ABSTRACT
BACKGROUND: Due to the narrow therapeutic window and large pharmacokinetic variation of valproic acid (VPA), it is difficult to make an optimal dosage regimen. The present study aims to optimize the initial dosage of VPA in patients with bipolar disorder. METHODS: A total of 126 patients with bipolar disorder treated by VPA were included to construct the VPA population pharmacokinetic model retrospectively. Sex differences and combined use of clozapine were found to significantly affect VPA clearance in patients with bipolar disorder. The initial dosage of VPA was further optimized in male patients without the combined use of clozapine, female patients without the combined use of clozapine, male patients with the combined use of clozapine, and female patients with the combined use of clozapine, respectively. RESULTS: The CL/F and V/F of VPA in patients with bipolar disorder were 11.3 L/h and 36.4 L, respectively. It was found that sex differences and combined use of clozapine significantly affected VPA clearance in patients with bipolar disorder. At the same weight, the VPA clearance rates were 1.134, 1, 1.276884, and 1.126 in male patients without the combined use of clozapine, female patients without the combined use of clozapine, male patients with the combined use of clozapine, and female patients with the combined use of clozapine, respectively. This study further optimized the initial dosage of VPA in male patients without the combined use of clozapine, female patients without the combined use of clozapine, male patients with the combined use of clozapine, and female patients with the combined use of clozapine, respectively. CONCLUSION: This study is the first to investigate the initial dosage optimization of VPA in patients with bipolar disorder based on sex differences and the combined use of clozapine. Male patients had higher clearance, and the recommended initial dose decreased with increasing weight, providing a reference for the precision drug use of VPA in clinical patients with bipolar disorder.
ABSTRACT
Background: The present study aimed to investigate the drug-drug interaction and initial dosage optimization of aripiprazole in patients with schizophrenia based on population pharmacokinetics. Research design and methods: A total of 119 patients with schizophrenia treated with aripiprazole were included to build an aripiprazole population pharmacokinetic model using nonlinear mixed effects. Results: The weight and concomitant medication of fluoxetine influenced aripiprazole clearance. Under the same weight, the aripiprazole clearance rates were 0.714:1 in patients with or without fluoxetine, respectively. In addition, without fluoxetine, for the once-daily aripiprazole regimen, dosages of 0.3 and 0.2 mg kg-1 day-1 were recommended for patients with schizophrenia weighing 40-95 and 95-120 kg, respectively, while for the twice-daily aripiprazole regimen, 0.3 mg kg-1 day-1 was recommended for those weighing 40-120 kg. With fluoxetine, for the once-daily aripiprazole regimen, a dosage of 0.2 mg kg-1 day-1 was recommended for patients with schizophrenia weighing 40-120 kg, while for the twice-daily aripiprazole regimen, 0.3 and 0.2 mg kg-1 day-1 were recommended for those weighing 40-60 and 60-120 kg, respectively. Conclusion: This is the first investigation of the effects of fluoxetine on aripiprazole via drug-drug interaction. The optimal aripiprazole initial dosage is recommended in patients with schizophrenia.
ABSTRACT
In recent years, inflammatory disorders have emerged as a significant concern for human health. Through ongoing research on anti-inflammatory agents, alpinetin has shown promising anti-inflammatory properties, including involvement in epigenetic modification pathways. As a crucial regulator of epigenetic modifications, Mecp2 may play a role in modulating the epigenetic effects of alpinetin, potentially impacting its anti-inflammatory properties. To test this hypothesis, two key components, p65 (a member of NF-KB family) and p300 (a type of co-activator), were screened by the expression profiling microarray, which exhibited a strong correlation with the intensity of LPS stimulation in mouse macrophages. Meanwhile, alpinetin demonstrates the anti-inflammatory properties through its ability to disrupt the synthesis of p65 and its interaction with promoters of inflammatory genes, yet it did not exhibit similar effects on p300. Additionally, Mecp2 can inhibit the binding of p300 by attaching to the methylated inflammatory gene promoter induced by alpinetin, leading to obstacles in promoter acetylation and subsequently impacting the binding of p65, ultimately enhancing the anti-inflammatory capabilities of alpinetin. Similarly, in a sepsis mouse model, it was observed that homozygotes overexpressing Mecp2 showed a greater reduction in organ damage and improved survival rates compared to heterozygotes when administered by alpinetin. However, blocking the expression of DNA methyltransferase 3A (DNMT3A) resulted in the loss of Mecp2's anti-inflammatory assistance. In conclusion, Mecp2 may augment the anti-inflammatory effects of alpinetin through epigenetic 'crosstalk', highlighting the potential efficacy of a combined therapeutic strategy involving Mecp2 and alpinetin for anti-inflammatory intervention.
