ABSTRACT
Ribosomopathies arise from the disruptions in ribosome biogenesis within the nucleolus, which is organized via liquid-liquid phase separation (LLPS). The roles of LLPS in ribosomopathies remain poorly understood. Here, we generated human induced pluripotent stem cell (hiPSC) models of ribosomopathy caused by mutations in small nucleolar RNA (snoRNA) gene SNORD118. Mutant hiPSC-derived neural progenitor cells (NPCs) or neural crest cells (NCCs) exhibited ribosomopathy hallmark cellular defects resulting in reduced organoid growth, recapitulating developmental delay in patients. SNORD118 mutations in NPCs disrupted nucleolar morphology and LLPS properties coupled with impaired ribosome biogenesis and a translational downregulation of fibrillarin (FBL), the key LLPS effector acting via the intrinsically disordered region (IDR) motif. IDR-depleted FBL failed to rescue NPC defects, whereas a chimeric FBL with swapped IDR motif from an unrelated protein mitigated ribosomopathy and organoid growth defects. Thus, SNORD118 human iPSC models revealed aberrant phase separation and nucleolar functions as potential pathogenic mechanisms in ribosomopathies.
ABSTRACT
Background: Chronic obstructive pulmonary disease (COPD) stands as a predominant cause of global morbidity and mortality. This study aims to elucidate the relationship between pyroptosis-related genes (PRGs) and COPD diagnosis in the context of immune infiltration, ultimately proposing a PRG-based diagnostic model for predicting COPD outcomes. Methods: Clinical data and PRGs of COPD patients were sourced from the GEO database. The "ConsensusClusterPlus" package was employed to generate molecular subtypes derived from PRGs that were identified through differential expression analysis and LASSO Cox analysis. A diagnostic signature including eight genes (CASP4, CASP5, ELANE, GPX4, NLRP1, GSDME, NOD1and IL18) was also constructed. Immune cell infiltration calculated by the ESTIMATE score, Stroma scores and Immune scores were also compared on the basis of pyroptosis-related molecular subtypes and the risk signature. We finally used qRT - PCR to detect the expression levels of eight genes in COPD patient and normal. Results: The diagnostic model, anchored on eight PRGs, underwent validation with an independent experimental cohort. The area under the receiver operating characteristic (ROC) curves (AUC) for the diagnostic model showcased values of 0.809, 0.765, and 0.956 for the GSE76925, GSE8545, and GSE5058 datasets, respectively. Distinct expression patterns and clinical attributes of PRGs were observed between the comparative groups, with functional analysis underscoring a disparity in immune-related functions between them. Conclusion: In this study, we developed a potential as diagnostic biomarkers for COPD and have a significant role in modulating the immune response. Such insights pave the way for novel diagnostic and therapeutic strategies for COPD.
Subject(s)
Databases, Genetic , Predictive Value of Tests , Pulmonary Disease, Chronic Obstructive , Pyroptosis , Humans , Pulmonary Disease, Chronic Obstructive/genetics , Pulmonary Disease, Chronic Obstructive/diagnosis , Pulmonary Disease, Chronic Obstructive/immunology , Pyroptosis/genetics , Gene Expression Profiling , Lung/immunology , Male , Female , Middle Aged , Genetic Markers , Case-Control Studies , Transcriptome , Aged , Reproducibility of Results , Genetic Predisposition to Disease , PrognosisABSTRACT
BACKGROUND: Evidence has shown that the individual metrics in Life's Essential 8 (LE8), an updated cardiovascular health (CVH) concept proposed by the American Heart Association, play a role in the development of inflammatory bowel disease (IBD). However, epidemiological evidence on the overall LE8 on IBD risk remains limited. We aimed to assess the longitudinal associations of LE8-defined CVH and the risks of IBD and its subtypes, ulcerative colitis (UC) and Crohn's disease (CD). We also tested whether genetic susceptibility could modify these associations. METHODS: A total of 260,836 participants from the UK Biobank were included. LE8 scores were determined by 8 metrics (physical activity, diet, nicotine exposure, sleep, body mass index, blood pressure, blood glucose, and blood lipids), and were divided into three levels: low CVH (0-49), moderate CVH (50-79), and high CVH (80-100). Cox proportional hazards models were used to calculate the hazard ratios (HRs) and confidence intervals (CIs) of the risk of IBD in relation to CVH status. RESULTS: Over a median follow-up 12.3 years, we documented 1,500 IBD cases (including 1,070 UC and 502 CD). Compared to participants with low CVH, the HRs (95% CIs) of those with high CVH for IBD, UC, and CD were 0.67 (0.52, 0.83), 0.70 (0.52, 0.93), and 0.55 (0.38, 0.80), respectively. These associations were not modified by genetic susceptibility (all P for interactions > 0.05). The lowest HR (UC: 0.30, 95% CI: 0.20-0.45; CD: 0.33, 95% CI: 0.20-0.57) was observed in participants with both high CVH and low genetic risk. CONCLUSIONS: Better CVH, defined by LE8, was associated with significantly lower risks of IBD, UC, and CD, irrespective of genetic predisposition. Our results underscore the importance of adherence to LE8 guidelines for maintaining CVH as a potential strategy in the prevention of IBD.
