Oral Health Knowledge and Oral Hygiene Habits in a Sample of 12-Year-Old Hispanics: A Cross-sectional Study.

OBJECTIVE: To explore the association between hygiene knowledge and habits and gingivitis in Puerto Rican school children. METHODS: Questionnaires on oral health knowledge and hygiene habits were provided to almost half of the 12-year-olds who participated in an island-wide cross-sectional oral health study. The evaluations included gingival examinations in 2 quadrants. Odds ratios (ORs) (with 95% CIs) were computed using logistic regression models and oral health-related knowledge and hygiene habits to gingivitis. RESULTS: Of the 823 participants who completed the questionnaire 53.43% were female, and 81% had gingivitis. Most reported having received instructions on brushing (98%), flossing (89.5%), and using mouthwash (90%). The majority (75%) rated their gums as healthy, and 44.68% agreed that oral health affects general health. Nearly half (44%) reported brushing their teeth at least 2 times a day, and 80.25%, flossing daily. In multivariate analysis, not having been instructed on how to brush was related to greater odds of having gingivitis (OR: 7.32; 95% CI: 1.5-35.67). Flossing more than once a day was associated with half the odds of gingivitis (OR: 0.50; 95% CI: 0.29-0.88). CONCLUSION: The children had knowledge of oral hygiene methods but were mostly unaware that gingival health could affect systemic health. Fewer than half reported brushing 2 or more times a day. Not having been instructed on how to brush was associated with higher odds of gingivitis.

Comparative Analysis of Gene Expression Patterns for Oral Epithelial Cell Functions in Periodontitis.

The structure and function of epithelial cells are critical for the construction and maintenance of intact epithelial surfaces throughout the body. Beyond the mechanical barrier functions, epithelial cells have been identified as active participants in providing warning signals to the host immune and inflammatory cells and in communicating various detailed information on the noxious challenge to help drive specificity in the characteristics of the host response related to health or pathologic inflammation. Rhesus monkeys were used in these studies to evaluate the gingival transcriptome for naturally occurring disease samples (GeneChip® Rhesus Macaque Genome Array) or for ligature-induced disease (GeneChip® Rhesus Gene 1.0 ST Array) to explore up to 452 annotated genes related to epithelial cell structure and functions. Animals were distributed by age into four groups: ≤ 3 years (young), 3-7 years (adolescent), 12-16 years (adult), and 18-23 years (aged). For naturally occurring disease, adult and aged periodontitis animals were used, which comprised 34 animals (14 females and 20 males). Groups of nine animals in similar age groups were included in a ligature-induced periodontitis experiment. A buccal gingival sample from either healthy or periodontitis-affected tissues were collected, and microarray analysis performed. The overall results of this investigation suggested a substantial alteration in epithelial cell functions that occurs rapidly with disease initiation. Many of these changes were prolonged throughout disease progression and generally reflect a disruption of normal cellular functions that would presage the resulting tissue destruction and clinical disease measures. Finally, clinical resolution may not signify biological resolution and represent a continued risk for disease that may require considerations for additional biologically specific interventions to best manage further disease.

Gingival tissue autophagy pathway gene expression profiles in periodontitis and aging.

OBJECTIVE: We hypothesized that autophagy-related genes will be differentially expressed in periodontitis, suggesting an impaired gingival autophagic response associated with disease. BACKGROUND: Autophagy is a cellular physiologic mechanism to maintain tissue homeostasis, while deficient autophagic responses increase inflammation and susceptibility to infection. METHODS: Rhesus monkeys [<3 years to 23 years of age (n = 34)] were examined for periodontal health and naturally occurring periodontitis. Gingival tissues samples were obtained from healthy or diseased sites, total RNA was isolated, and the Rhesus Gene Chip 1.0 ST (Affymetrix) was used for gene expression analysis of 150 autophagy-related genes. RESULTS: Comparison of expression levels with adult healthy tissues demonstrated a rather limited number of individual genes that were significantly different across the age-groups. In contrast, with periodontitis in the adults and aged animals, about 15% of the genes were significantly increased or decreased. The differences were reflected in the mTOR complex (5/12), ULK1/ATG1 complex (5/9), PI3K complex (5/21), ATG9 complex (2/7), ATG12 conjugation/LC3 lipidation (7/22), and lysosome fusion/vesicle degradation [LF/VD (5/10)] activities within the broader autophagic pathway. The genes most greatly altered in gingival tissues of naturally occurring periodontitis were identified in the ATG12 and LF/VD pathways that approximated 50% of the genes in each of those categories. While healthy gingival aging did not appear to reflect altered autophagy gene expression, substantial differences were noted with periodontitis irrespective of the age of the animals. Future studies into the role of autophagy in periodontitis and could offer potential new therapeutic strategies to prevent and/or treat periodontal disease.