Subject(s)
Anti-Inflammatory Agents , Epigenesis, Genetic , Flavanones , Methyl-CpG-Binding Protein 2 , Promoter Regions, Genetic , Methyl-CpG-Binding Protein 2/metabolism , Methyl-CpG-Binding Protein 2/genetics , Animals , Flavanones/pharmacology , Epigenesis, Genetic/drug effects , Mice , Anti-Inflammatory Agents/pharmacology , RAW 264.7 Cells , DNA Methylation/drug effects , Lipopolysaccharides/pharmacology , Transcription Factor RelA/metabolism , Sepsis/drug therapy , Sepsis/genetics , Sepsis/metabolism , Macrophages/metabolism , Macrophages/drug effects , Inflammation/drug therapy , Inflammation/pathology , Inflammation/genetics , Inflammation/metabolism , DNA Methyltransferase 3A/metabolism , Male , E1A-Associated p300 Protein/metabolism , Disease Models, Animal , Mice, Inbred C57BL , DNA (Cytosine-5-)-Methyltransferases/metabolism , DNA (Cytosine-5-)-Methyltransferases/geneticsABSTRACT
Dexamethasone (DEX) has been demonstrated to inhibit the inflammatory corneal neovascularization (CNV). However, the therapeutic efficacy of DEX is limited by the poor bioavailability of conventional eye drops and the increased risk of hormonal glaucoma and cataract associated with prolonged and frequent usage. To address these limitations, we have developed a novel DEX-loaded, reactive oxygen species (ROS)-responsive, controlled-release nanogel, termed DEX@INHANGs. This advanced nanogel system is constructed by the formation of supramolecular host-guest complexes by cyclodextrin (CD) and adamantane (ADA) as a cross-linking force. The introduction of the ROS-responsive material, thioketal (TK), ensures the controlled release of DEX in response to oxidative stress, a characteristic of CNV. Furthermore, the nanogel's prolonged retention on the corneal surface for over 8 h is achieved through covalent binding of the integrin ß1 fusion protein, which enhances its bioavailability. Cytotoxicity assays demonstrated that DEX@INHANGs was not notably toxic to human corneal epithelial cells (HCECs). Furthermore, DEX@INHANGs has been demonstrated to effectively inhibit angiogenesis in vitro. In a rabbit model with chemically burned eyes, the once-daily topical application of DEX@INHANGs was observed to effectively suppress CNV. These results collectively indicate that the nanomedicine formulation of DEX@INHANGs may offer a promising treatment option for CNV, offering significant advantages such as reduced dosing frequency and enhanced patient compliance.