Subject(s)
Crohn Disease , Diet , Genetic Predisposition to Disease , Inflammatory Bowel Diseases , Humans , Male , Female , Middle Aged , Risk Factors , United Kingdom , Adult , Inflammatory Bowel Diseases/genetics , Crohn Disease/genetics , Exercise , Aged , Body Mass Index , Colitis, Ulcerative/genetics , Cohort Studies , Proportional Hazards Models , Longitudinal Studies , Blood Pressure , Sleep , Blood Glucose/metabolismABSTRACT
The design of boron-based molecular rotors stems from boron-carbon binary clusters containing multiple planar hypercoordinate carbons (phCs, such as C2B8). However, the design of boron-coordinated phCs is challenging due to boron's tendency to occupy hypercoordinate centers more than carbon. Although this challenge has been addressed, the designed clusters of interest have not exhibited dynamic fluxionality similar to that of the initial C2B8. To address this issue, we report a σ/π doubly aromatic CB2H5+ cluster, the first global minimum containing a boron-coordinated planar tetracoordinate carbon atom with dynamic fluxionality. Dynamics simulations show that two ligand H atoms exhibit alternate rotation, resulting in an intriguing dynamic fluxionality in this cluster. Electronic structure analysis reveals the flexible bonding positions of the ligand H atoms because they do not participate in π delocalized bonding nor bond to any other non-carbon atom, highlighting this rotational fluxionality. Unprecedentedly, the fluxional process involves not only the usual conversion of the number of bonding atoms, but also the type of bonding (3c π bonds â 4c σ bonds), which is an uncommon fluxional mechanism. The cluster represents an effort to apply phC species to molecular machines.
ABSTRACT
The fermentation process has a significant impact on the aromatic profile of wines, particularly in relation to the difference in fermentation matrix caused by grape varieties. This study investigates the leaching and evolution patterns of aroma compounds in Vitis vinifera L. Marselan and Merlot during an industrial-scale vinification process, including the stages of cold soak, alcohol fermentation, malolactic fermentation, and one-year bottle storage. The emphasis is on the differences between the two varieties. The results indicated that most alcohols were rapidly leached during the cold soak stage. Certain C6 alcohols, terpenes, and norisoprenoids showed faster leaching rates in 'Marselan', compared to 'Merlot'. Some branched chain fatty-acid esters, such as ethyl 3-methylbutyrate, ethyl 2-methylbutyrate, and ethyl lactate, consistently increased during the fermentation and bottling stages, with faster accumulation observed in 'Marselan'. The study combines the Orthogonal Partial Least Squares-Discriminant Analysis (OPLS-DA) model based on odor activity values to elucidate the accumulation of these ethyl esters during bottle storage, compensating for the reduction in fruity aroma resulting from decreased levels of (E)-ß-damascenone. The 'Marselan' wine exhibited a more pronounced floral aroma due to its higher level of linalool, compared to the 'Merlot' wine. The study unveils the distinctive variation patterns of aroma compounds from grapes to wine across grape varieties. This provides a theoretical framework for the precise regulation of wine aroma and flavor, and holds significant production value.