Oral Microbiome and Gingival Tissue Apoptosis and Autophagy Transcriptomics.

Objective: This study focused on documenting characteristics of the gingival transcriptome during various stages of periodontitis targeting genes associated with apoptotic and autophagic pathways and changes that specifically associate with features of the oral microbiome. Methods:Macaca mulatta (n = 18; 12-23 years) were examined at baseline and 0.5, 1, and 3 months of disease progression, as well as 5 months with clinical disease resolution. 16S sequencing and microarray analyses examined changes in the microbiome and gingival transcriptome, respectively, at each time point from every animal. Results: Specific patterns of apoptotic and autophagic genes were identified related to the initiation and progression of disease. The analysis also provided insights on the principal bacteria within the complex microbiome whose abundance was significantly correlated with differences in apoptotic and autophagic gene expression. Bacteria were identified that formed associated complexes with similar effects on the host gene expression profiles. A complex of Leptotrichia_unclassifed, Capnocytophaga_unclassified, Prevotella sp. 317, and Veillonellaceae_[G-1] sp. 155 were significantly negatively correlated with both apoptosis and autophagy. Whereas, Veillonellaceae_[G-1], Porphyromonadaceae, and F. alocis 539 were significantly positively correlated with both pathways, albeit this relationship was primarily associated with pro-apoptotic genes. Conclusions: The findings provide evidence for specific bacteria/bacterial complexes within the oral microbiome that appear to have a more substantive effect on regulating apoptotic and autophagic pathways in the gingival tissues with periodontitis.

Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA.

The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.

Periodontal disease susceptible matrilines in the Cayo Santiago Macaca mulatta macaques.

OBJECTIVE AND BACKGROUND: The expression of periodontitis, including age of onset, extent, and severity is considered to represent an interaction of the individual's oral microbiome and host response to the microbial challenge that is modified by both genetics and environmental factors. The aim of this study was to determine the distribution of periodontitis in a population of nonhuman primates, to document features of familial distribution that could reflect heritability and transmission of microbes with enhanced virulence. MATERIAL AND METHODS: This report presents our findings from evaluation of periodontal disease bone defects in skulls from 569 animals (5-31 years of age) derived from the skeletons of the rhesus monkeys (Macaca mulatta) of Cayo Santiago derived from eight matrilines over 6-9 generations. The distance from the base of alveolar bone to the cemento-enamel junction on 1st /2nd premolars and 1st /2nd molars from all four quadrants was evaluated as a measure of periodontal disease. Additionally, we documented the presence of periodontitis in 79 living descendants within these matrilines. RESULTS: The results demonstrated an increased extent and severity of periodontitis with aging across all matrilines. Extensive heterogeneity in disease expression was observed among the animals and this was linked to specific periodontitis susceptible matrilines. Moreover, we identified some matrilines in which the members appeared to show some resistance to more severe disease, even with aging. CONCLUSION: Linking these disease variations to multigenerational matriarchal family units supported familial susceptibility of periodontitis. This familial disease relationship was reinforced by the distribution of naturally-occurring periodontitis in the living descendants.

Gene expression analysis of neuropeptides in oral mucosa during periodontal disease in non-human primates.