ABSTRACT
BACKGROUND: Vector mosquito control is important for preventing and controlling mosquito-borne infectious diseases. This study designed and developed a mosquito killer (MK) with a specific light wavelength, simulated human body temperature, human odor, and a photocatalyst to stimulate CO2 based on the physiological characteristics and ecological habits of mosquitoes. We tested the trapping effect of individual and multiple mosquito-trapping elements of the MK through two-way selection experiments and compared them with several commercial mosquito traps. RESULTS: The 365 nm wavelength MK was significantly more effective than the 395 nm (Cx. quinquefasciatus: 62.00% vs. 34.25%; Ae. albopictus: 50.75% vs 45.00%, An. sinensis: 49.75% vs 39.00%). Mosquitoes captured by the MK with heaters at 365 nm were significantly more than those captured by the MK without heaters at 365 nm. A trap with a 365 nm wavelength, heating element, and lure showed significantly better capture effectiveness than MK with a 365 nm wavelength, heating element, but without lure (Cx. quinquefasciatus: 67.00% vs. 29.75%, Ae. albopictus: 60.25% vs 36.25%, An. sinensis: 49.75% vs 39.75%). The coated photocatalyst trap with a 365 nm wavelength, heating element, and lure showed significantly better capture effectiveness than the trap without coating (Cx. quinquefasciatus: 54.25% vs. 42.50%; Ae. albopictus: 53.50% vs 44.00%, An. sinensis: 50.00% vs 41.25%). This trap demonstrated a significantly better capture advantage for Cx. quinquefasciatus and Ae. albopictus compared to the three commercial products. CONCLUSION: The developed mosquito trap with multiple attractant factors significantly enhanced the capture effectiveness of common mosquitoes. © 2024 Society of Chemical Industry.
ABSTRACT
BACKGROUND: In certain situations, masks are worn during sleep to prevent respiratory infections. However, the effects of mask wearing on cardiopulmonary function during sleep are unknown. This study aimed to determine whether wearing masks during sleep has an impact on cardiopulmonary function, including in patients with obstructive sleep apnea. METHODS: This was a prospective, randomized crossover-controlled trial. The effects of wearing surgical masks or N95 respirators on cardiopulmonary function were measured in healthy subjects and patients with mild-moderate obstructive sleep apnea. Sleep breathing parameters were monitored during nocturnal sleep using a sleep monitor, and subjective feelings about mask wearing were assessed using a questionnaire. RESULTS: Wearing masks during sleep at night did not significantly impact sleep breathing parameters. Furthermore, there were no significant differences in heart rate, blood oxygenation, and blood pressure before and after wearing masks. However, masks wearing, especially wearing N95 mask, had an adverse impact on sleep quality and were subjectively uncomfortable. CONCLUSIONS: Wearing masks during sleep at night does not adversely affect cardiopulmonary function but it's uncomfortable, especially N95 mask. Thus, in circumstances where wearing N95 masks during nocturnal sleep proves intolerable, we recommend the use of surgical masks as a more comfortable alternative.
ABSTRACT
A systematic review and meta-analysis were performed to investigate the efficacy of the AirSeal Valveless Trocar Needle Insufflation System in robot-assisted partial nephrectomy (RAPN). The study compared the differences in perioperative outcomes between the AirSeal insufflation group (AIS) and the conventional insufflation group (CIS). A systematic search of databases such as PubMed, Embase, Cochrane library, and Web of science was performed to identify studies reporting perioperative outcomes between the AirSeal insufflation group (AIS) and the conventional insufflation group (CIS) in RAPN. The study protocol is registered with PROSPERO (CRD42024524335). The primary outcome was to compare the incidence of subcutaneous emphysema (SCE) and postoperative pain scores between the two approaches. The review included four studies with 379 patients, 194 in the AIS group and 185 in the CIS group. Baseline characteristics of the two groups were similar in all outcomes. SCE was significantly lower in the AIS group than in the CIS group [(OR) 0.30 (0.16, 0.54), p < 0.001]. Postoperative 12-h pain scores were also significantly lower in the AIS group compared to the CIS group [(WMD) - 0.93 (- 1.67, - 1.09), p = 0.014]. Both groups showed a significant reduction in length of hospitalization [(WMD) - 0.12 (- 0.84, 0.60), p = 0.746], thermal ischemia time [(WMD) 4.72 (- 5.71, 15.15), p = 0.375], amount of lost hemoglobin [(WMD) - 0.19 (- 0.53, 0.15), p = 0.284], pneumothorax [(OR) 0.13 (0.02,1.10), p = 0.062], mediastinal emphysema [(OR) 0.55 (0.20, 1.46), p = 0.230], and 4-h pain score [(WMD) - 0.25 (- 1.16, 0.65), p = 0.584]; no significant differences were observed. The incidence of subcutaneous emphysema SCE and 12-h pain scores were significantly lower in the AIS group compared to the CIS group. The AirSeal system demonstrated similar efficacy and a higher safety profile than the conventional insufflation system in robotic-assisted partial nephrectomy; however, due to the lack of a randomized study on the topic, further data are needed.