Subject(s)
Fermentation , Odorants , Vitis , Volatile Organic Compounds , Wine , Vitis/chemistry , Wine/analysis , Odorants/analysis , Volatile Organic Compounds/analysis , Fruit/chemistry , Alcohols/analysis , Terpenes/analysis , Gas Chromatography-Mass SpectrometryABSTRACT
Vitis amurensis grape, an East Asian Vitis species, has excellent cold and disease resistance and exhibits high winemaking potential. In this study, the aroma compounds in grapes from five V. amurensis cultivars ('Beiguohong', 'Beiguolan', 'Shuangfeng', 'Shuanghong', 'Shuangyou') and three interspecific hybrids ('Beibinghong', 'Xuelanhong', 'Zuoyouhong') from two regions (Zuojia and Ji'an, Jilin, China) were identified via HS-SPME-GC/MS. The results showed that V. amurensis grapes had a greater concentration of aroma compounds than the interspecific hybrid berries. 'Beibinghong' was relatively rich in terpenes, although their concentrations were all lower than the threshold. 'Shuangfeng' contained more concentrations of free C6/C9 compounds, alcohols, aromatics and aldehydes/ketones than the other cultivars. The aroma characteristics of 'Beiguolan' and 'Shuanghong' were relatively similar. The grapes from the lower temperature and more fertile soil of Zuojia contained more C6/C9 compounds, norisoprenoids and alcohols, while aromatics were more abundant in the grapes from Ji'an, which was warmer than the Zuojia region. Herbaceous, floral, fruity and sweet were the main aroma series of V. amurensis grapes. Our study could provide a reference for the development and utilization of V. amurensis grapes and lay a foundation for the development of wild grape cultivars and the production of wines with characteristic styles.
Subject(s)
Fruit , Gas Chromatography-Mass Spectrometry , Genotype , Odorants , Vitis , Volatile Organic Compounds , Wine , Vitis/chemistry , Vitis/genetics , Vitis/classification , Odorants/analysis , Volatile Organic Compounds/analysis , Fruit/chemistry , Wine/analysis , China , Hybridization, Genetic , Solid Phase MicroextractionABSTRACT
Iron ion (Fe3+) detection is crucial for human health since it plays a crucial role in many physiological activities. In this work, a novel Schiff-base functionalized cyanine derivative (CyPy) was synthesized, which was successfully assembled on the surface of upconversion nanoparticles (UCNPs) through an amphiphilic polymer encapsulation method. In the as-designed nanoprobe, CyPy, a recognizer of Fe3+, is served as energy donor and ß-NaYF4:Yb,Er upconversion nanoparticles are adopted as energy acceptor. As a result, a 93-fold enhancement of upconversion luminescence is achieved. The efficient energy transfer from CyPy to ß-NaYF4:Yb,Er endows the nanoprobe a high sensitivity for Fe3+ in water with a low detection limit of 0.21 µM. Moreover, the nanoprobe has been successfully applied for Fe3+ determination in human serum and tap water samples with recovery ranges of 95 %-105 % and 97 %-106 %, respectively. Moreover, their relative standard deviations are all below 3.72 %. This work provides a sensitive and efficient methodology for Fe3+ detection in clinical and environmental testing.
ABSTRACT
PURPOSE: To study the stability of physicochemical properties and sterilizing effect about two commercially available hypochlorous acid (HClO) products under simulated clinical conditions, and to evaluate the compatibility of HClO on soft and hard tissues and cells in oral cavity. METHODS: Samples of HClO solution with different production processes were prepared, to detect the changes of physicochemical indexes of each sample over time under simulated clinical conditions (shielded from light at 20-25 â, open the cover for 5 minutes every day), including free available chlorine, oxidation-reduction potential and pH. Through suspension quantitative germicidal test, the antibiosis-concentration curve of HClO solution was made, so as to calibrate the change of antibacterial ability of disinfectant with the decrease of available chlorine content during storage. Pulp, tongue and dentine were immersed in PBS, 100 ppm HClO, 200 ppm HClO and 3% NaClO. The influence on soft and hard tissues was evaluated by weighing method and microhardness test. The toxic effects of HClO, NaClO and their 10-fold diluent on human gingival fibroblasts were determined by CCK-8 cytotoxicity assay. GraphPad PRIS 8.0 software was used to analyze the data. RESULTS: Under simulated conditions, the free available chlorine (FAC) of HClO solution decayed with time, and the attenuation degree was less than 20 ppm within 1 month. The bactericidal effect of each HClO sample was still higher than 5log after concentration decay. There was no obvious dissolution and destruction to soft and hard tissues for HClO(Pï¼0.05). The cell viability of HClO to human gingival fibroblast cells (HGFC) was greater than 80%, which was much higher than 3% NaClO (Pï¼0.001). CONCLUSIONS: The bactericidal effect and stability of HClO solution can meet clinical needs, which has low cytotoxicity and good histocompatibility. It is expected to become a safe and efficient disinfection product in the field of living pulp preservation and dental pulp regeneration.