BACKGROUND: Neuropeptides (NPs) are innate pivotal regulators of the immunoinflammatory response. Nevertheless, their role in the pathogenesis of periodontal disease remains unknown. Changes in gene expression of 10 NPs and 16 NP receptors (NPRs) coincident with the initiation, progression, and resolution of periodontitis were determined. METHODS: The ligature-induced periodontitis model was used in rhesus monkeys (n = 18). Gingival tissue samples were taken at baseline (preligatures), at 2 weeks and at 1 month (initiation), and at 3 months (progression) postligation. Ligatures were removed and samples taken 2 months later (resolution). Total RNA was isolated from tissues and NP/NPR gene expression microarray analysis was performed. Gene expression changes were validated by quantitative polymerase chain reaction and immunohistochemistry. RESULTS: Unexpectedly, the expression of pro-inflammatory NPs/NPRs did not change during periodontitis or with resolution. However, increased expression of the anti-inflammatory NPs adrenomedullin (ADM) and galanin (GAL), and the NPRs calcitonin receptor-like (CALCRL) and receptor activity-modifying protein-2 and -3 (RAMP2 and RAMP3) were observed during initiation and progression of disease. The expression of the same NPs/NPRs exhibited a significant positive correlation with both molecular (interleukin-1ß, matrix mettaloproteinase-9, and receptor activator of nuclear factor-kappa B ligand) and clinical measures of gingival inflammation and tissue destruction. CONCLUSION: Initiation and progression of periodontitis involve significant overexpression of ADM, GAL, CALCRL, RAMP2, and RAMP3. These anti-inflammatory NPs/NPRs could play a role in the unresolved infection and inflammation that normally drives tissue destruction in periodontitis. Both ADM and GAL potentially are new candidates to consider as biomolecules associated with periodontal disease activity.

Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA.

P. gingivalis (Pg) is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which mucosal responses to the oral microbiota in the presence of specific pathogens such as Pg could abrogate the host-microbe symbiotic relationship leading to periodontitis remain unclear. Herein, we identified the Notch-1/PLA2-IIA axis as a new molecular pathway through which Pg could be specifically modulating oral epithelial antimicrobial and inflammatory responses. Pg activated Notch-1, and inhibition or silencing of Notch-1 completely abrogated Pg-induced PLA2-IIA in oral epithelial cells (OECs). Activation of Notch-1 and PLA2-IIA production were associated with Pg-produced gingipains. Other oral Gram-positive and Gram-negative species failed to induce similar responses. Pg enhanced OEC antimicrobial activity through PLA2-IIA. Increased Notch-1 activation correlated with higher PLA2-IIA gingival expression and changes in the abundance of specific oral bacteria phyla during periodontal disease. Oral bacterial species exhibited differential antimicrobial susceptibility to PLA2-IIA. These findings support previous evidence suggesting an important role for epithelial Notch-1 activation and PLA2-IIA production during health and disease at mucosal surfaces, and provide new mechanistic information concerning the regulation of epithelial antimicrobial and pro-inflammatory responses modulated by oral pathogenic bacteria associated with periodontal disease.

Hypoxia-inducible transcription factors, HIF1A and HIF2A, increase in aging mucosal tissues.

Hypoxia (i.e. oxygen deprivation) activates the hypoxia-signalling pathway, primarily via hypoxia-inducible transcription factors (HIF) for numerous target genes, which mediate angiogenesis, metabolism and coagulation, among other processes to try to replenish tissues with blood and oxygen. Hypoxia signalling dysregulation also commonly occurs during chronic inflammation. We sampled gingival tissues from rhesus monkeys (Macaca mulatta; 3-25 years old) and total RNA was isolated for microarray analysis. HIF1A, HIF1B and HIF2A were significantly different in healthy aged tissues, and both HIF1A and HIF3A were positively correlated with aging. Beyond these transcription factor alterations, analysis of patterns of gene expression involved in hypoxic changes in tissues showed specific increases in metabolic pathway hypoxia-inducible genes, whereas angiogenesis pathway gene changes were more variable in healthy aging tissues across the animals. With periodontitis, aging tissues showed decreases in metabolic gene expression related to carbohydrate/lipid utilization (GBE1, PGAP1, TPI1), energy metabolism and cell cycle regulation (IER3, CCNG2, PER1), with up-regulation of transcription genes and cellular proliferation genes (FOS, EGR1, MET, JMJD6) that are hypoxia-inducible. The potential clinical implications of these results are related to the epidemiological findings of increased susceptibility and expression of periodontitis with aging. More specifically the findings describe that hypoxic stress may exist in aging gingival tissues before documentation of clinical changes of periodontitis and, so, may provide an explanatory molecular risk factor for an elevated capacity of the tissues to express destructive processes in response to changes in the microbial biofilms characteristic of a more pathogenic microbial challenge.