Subject(s)
Insufflation , Nephrectomy , Robotic Surgical Procedures , Robotic Surgical Procedures/methods , Robotic Surgical Procedures/adverse effects , Robotic Surgical Procedures/instrumentation , Humans , Nephrectomy/methods , Nephrectomy/adverse effects , Insufflation/methods , Pain, Postoperative/etiology , Pain, Postoperative/prevention & control , Subcutaneous Emphysema/etiology , Subcutaneous Emphysema/prevention & control , Treatment Outcome , Postoperative Complications/etiology , Postoperative Complications/epidemiology , Postoperative Complications/prevention & control , Kidney Neoplasms/surgeryABSTRACT
Purpose: This study evaluated the first clinical implementation of daily iterative cone beam computed tomography (iCBCT)-guided online adaptive radiation therapy (oART) in the postoperative treatment of endometrial and cervical cancer. Methods and Materials: Seventeen consecutive patients treated with daily iCBCT-guided oART were enrolled in this prospective study, with a reduced uniform 3-dimensional PTV margin of 5 mm. Treatment plans were designed to deliver 45 or 50.4 Gy in 1.8 Gy daily fractions to PTV. Pre- and posttreatment ultrasound and iCBCT scans were performed to record intrafractional bladder and rectal volume changes. The accuracy of contouring, oART procedure time, dosimetric outcomes, and acute toxicity were evaluated. Results: The average time from first iCBCT acquisition to completion of treatment was 22 minutes and 26 seconds. During this period, bladder volume increased by 44 cm3 using iCBCT contouring, whereas rectal volume remained stable (62.9 cm3 pretreatment vs 61.9 cm3 posttreatment). A total of 91.6% of influencers and 88.1% of CTVs required no or minor edits. The adapted plan was selected in all (434) fractions and significantly improved the dosimetry coverage for CTV and PTV, especially the vaginal PTV coverage by nearly 7% (P < .05). The adapted bladder Dmean was 104.61 cGy, and the rectum Dmean was 123.67 cGy, significantly lower than the scheduled plan of 108.24 and 128.19 cGy, respectively. The bone marrow and femur head left and right dosimetry were also improved with adaptation. Grade 2 acute gastrointestinal and genitourinary toxicities were 24% and 0, respectively. There was a grade 3 acute toxicity of decreased white blood cell count in 1 patient. Conclusions: Daily oART was associated with favorable dosimetry improvement and low acute toxicity, supporting its safety and efficacy for postoperative treatment of endometrial and cervical cancer. These results need to be validated in a larger prospective randomized controlled cohort.
ABSTRACT
BACKGROUND: For patients with stage III epithelial ovarian cancer, there are limited studies on the effects of postoperative adjuvant radiotherapy (RT). Here we assessed the therapeutic efficacy and toxicity of postoperative radiotherapy to the abdominal and pelvic lymphatic drainage area for stage III epithelial ovarian cancer patients, who had all received surgery and chemotherapy (CT). METHODS: We retrospectively collected patients with stage III epithelial ovarian cancer after cytoreductive surgery (CRS) and full-course adjuvant CT. The chemoradiotherapy (CRT) group patients were treated with intensity modulated radiotherapy (IMRT) to the abdominal and pelvic lymphatic drainage area in our hospital between 2010 and 2020. A propensity score matching analysis was conducted to compare the results between the CRT and CT groups. Kaplan-Meier analysis estimated overall survival (OS), disease-free survival (DFS), and local control (LC) rates. The log-rank test determined the significance of prognostic factors. RESULTS: A total of 132 patients with median follow-up of 73.9 months (9.1-137.7 months) were included (44 and 88 for the CRT and RT groups, retrospectively). The baseline characteristics of age, histology, level of CA12-5, surgical staging, residual tumour, courses of adjuvant CT, and courses to reduce CA12-5 to normal were all balanced. The median DFS time, 5-year OS, and local recurrence free survival (LRFS) were 100.0 months vs 25.9 months (P = .020), 69.2% vs 49.9% (P = .002), and 85.9% vs 50.5% (P = .020), respectively. The CRT group mainly presented with acute haematological toxicities, with no statistically significant difference compared with grade III intestinal adverse effects (3/44 vs 6/88, P = .480). CONCLUSION: This report demonstrates that long-term DFS could be achieved in stage III epithelial ovarian cancer patients treated with IMRT preventive radiation to the abdominal and pelvic lymphatic area. Compared with the CT group, DFS and OS were significantly prolonged and adverse effects were acceptable.