Subject(s)
Fibroblasts , Hypochlorous Acid , Mouth , Hypochlorous Acid/chemistry , Humans , Mouth/drug effects , Fibroblasts/drug effects , Gingiva/cytology , Gingiva/drug effects , Irritants , Disinfectants/pharmacology , Disinfectants/chemistry , Anti-Bacterial Agents/pharmacology , Anti-Bacterial Agents/chemistryABSTRACT
In this study, the electric energy harvesting capability of the hierarchical pore gradient silica aerogel (HPSA) is demonstrated due to its unique porous structure and inherent hydroxyl groups on the surface. Taking advantage of the positively charged surface of unwashed HPSA credited by the preparation strategy, poly(4-styrene sulfonic acid) (PSS) can be spontaneously adsorbed onto unwashed HPSA and shows gradient distribution due to the pore-gradient structure of HPSA. By virtue of the gradient distribution and the stronger ionization of PSS, PSS-modified HPSA (PSS-HPSA) shows enhanced electricity generation performance from natural water evaporation with an average output voltage of 0.77 V on an individual device. The water evaporation-induced electricity property of PSS-HPSA can be maintained in the presence of a low concentration of salt. The desirable salt resistance capability benefits from the unique 3D hierarchical porous structure of HPSA which ensures rapid water replenishment so as to effectively avoid the salt accumulation. The HPSA-based devices with the advantages of unique porous structure, easy functionalization, good physicochemical stability, good salt resistance capability, and eco-friendliness show great potential as water evaporation-induced electricity generators.
ABSTRACT
Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.
ABSTRACT
OBJECTIVE: To compare the differences between Ultrasound Volume Navigation (UVN), O-arm Navigation, and conventional X-ray fluoroscopy-guided screw placement in Minimally Invasive Transforaminal Lumbar Interbody Fusion (MIS-TLIF) surgeries. METHODS: A total of 90 patients who underwent MIS-TLIF due to lumbar disc herniation from January 2022 to January 2023 were randomly assigned to the UVN group, O-arm group, and X-ray group. UVN, O-arm navigation, and X-ray guidance were used for screw placement in the respective groups, while the remaining surgical procedures followed routine MIS-TLIF protocols. Intraoperative data including average single screw placement time, total radiation dose, and average effective radiation dose per screw were recorded and calculated. On the 10th day after surgery, postoperative X-ray and CT examinations were conducted to assess screw placement accuracy and facet joint violation. RESULTS: There were no significant differences in general characteristics among the three groups, ensuring comparability. Firstly, the average single screw placement time in the O-arm group was significantly shorter than that in the UVN group and X-ray group (P<0.05). Secondly, in terms of total radiation dose during surgery, for single-level MIS-TLIF, the O-arm group had a significantly higher radiation dose compared to the UVN group and X-ray group (P<0.05). However, for multi-level MIS-TLIF, the X-ray group had a significantly higher radiation dose than the O-arm group and UVN group (P<0.05). In terms of average single screw radiation dose, the O-arm group and X-ray group were similar (P>0.05), while the UVN group was significantly lower than the other two groups (P<0.05). Furthermore, no significant differences were found in screw placement assessment grades among the three groups (P>0.05). However, in terms of facet joint violation rate, the UVN group (10.3%) and O-arm group (10.7%) showed no significant difference (P>0.05), while the X-ray group (26.7%) was significantly higher than both groups (P<0.05). Moreover, in the UVN group, there were significant correlations between average single screw placement time and placement grade with BMI index (r = 0.637, P<0.05; r = 0.504, P<0.05), while no similar significant correlations were found in the O-arm and X-ray groups. CONCLUSION: UVN-guided screw placement in MIS-TLIF surgeries demonstrates comparable efficiency, visualization, and accuracy to O-arm navigation, while significantly reducing radiation exposure compared to both O-arm navigation and X-ray guidance. However, UVN may be influenced by factors like obesity, limiting its application.