Transcriptome Analysis of B Cell Immune Functions in Periodontitis: Mucosal Tissue Responses to the Oral Microbiome in Aging.

Evidence has shown activation of T and B cells in gingival tissues in experimental models and in humans diagnosed with periodontitis. The results of this adaptive immune response are noted both locally and systemically with antigenic specificity for an array of oral bacteria, including periodontopathic species, e.g., Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans. It has been recognized through epidemiological studies and clinical observations that the prevalence of periodontitis increases with age. This report describes our studies evaluating gingival tissue transcriptomes in humans and specifically exploiting the use of a non-human primate model of naturally occurring periodontitis to delineate gingival mucosal tissue gene expression profiles focusing on cells/genes critical for the development of humoral adaptive immune responses. Patterns of B cell and plasmacyte genes were altered in aging healthy gingival tissues. Substantial increases in a large number of genes reflecting antigen-dependent activation, B cell activation, B cell proliferation, and B cell differentiation/maturation were observed in periodontitis in adults and aged animals. Finally, evaluation of the relationship of these gene expression patterns with those of various tissue destructive molecules (MMP2, MMP9, CTSK, TNFα, and RANKL) showed a greater frequency of positive correlations in healthy tissues versus periodontitis tissues, with only MMP9 correlations similar between the two tissue types. These results are consistent with B cell response activities in healthy tissues potentially contributing to muting the effects of the tissue destructive biomolecules, whereas with periodontitis this relationship is adversely affected and enabling a progression of tissue destructive events.

Bone biology-related gingival transcriptome in ageing and periodontitis in non-human primates.

AIM: Cellular and molecular immunoinflammatory changes in gingival tissues drive alveolar bone loss in periodontitis. Since ageing is a risk factor for periodontitis, we sought to identify age-related gingival transcriptome changes associated with bone metabolism in both healthy and in naturally occurring periodontitis. MATERIALS AND METHODS: Adult (12-16 years) and aged (18-23 years) non-human primates (M. mulatta) (n = 24) were grouped into healthy and periodontitis. Gingival tissue samples were obtained and subjected to microarray analysis using the Gene Chip Macaque Genome Array. Gene expression profiles involved in osteoclast/osteoblast proliferation, adhesion and function were evaluated and compared across and between the age groups. QPCR was also performed on selected genes to validate microarray data. RESULTS: Healthy aged tissues showed a gene profile expression that suggest enhancement of osteoclastic adhesion, proliferation/survival and function (SPP1, TLR4, MMP8 and TFEC) and impaired osteoblastic activity (SMEK3P and SMAD5). The gingival transcriptome in both adult and aged animals with naturally occurring periodontitis (FOS, IL6, TLR4, MMP9, MMP10 and SPP1 genes) was consistent with a local inflammatory response driving towards bone/connective tissue destruction. CONCLUSION: A pro-osteoclastogenic gingival transcriptome is associated with periodontitis irrespective of age; however; a greater bone-destructive molecular environment is associated with ageing in healthy tissues.

Persistent oral health disparity in 12-year-old Hispanics: a cross-sectional study.