Subject(s)
Neoplasm Staging , Humans , Female , Middle Aged , Retrospective Studies , Ovarian Neoplasms/pathology , Ovarian Neoplasms/therapy , Ovarian Neoplasms/mortality , Adult , Aged , Carcinoma, Ovarian Epithelial/therapy , Carcinoma, Ovarian Epithelial/pathology , Cytoreduction Surgical Procedures/methods , Radiotherapy, Intensity-Modulated/methods , Radiotherapy, Adjuvant/methodsABSTRACT
Intermittent hypoxia (IH) and intermittent transcutaneous electrical stimulation (ITES) might benefit patients with obstructive sleep apnea (OSA). However, the therapeutic value of combined IH and ITES in OSA is unknown. In this prospective, randomized, controlled crossover study, normoxia (air exposure for 50â¯min before sleep and sham stimulation for 6â¯h during sleep), IH (5 repeats of 5â¯min 10-12â¯% O2 alternating with 5â¯min air for 50â¯min, and sham stimulation for 6â¯h), ITES (air exposure for 50â¯min and 6 repeats of 30â¯min transcutaneous electrical stimulation alternating with 30â¯min of sham stimulation for 6â¯h), and IH&ITES (10-12â¯% O2 alternating with air for 50â¯min and transcutaneous electrical stimulation alternating with sham stimulation for 6â¯h) were administered to patients with OSA over four single-night sessions. The primary endpoint was difference in OSA severity between the interventions according to apnea-hypopnea index (AHI) and oxygen desaturation index (ODI). The efficacy was response to IH, ITES, IH&ITES defined as a ≥50â¯% reduction in AHI compared with normoxia. Twenty participants (17 male, 3 female) completed the trial. The median (IQR) AHI decreased from 14.5 (10.8, 17.5) events/h with normoxia to 6.9 (3.9, 14.8) events/h with IH (p=0.020), 5.7 (3.4, 9.1) events/h with ITES (p=0.001), and 3.5 (1.8, 6.4) events/h with IH&ITES (p=0.001). AHI was significantly different between IH and IH&ITES (p=0.042) but not between ITES and IH&ITES (p=0.850). For mild-moderate OSA (n=17), IH, ITES, and IH&ITES had a significant effect on AHI (p=0.013, p=0.001, p=0.001, respectively) compared with normoxia, but there were no differences in post hoc pairwise comparisons between intervention groups. No serious adverse events were observed. In conclusion, IH, ITES, and IH&ITES significantly reduced OSA severity. IH&ITES showed better efficacy in mild-moderate OSA than IH and was comparable to ITES. Our data do not support recommending IH&ITES over ITES for OSA.