ABSTRACT
The layered chalcogenide ZnIn2S4 (ZIS) exhibits photo-stability and a tunable band gap but is limited in photocatalytic applications, such as hydrogen (H2) production, due to rapid carrier recombination and slow charge separation. To overcome these limitations, we have synthesized a ternary MoS2/ZIS/graphene quantum dots (GQDs) heterojunction, wherein MoS2 and GQDs are strategically attached to ZIS interlaced nanoflakes, enhancing light absorption across the 500-1500 nm range. This heterojunction benefits from dual S-scheme interfaces between MoS2-ZIS and ZIS-GQDs, establishing directed internal electric fields (IEFs). These IEFs accelerate the transfer of photoinduced electrons from the conduction bands of MoS2 and GQDs to the valence band of ZIS, promoting rapid recombination with holes and facilitating efficient catalytic reactions with plentiful photoinduced electrons stemmed from the conduction band of ZIS. As a result, the photocatalytic H2 production rate of the MoS2/ZIS/GQDs heterojunction is measured at 21.63 mmol h-1 g-1, marking an increase of 36.7 times over pure ZIS. This research provides valuable insights into designing novel heterojunctions for improved charge separation and transfer for solar energy conversion applications.
ABSTRACT
This study aimed to clarify how microclimate diversity altered volatilomics in Cabernet Sauvignon grapes and wines. Four row-oriented vineyards were selected, and metabolites of grapes and wines were determined from separate canopy sides. Results showed that shaded sides received 59% of the solar radiation and experienced 55% of the high-temperature days compared to the exposed sides on average. Grape primary metabolites were slightly affected by the canopy side. Herbaceous aromas were consistently more abundant in grapes and wines from shaded clusters. Heat-stressed canopy sides accelerated terpenoid loss and increased norisoprenoid levels in grapes, while ß-damascenone in north-side wines was 13%-32% higher than that in south-side wines of the east-west vineyard. The northeast-southwest vineyard showed the most notable variation in taste and aroma sensory scores, with four parameters significantly different. There were 32 aroma series identified in wines, and banana, pineapple, and strawberry odors were highly correlated with aroma sensory score.
ABSTRACT
Stereo matching and instrument segmentation of laparoscopic surgical scenarios are key tasks in robotic surgical automation. Many researchers have been studying the two tasks separately for stereo matching and instrument segmentation. However, the relationship between these two tasks is often neglected. In this paper, we propose a model framework for multi-tasking with complementary functions for stereo matching and surgical instrument segmentation (MCF-SMSIS). We aim to complement the features of instrument prediction segmentation to the parallax matching block of stereo matching. We also propose two new evaluation metrics (MINPD and MAXPD) for assessing how well the parallax range matches the migrated domain when the model used for the stereo matching task undergoes domain migration. We performed stereo matching experiments on the SCARED , SERV-CT dataset as well as instrumentation segmentation experiments on the AutoLaparo dataset. The results demonstrate the effectiveness of the proposed method. In particular, stereo matching supplemented with instrument features reduced EPE, >3px and RMSE Depth in the surgical instrument section by 9.5%, 12.7% and 6.51%, respectively. The instrumentation segmentation performance also achieves a DSC value of 0.9233. Moreover, MCF-SMSIS takes only 0.14 s to infer a set of images. The model code and model weights for each stage are available from https://github.com/wurenkai/MCF-SMSIS.
ABSTRACT
We aimed to investigate the species composition of a small mammal community and the prevalence of Echinococcus spp. in a typical endemic area of the Tibetan Plateau. One pika and five rodent species were identified based on the morphological characteristics of 1278 small mammal specimens collected during 2014-2019. Detection of Echinococcus DNA in tissue samples from small mammal specimens revealed that Ochotona curzoniae (pika, total prevalence: 6.02%, 26/432), Neodon fuscus (5.91%, 38/643), N. leucurus (2.50%, 3/120), and Alexandromys limnophilus (21.74%, 10/46) were infected by both E. multilocularis and E. shiquicus; Cricetulus longicaudatus (16.67%, 1/6) was infected by E. shiquicus; and no infection was detected in N. irene (0/15). Neodon fuscus and O. curzoniae were the two most abundant small mammal species. There was no significant difference in the prevalence of pika and the overall rodent species assemblage (6.26%, 53/846); however, the larger rodent populations suggested that more attention should be paid to their role in the transmission of echinococcosis in the wildlife reservoir, which has long been underestimated. Moreover, although DNA barcoding provides a more efficient method than traditional morphological methods for identifying large numbers of small mammal samples, commonly used barcodes failed to distinguish the three Neodon species in this study. The close genetic relationships between these species suggest the need to develop more powerful molecular taxonomic tools.