BACKGROUND: Dental caries is the most prevalent chronic illness worldwide. In the US dental caries has been described as a "silent epidemic", affecting 58.2 % of 12-15 year-olds, particularly in minority and immigrant groups. Caries is associated with complex yet preventable biological and behavioral factors such as dental plaque and diet, as well as social determinants of health. In developed nations, a higher risk caries has been associated with populations of low socio-economic status (SES), especially in areas with greater income disparity. An island-wide study conducted in Puerto Rico in 1997 revealed a high prevalence of dental caries in 12-year-olds and a significant health disparity between children attending private and public schools. The purpose of the present study was twofold: 1) to estimate caries levels of 12-year-old school Puerto Ricans in 2011; and 2) compare results to data obtained in 1997 to explore any possible change in caries outcomes after a government health insurance (GHI) reform was implemented. METHODS: In this cross-sectional study, a probability sample of 133 out of 1,843 schools was selected proportional to enrollment size, and stratified by 1997 GHI regions, school type, and gender. Calibrated examiners conducted oral soft tissue and caries examinations. Dental caries prevalence was estimated. Mean Decayed Missing Filled Tooth/Surface (DMFT/S) indices and mean Significant Caries Index (SiC) were calculated and compared retrospectively to data obtained in 1997. RESULTS: The final sample included 1,587 school-enrolled children. About 53 % of participants were female and 77 % attended public schools. Between 1997 and 2011, reductions were observed in caries prevalence (81 to 69 %), mean DMFT scores (3.8 to 2.5), mean DMFS scores (6.5 to 3.9), and mean SiC index (7.3 to 5.6) in both private and public schools, with a more prominent decrease in private schools. Between 1997 and 2011, overall the filled component increased (50 to 67 %), while decayed and missing component decreased (42 to 30 %) and (8 to 3 %), respectively. CONCLUSIONS: Among 12-year-old schoolchildren in Puerto Rico between 1997 and 2011, caries prevalence, extent, and severity decreased as well as the DMFT missing component, while the filled component increased. Dental caries prevalence was high and the health disparity persists between children enrolled in public and private schools after more than a decade of the GHI implementation. The relationship between GHI implementation and other potentially relevant co-factors for caries warrants further research, as does the seemingly entrenched disparity across groups.

Familial periodontal disease in the Cayo Santiago rhesus macaques.

Substantial ongoing research continues to explore the contribution of genetics and environment to the onset, extent and severity of periodontal disease(s). Existing evidence supports that periodontal disease appears to have an increased prevalence in family units with a member having aggressive periodontitis. We have been using the nonhuman primate as a model of periodontal disease for over 25 years with these species demonstrating naturally occurring periodontal disease that increases with age. This report details our findings from evaluation of periodontal disease in skulls from 97 animals (5-31 years of age) derived from the skeletons of the rhesus monkeys (Macaca mulatta) on Cayo Santiago. Periodontal disease was evaluated by determining the distance from the base of the alveolar bone defect to the cemento-enamel junction on 1st/2nd premolars and 1st/2nd molars from all four quadrants. The results demonstrated an increasing extent and severity of periodontitis with aging across the population of animals beyond only compensatory eruption. Importantly, irrespective of age, extensive heterogeneity in disease expression was observed among the animals. Linking these variations to multi-generational matriarchal family units supported familial susceptibility of periodontitis. As the current generations of animals that are descendants from these matrilines are alive, studies can be conducted to explore an array of underlying factors that could account for susceptibility or resistance to periodontal disease.

Cytokine gene expression profiles during initiation, progression and resolution of periodontitis.

AIM: Variations in the expression of cytokines during the progression of periodontitis remain ill-defined. We evaluated the expression of 19 cytokine genes related to T-cell phenotype/function during initiation, progression and resolution of periodontitis, and related these to the expression of soft and bone tissue destruction genes (TDGs). MATERIALS AND METHODS: A ligature-induced periodontitis model was used in rhesus monkeys (M. mulatta) (n = 18). Gingival tissues were taken at baseline pre-ligation, 2 weeks and 1 month (Initiation) and 3 months (progression) post ligation. Ligatures were removed and samples taken 2 months later (resolution). Total RNA was isolated and the Rhesus Gene 1.0 ST (Affymetrix) used for gene expression analysis. Significant expression changes were validated by qRT-PCR. RESULTS: Disease initiation/progression was characterized by overexpression of Th17/Treg cytokine genes (IL-1ß, IL-6, TGFß and IL-21) and down-regulation of Th1/Th2 cytokine genes (IL-18 and IL-25). Increased IL-2 and decreased IL-10 levels were seen during disease resolution. Several Th17/Treg cytokine genes positively correlated with TDGs, whereas most Th1/Th2 genes exhibited a negative correlation. CONCLUSION: Initiation, progression and resolution of periodontitis involve over- and underexpression of cytokine genes related to various T-helper subsets. In addition, variations in individual T-helper response subset/genes during disease progression correlated with protective/destructive outcomes.

Diet quality, social determinants, and weight status in Puerto Rican children aged 12 years.