ABSTRACT
Rectal toxicity is a significant concern in cervical cancer radiotherapy. Despite advancements in image-guided brachytherapy (IGBT), rectal morbidity remains a challenge. Injectable hydrogel showed promise in creating a space between the vagina and rectum, reducing rectal radiation dose; however, the traditional ultrasound-guided injection revealed some problems, such as the inadequate separation of the upper edge of the cervix, which can be mitigated through adopting CT-guided injection. This case report presents the successful use of computed tomography (CT)-guided hydrogel injection to limit rectal doses and improve treatment outcomes. A forty-year-old female with stage IIIC1r cervical cancer received external-beam radiotherapy and concurrent chemotherapy. Due to the proximity of the tumor to the rectum, a CT-guided hydrogel injection was performed to increase the distance between the cervix and rectum. Post-injection, magnetic resonance imaging (MRI) demonstrated increased distances between the cervix and rectum. Subsequent MRI-based IGBT achieved high clinical target volume doses while limiting rectal doses. During the six-month follow-up, the patient reported only mild adverse effects. CT-guided hydrogel injection offers advantages over ultrasound-guided injection in cervical cancer radiotherapy. The technique allows for better puncture position adjustment, reduced reliance on specialized ultrasound expertise, and shorter puncture distances. This case report highlights the potential of hydrogel injection as a viable method to reduce rectal morbidity and improve treatment outcomes in a broader range of cervical cancer patients. Further studies are warranted to validate these findings and explore its applicability in larger cohorts.
ABSTRACT
AIM: To explore the molecular mechanism underlying the protective effect of hypothermic perfusion on the corneal endothelium during phacoemulsification. METHODS: Phacoemulsification was performed on New Zealand white rabbits. Perfusate at different temperatures was used during the operation, and the aqueous humor was collected for proteomic sequencing after the operation. Corneal endothelial cell injury was simulated by a corneal endothelial cell oxygen-glucose deprivation/reoxygenation (OGD/R) model in vitro. Flow cytometry and evaluation of fluorescent LC3B puncta were used to detect apoptosis and autophagy, and western blotting was used to detect protein expression. RESULTS: A total of 381 differentially expressed proteins were identified between the two groups. In vitro, 4 â hypothermia significantly reduced apoptosis and promoted autophagy. Apoptosis increased after autophagy was inhibited by 3-Methyladenine (3-MA). Furthermore, adiponectin (ADIPOQ) knockdown inhibited phospho-AMPK and blocked the protective effect of hypothermia on corneal endothelial cells. CONCLUSIONS: We investigated the differential expression of proteins between the hypothermia group and normothermia group by proteomics. Moreover, hypothermia-induced ADIPOQ can reduce apoptosis by promoting AMPK-mediated autophagy.
ABSTRACT
Stem cells in vivo can transit between quiescence and activation, two metabolically distinct states. It is increasingly appreciated that cell metabolism assumes profound roles in stem cell maintenance and tissue homeostasis. However, the lack of suitable models greatly hinders our understanding of the metabolic control of stem cell quiescence and activation. In the present study, we have utilized classical signaling pathways and developed a cell culture system to model reversible NSC quiescence and activation. Unlike activated ones, quiescent NSCs manifested distinct morphology characteristics, cell proliferation, and cell cycle properties but retained the same cell proliferation and differentiation potentials once reactivated. Further transcriptomic analysis revealed that extensive metabolic differences existed between quiescent and activated NSCs. Subsequent experimentations confirmed that NSC quiescence and activation transition was accompanied by a dramatic yet coordinated and dynamic shift in RNA metabolism, protein synthesis, and mitochondrial and autophagy activity. The present work not only showcases the broad utilities of this powerful in vitro NSC quiescence and activation culture system but also provides timely insights for the field and warrants further investigations.
Subject(s)
Cell Differentiation , Cell Proliferation , Neural Stem Cells , Neural Stem Cells/metabolism , Neural Stem Cells/cytology , Animals , Mice , Cell Culture Techniques/methods , Cells, Cultured , Cell Cycle/physiology , AutophagyABSTRACT
Septic cardiomyopathy is a severe cardiovascular disease with a poor prognosis. Previous studies have reported the involvement of ferroptosis in the pathogenesis of septic cardiomyopathy. SGLT2 inhibitors such as dapagliflozin have been demonstrated to improve ischemia-reperfusion injury by alleviating ferroptosis in cardiomyocyte. However, the role of dapagliflozin in sepsis remains unclear. Therefore, our study aims to investigate the therapeutic effects of dapagliflozin on LPS-induced septic cardiomyopathy. Our results indicate that dapagliflozin improved cardiac function in septic cardiomyopathy experimental mice. Mechanistically, dapagliflozin works by inhibiting the translation of key proteins involved in ferroptosis, such as GPX4, FTH1, and SLC7A11. It also reduces the transcription of lipid peroxidation-related mRNAs, including PTGS2 and ACSL4, as well as iron metabolism genes TFRC and HMOX1.