ABSTRACT
BACKGROUND: Hypertensive nephropathy (HN) is one of the main causes of end-stage renal disease (ESRD), leading to serious morbidity and mortality in hypertensive patients. However, existing treatment for hypertensive nephropathy are still very limited. It has been demonstrated that aerobic exercise has beneficial effects on the treatment of hypertension. However, the underlying mechanisms of exercise in HN remain unclear. METHODS: The spontaneously hypertensive rats (SHR) were trained for 8 weeks on a treadmill with different exercise prescriptions. We detected the effects of moderate intensity continuous training (MICT) and high intensity interval training (HIIT) on inflammatory response, renal function, and renal fibrosis in SHR. We further investigated the relationship between TLR4 and the NLRC4 inflammasome in vitro HN model. RESULTS: MICT improved renal fibrosis and renal injury, attenuating the inflammatory response by inhibiting TLR4/NF-κB pathway and the activation of NLRC4 inflammasome. However, these changes were not observed in the HIIT group. Additionally, repression of TLR4/NF-κB pathway by TAK-242 inhibited activation of NLRC4 inflammasome and alleviated the fibrosis in Ang II-induced HK-2 cells. CONCLUSION: MICT ameliorated renal damage, inflammatory response, and renal fibrosis via repressing TLR4/NF-κB pathway and the activation of NLRC4 inflammasome. This study might provide new references for exercise prescriptions of hypertension.
Subject(s)
Calcium-Binding Proteins , Inflammasomes , NF-kappa B , Nephritis , Rats, Inbred SHR , Signal Transduction , Toll-Like Receptor 4 , Animals , Toll-Like Receptor 4/metabolism , NF-kappa B/metabolism , Inflammasomes/metabolism , Rats , Calcium-Binding Proteins/metabolism , Male , Nephritis/metabolism , Nephritis/pathology , Hypertension, Renal/metabolism , Hypertension, Renal/pathology , Fibrosis , Down-Regulation , Humans , Exercise Therapy/methods , Kidney/pathology , Kidney/metabolismABSTRACT
OBJECTIVE: To describe multimodal imaging of peculiar bilateral globular subretinal deposits and acquired serous retinal detachment in patients with systemic immunoglobulin light chain deposition. DESIGN: A retrospective observational case series. PARTICIPANTS: We examined six eyes in three patients (one with multiple myeloma, one with membranous nephropathy, and one with immunoglobulin A nephropathy) at the Eye and ENT Hospital of Fudan University. The patients presented with peculiar globular subretinal deposits along the retinal pigment epithelium (RPE)âBruch's membrane complex and acquired serous retinal detachment. METHODS: Fundus appearance was documented with multimodal imaging, which included fundus photography, fundus autofluorescence, spectral domain optical coherence tomography (OCT), swept-source OCT (SS-OCT), en-face OCT, and SS-OCT angiography. Additional evaluations included serum protein electrophoreses, positron emission tomography computed tomography, and renal and bone biopsies to assess the primary diseases. MAIN OUTCOME MEASURES: Multimodal imaging, course, and prognosis of bilateral RPE immunoglobulin light chain deposition in patients with systemic immunoglobulin light chain deposition. RESULTS: Bilateral, multiple, speckled, or patchy RPE changes in the posterior fundus that corresponded to striking multifocal hyperautofluorescence on fundus autofluorescence and lumpy, globular hyperreflective deposits along the RPEâBruch's membrane complex were identified as characteristic features of bilateral RPE light chain deposition. These features may be accompanied by dense light chain deposits in the choriocapillaris and choroid vessels, diffuse choroidal thickening, and "angiographically silent" serous retinal detachment in patients with systemic immunoglobulin light chain deposition. CONCLUSIONS: We have documented the characteristic features, clinical course, and prognosis of bilateral RPE immunoglobulin light chain deposition in patients with systemic immunoglobulin light chain deposition. Appropriate evaluations, including serum protein electrophoresis and hematologic consultation, are recommended to manage patients with this fundus abnormality.