Diet quality may be influenced by social determinants and weight status. This has not been studied in Puerto Rico; therefore, our cross-sectional study examined whether diet quality, assessed by the Healthy Eating Index-2005 (HEI-2005), differs by social determinants (sex, school type, and region) and weight status in children in Puerto Rico. As part of an island-wide study to evaluate oral health in 1,550 children aged 12 years, dietary intake was assessed in a representative subset (n=796) using a 24-hour diet recall. Diet quality was evaluated from the diet recall results using the HEI-2005. Overall mean HEI-2005 score was 40.9, out of a total maximum score of 100. Girls had significantly higher scores for whole fruit, total vegetables, whole grains, and sodium but lower scores for total grains and milk compared with boys (P<0.05). Children from public schools had higher scores for total fruit, whole fruit, and dark green and orange vegetables and legumes, but lower scores for whole grains and milk compared with those from private schools (P<0.05). Children from the central mountains had higher scores for the dark green and orange vegetables and legumes and for whole fruit compared with the other regions (P<0.05). Overweight children had significantly higher scores for total vegetables and milk, but lower scores for total fruit and sodium compared with non-overweight children (P<0.01). Some components of diet quality were associated with the social determinants studied and with weight status in our sample. Overall diet quality needs improvement in Puerto Rican children so that it is better aligned with dietary recommendations.

Comparative analysis of gingival tissue antigen presentation pathways in ageing and periodontitis.

AIM: Gingival tissues of periodontitis lesions contribute to local elevations in mediators, including both specific T cell and antibody immune responses to oral bacterial antigens. Thus, antigen processing and presentation activities must exist in these tissues to link antigen-presenting cells with adaptive immunity. We hypothesized that alterations in the transcriptome of antigen processing and presentation genes occur in ageing gingival tissues and that periodontitis enhances these differences reflecting tissues less capable of immune resistance to oral pathogens. MATERIALS AND METHODS: Rhesus monkeys (n = 34) from 3 to 23 years of age were examined. A buccal gingival sample from healthy or periodontitis sites was obtained, total RNA isolated, and microarray analysis was used to describe the transcriptome. RESULTS: The results demonstrated increased transcription of genes related to the MHC class II and negative regulation of NK cells with ageing in healthy gingival tissues. In contrast, both adult and ageing periodontitis tissues showed decreased transcription of genes for MHC class II antigens, coincident with up-regulation of MHC class I-associated genes. CONCLUSION: These transcriptional changes suggest a response of healthy ageing tissues through the class II pathway (i.e. endocytosed antigens) and altered responses in periodontitis that could reflect host-associated self-antigens or targeting cytosolic intracellular microbial pathogens.

Effects of aging on apoptosis gene expression in oral mucosal tissues.

Apoptotic processes are important for physiologic renewal of an intact epithelial barrier and contribute some antimicrobial resistance for bacteria and viruses, as well as anti-inflammatory effects that benefits the mucosa. The oral cavity presents a model of host-bacterial interactions at mucosal surfaces, in which a panoply of microorganisms colonizes various niches in the oral cavity and creates complex multispecies biofilms that challenge the gingival tissues. This report details gene expression in apoptotic pathways that occur in oral mucosal tissues across the lifespan, using a nonhuman primate model. Macaca mulatta primates from 2 to 23 years of age (n = 23) were used in a cross-sectional study to obtain clinical healthy gingival tissues specimens. Further, mRNA was prepared and evaluated using the Affymetrix Rhesus GeneChip and 88 apoptotic pathway genes were evaluated. The results identified significant positive correlations with age in 12 genes and negative correlations with an additional five genes. The gene effects were predicted to alter apoptosis receptor levels, extrinsic apoptotic pathways through caspases, cytokine effects on apoptotic events, Ca(+2)-induced death signaling, cell cycle checkpoints, and potential effects of survival factors. Both the positively and negatively correlated genes within the apoptotic pathways provided evidence that healthy tissues in aging animals exhibit decreased apoptotic potential compared to younger animals. The results suggested that decreased physiologic apoptotic process in the dynamic septic environment of the oral mucosal tissues could increase the risk of aging tissues to undergo destructive disease processes through dysregulated inflammatory responses to the oral microbial burden.