Subject(s)
Benzhydryl Compounds , Ferroptosis , Glucosides , Lipopolysaccharides , Ferroptosis/drug effects , Animals , Mice , Benzhydryl Compounds/pharmacology , Benzhydryl Compounds/therapeutic use , Glucosides/pharmacology , Glucosides/therapeutic use , Lipopolysaccharides/toxicity , Male , Cardiomyopathies/drug therapy , Mice, Inbred C57BL , Phospholipid Hydroperoxide Glutathione Peroxidase/metabolism , Amino Acid Transport System y+/metabolism , Myocytes, Cardiac/drug effects , Myocytes, Cardiac/metabolism , Myocytes, Cardiac/pathologyABSTRACT
BACKGROUND: Non-small cell lung cancer (NSCLC) accounts for more than 80 % of lung cancer (LC) cases, making it the primary cause of cancer-related mortality worldwide. T-box transcription factor 5 (TBX5) is an important regulator of embryonic and organ development and plays a key role in cancer development. Here, our objective was to investigate the involvement of TBX5 in ferroptosis within LC cells and the underlying mechanisms. METHODS: First, TBX5 expression was examined in human LC cells. Next, overexpression of TBX5 and Yes1-associated transcriptional regulator (YAP1) and knockdown of TEA domain 1 (TEAD1) were performed in A549 and NCI-H1703 cells. The proliferation ability of A549 and NCI-H1703 cells, GSH, MDA, ROS, and Fe2+ levels were measured. Co-immunoprecipitation (Co-IP) was performed to verify whether TBX5 protein could bind YAP1. Then TBX5, YAP1, TEAD1, GPX4, p53, FTH1, SLC7A11 and PTGS2 protein levels were assessed. Finally, we verified the effect of TBX5 on ferroptosis in LC cells in vivo. RESULTS: TBX5 expression was down-regulated in LC cells, especially in A549 and NCI-H1703 cells. Overexpression of TBX5 significantly decreased proliferation ability of A549 and NCI-H1703 cells, downregulated GPX4 and GSH levels, and upregulated MDA, ROS, and Fe2+ levels. Co-IP verified that TBX5 protein could bind YAP1. Moreover, oe-YAP1 promoted proliferation ability of A549 and NCI-H1703 cells transfected with Lv-TBX5, upregulated GPX4 and GSH levels and downregulated MDA, ROS, and Fe2+ levels. Additionally, oe-YAP1 promoted FTH1 and SLC7A11 levels and inhibited p53 and PTGS2 levels in A549 and NCI-H1703 cells transfected with Lv-TBX5. However, transfection with si-TEAD1 further reversed these effects. In vivo experiments further validated that TBX5 promoted ferroptosis in LC cells. CONCLUSIONS: TBX5 inhibited the activation of YAP1-TEAD1 pathway to promote ferroptosis in LC cells.