ABSTRACT
OBJECTIVE: To investigate the characteristics of the CD8+ T cells infiltration from the 4 subtypes in medulloblastoma (MB), to analyze the relationship between CD8+ T cells infiltration and prognosis, to study the function of C-X-C motif chemokine ligand 11 (CXCL11) and its receptor in CD8+ T cells infiltration into tumors and to explore the potential mechanism, and to provide the necessary clinicopathological basis for exploring the immunotherapy of MB. METHODS: In the study, 48 clinical MB samples (12 cases in each of 4 subtypes) were selected from the multiple medical center from 2012 to 2019. The transcriptomics analysis for the tumor of 48 clinical samples was conducted on the NanoString PanCancer IO360TM Panel (NanoString Technologies). Immunohistochemistry (IHC) staining of formalin-fixed, paraffin-embedded sections from MB was carried out using CD8 primary antibody to analyze diffe-rential quantities of CD8+ T cells in the MB four subtypes. Through bioinformatics analysis, the relationship between CD8+T cells infiltration and prognosis of the patients and the expression differences of various chemokines in the different subtypes of MB were investigated. The expression of CXCR3 receptor on the surface of CD8+T cells in MB was verified by double immunofluorescence staining, and the underlying molecular mechanism of CD8+T cells infiltration into the tumor was explored. RESULTS: The characteristic index of CD8+T cells in the WNT subtype of MB was relatively high, suggesting that the number of CD8+T cells in the WNT subtype was significantly higher than that in the other three subtypes, which was confirmed by CD8 immunohistochemical staining and Gene Expression Omnibus (GEO) database analysis by using R2 online data analysis platform. And the increase of CD8+T cells infiltration was positively correlated with the patient survival. The expression level of CXCL11 in the WNT subtype MB was significantly higher than that of the other three subtypes. Immunofluorescence staining showed the presence of CXCL11 receptor, CXCR3, on the surface of CD8+T cells, suggesting that the CD8+T cells might be attracted to the MB microenvironment by CXCL11 through CXCR3. CONCLUSION: The CD8+T cells infiltrate more in the WNT subtype MB than other subtypes. The mechanism may be related to the activation of CXCL11-CXCR3 chemokine system, and the patients with more infiltration of CD8+T cells in tumor have better prognosis. This finding may provide the necessary clinicopathological basis for the regulatory mechanism of CD8+T cells infiltration in MB, and give a new potential therapeutic target for the future immunotherapy of MB.
Subject(s)
CD8-Positive T-Lymphocytes , Chemokine CXCL11 , Medulloblastoma , Receptors, CXCR3 , Humans , CD8-Positive T-Lymphocytes/immunology , CD8-Positive T-Lymphocytes/metabolism , Medulloblastoma/immunology , Medulloblastoma/pathology , Medulloblastoma/classification , Medulloblastoma/genetics , Medulloblastoma/metabolism , Receptors, CXCR3/metabolism , Receptors, CXCR3/genetics , Chemokine CXCL11/metabolism , Chemokine CXCL11/genetics , Prognosis , Lymphocytes, Tumor-Infiltrating/immunology , Lymphocytes, Tumor-Infiltrating/metabolism , Cerebellar Neoplasms/immunology , Cerebellar Neoplasms/pathology , Cerebellar Neoplasms/genetics , Cerebellar Neoplasms/classification , Cerebellar Neoplasms/metabolism , Male , FemaleABSTRACT
In recent years, increased species extinction and habitat loss have significantly reduced biodiversity, posing a serious threat to both nature and human survival. Environmental factors strongly influence bird distribution and diversity. The potential distribution patterns and species richness offer a conservation modeling framework for policymakers to assess the effectiveness of natural protected areas (PAs) and optimize their existing ones. Very few such studies have been published that cover a large and complete taxonomic group with fine resolution at regional scale. Here, using birds as a study group, the maximum entropy model (MaxEnt) was used to analyze the pattern of bird species richness in Jiangsu Province. Using an unparalleled amount of occurrence data, we created species distribution models (SDMs) for 312 bird species to explore emerging diversity patterns at a resolution of 1 km2. The gradient of species richness is steep, decreasing sharply away from water bodies, particularly in the northern part of Jiangsu Province. The migratory status and feeding habits of birds also significantly influence the spatial distribution of avian species richness. This study reveals that the regions with high potential bird species richness are primarily distributed in three areas: the eastern coastal region, the surrounding area of the lower reaches of the Yangtze River, and the surrounding area of Taihu Lake. Compared with species richness hotspots and existing PAs, we found that the majority of hotspots are well-protected. However, only a small portion of the regions, such as coastal areas of Sheyang County in Yancheng City, as well as some regions along the Yangtze River in Nanjing and Zhenjiang, currently have relatively weak protection. Using stacked SDMs, our study reveals effective insights into diversity patterns, directly informing conservation policies and contributing to macroecological research advancements.