Subject(s)
Ferroptosis , Lung Neoplasms , T-Box Domain Proteins , TEA Domain Transcription Factors , Transcription Factors , YAP-Signaling Proteins , Ferroptosis/genetics , Humans , Lung Neoplasms/metabolism , Lung Neoplasms/pathology , Lung Neoplasms/genetics , YAP-Signaling Proteins/metabolism , YAP-Signaling Proteins/genetics , Transcription Factors/metabolism , Transcription Factors/genetics , TEA Domain Transcription Factors/metabolism , T-Box Domain Proteins/metabolism , T-Box Domain Proteins/genetics , Animals , Cell Line, Tumor , Carcinoma, Non-Small-Cell Lung/metabolism , Carcinoma, Non-Small-Cell Lung/pathology , Carcinoma, Non-Small-Cell Lung/genetics , Adaptor Proteins, Signal Transducing/metabolism , Adaptor Proteins, Signal Transducing/genetics , Mice, Nude , Cell Proliferation , DNA-Binding Proteins/metabolism , DNA-Binding Proteins/genetics , Mice , Gene Expression Regulation, Neoplastic , A549 Cells , Signal Transduction , Reactive Oxygen Species/metabolismABSTRACT
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
ABSTRACT
Undescended testis (UDT), known as cryptorchidism (CRY), is a common congenital disorder in which one or both testicles do not descend normally into the scrotum. A unilateral UDT model was established by inducing UDT in mice through surgery. The results showed that the testis in the UDT model group was abnormal; the lumen of the seminiferous tubule was atrophic; apoptosis, necrosis and shedding were observed in many of the germ cells; the level of sex hormones was abnormal; and mature sperm was reduced. Subsequently, transcriptome sequencing was conducted on the testicular tissue of UDT model mice. Through analysis and verification of differential genes, AZIN2 was identified as playing a key role in the decline in male fertility caused by cryptorchidism. AZIN2 expression and spermine content was down-regulated in the testis of the UDT group. We then used a combination of hypoxanthine and xanthine to create a GC-1 cell damage model. In this model, AZIN2 expression and spermine content was down-regulated. When si-Azin2 transfected GC-1 cells, cell viability and proliferation were decreased. However, in the GC-1 cell damage model transfected with Azin2 over-expressed plasmid, AZIN2 expression and spermine content was up-regulated, reversing the cell damage caused by hypoxanthine and xanthine, and restoring the proliferation ability of GC-1 cells. These results indicate that in UDT, down-regulated AZIN2 expression is a factor in testicular damage. This discussion of the connection between AZIN2 and germ cells has important clinical significance as it provides an important reference for the diagnosis and treatment of cryptorchidism.
ABSTRACT
BACKGROUND: Limited knowledge exists regarding the casual associations linking blood metabolites and the risk of developing colorectal cancer. AIM: To investigate causal associations between blood metabolites and colon cancer. METHODS: The study utilized a two-sample Mendelian randomization (MR) analysis to investigate the causal impact of 486 blood metabolites on colorectal cancer. The primary method of analysis used was the inverse variance weighted model. To further validate the results several sensitivity analyses were performed, including Cochran's Q test, MR-Egger intercept test, and MR robust adjusted profile score. These additional analyses were conducted to ensure the reliability and robustness of the findings. RESULTS: After rigorous selection for genetic variation, 486 blood metabolites were included in the MR analysis. We found Mannose [odds ratio (OR) = 2.09 (1.10-3.97), P = 0.024], N-acetylglycine [OR = 3.14 (1.78-5.53), P = 7.54 × 10-8], X-11593-O-methylascorbate [OR = 1.68 (1.04-2.72), P = 0.034], 1-arachidonoylglycerophosphocholine [OR = 4.23 (2.51-7.12), P = 6.35 × 10-8] and 1-arachidonoylglycerophosphoethanolamine 4 [OR = 3.99 (1.17-13.54), P = 0.027] were positively causally associated with colorectal cancer, and we also found a negative causal relationship between Tyrosine [OR = 0.08 (0.01-0.63), P = 0.014], Urate [OR = 0.25 (0.10-0.62), P = 0.003], N-acetylglycine [0.73 (0.54-0.98), P = 0.033], X-12092 [OR = 0.89 (0.81-0.99), P = 0.028], Succinylcarnitine [OR = 0.48 (0.27-0.84), P = 0.09] with colorectal cancer. A series of sensitivity analyses were performed to confirm the rigidity of the results. CONCLUSION: This study showed a causal relationship between 10 blood metabolites and colorectal cancer, of which 5 blood metabolites were found to be causal for the development of colorectal cancer and were confirmed as risk factors. The other five blood metabolites are protective factors.