Hemostatic Interventions and All-Cause Mortality in Hemodynamically Unstable Pelvic Fractures: A Systematic Review and Meta-Analysis.

Objective: To conduct a systematic review and meta-analysis of the all-cause mortality associated with the most commonly used hemostatic treatments in patients with hemodynamically unstable pelvic fractures. Methods: Up to April 30, 2023, we searched PubMed, Embase, Web of Science, and Cochrane, including the references to qualified papers. A meta-analysis was performed on studies that reported odds ratios (ORs) or the number of events needed to calculate them. The PROSPERO registration number was CRD42023421137. Results: Of the 3452 titles identified in our original search, 29 met our criteria. Extraperitoneal packing (EPP) (OR = 0.626 and 95% CI = 0.413-0.949), external fixation (EF) (OR = 0.649 and 95% CI = 0.518-0.814), and arterial embolism (AE) (OR = 0.459 and 95% CI = 0.291-0.724) were associated with decreased mortality. Resuscitative endovascular balloon occlusion of the aorta (REBOA) (OR = 2.824 and 95% CI = 1.594-5.005) was associated with increased mortality. A random effect model meta-analysis of eight articles showed no difference in mortality between patients with AE and patients with EPP for the initial treatments for controlling blood loss (OR = 0.910 and 95% CI = 0.623-1.328). Conclusion: This meta-analysis collectively suggested EF, AE, or EPP as life-saving procedures for patients with hemodynamically unstable pelvic fractures.

Fronto-parietal activity changes associated with changes in working memory load: Evidence from simultaneous electroencephalography and functional near-infrared spectroscopy analysis.

Working memory (WM) involves the capacity to maintain and manipulate information over short periods. Previous research has suggested that fronto-parietal activities play a crucial role in WM. However, there remains no agreement on the effect of working memory load (WML) on neural activities and haemodynamic responses. Here, our study seeks to examine the effect of WML through simultaneous electroencephalography (EEG) and functional near-infrared spectroscopy (fNIRS). In this study, a delay change detection task was conducted on 23 healthy volunteers. The task included three levels: one item, three items and five items. The EEG and fNIRS were simultaneously recorded during the task. Neural activities and haemodynamic responses at prefrontal and parietal regions were analysed using time-frequency analysis and weighted phase-lag index (wPLI). We observed a significant enhancement in prefrontal and parietal ß suppression as WML increased. Furthermore, as WML increased, there was a notable enhancement in fronto-parietal connectivity (FPC), as evidenced by both EEG and fNIRS. Correlation analysis indicated that as WML increased, there was a potential for enhancement of neurovascular coupling (NVC) of FPC.

Atomic Layer-Deposited Silane Coupling Agent for Interface Passivation of Quantum Dot Light-Emitting Diodes.

Inserting an insulating layer between the charge transport layer (CTL) and quantum dot emitting layer (QDL) is widely used in improving the performance of quantum dot light-emitting diodes (QLEDs). However, the additional layer inevitably leads to energy loss and joule heat. Herein, a monolayer silane coupling agent is used to modify the said interfaces via the self-limiting adsorption effect. Because the ultrathin layers induce negligible series resistance to the device, they can partially passivate the interfacial defects on the electron transport side and help confine the electrons within the QDL on the hole transport side. These interfacial modifications can not only suppress the nonradiative recombination but also slow down the aging of the hole transport layer. The findings here underline a low-temperature adsorption-based strategy for effective interfacial modification which can be used in any layer-by-layer device structures.

Study of the development patterns of water-conducting fracture zones under karst aquifers and the mechanism of water inrush.

The hydrogeological conditions of the Qianbei coalfield are complex, and karst water in the roof rock frequently disrupts mining operations, leading to frequent water inrush incidents. Taking the representative Longfeng Coal Mine as a case study, research was conducted on the development pattern of the water-conducting fracture zone and the water inrush mechanisms beneath karst aquifers. On the basis of key stratum theory and calculations of the stratum stretching rate, the karst aquifer in the Changxing Formation was identified as the primary key stratum. It was deduced that the water-conducting fracture zone would develop into the karst aquifer, indicating a risk of roof water inrush at the working face. Numerical simulations were used to study the stress field, displacement field, and plastic zone distribution patterns in the overlying roof strata. Combined with similar simulation tests and digital speckle experiments, the spatiotemporal evolution characteristics of the water-conducting fracture zone were investigated. During the coal mining process, the water-conducting fracture zone will exhibit a "step-type" development characteristic, with the fracture morphology evolving from vertical to horizontal. Near the goaf boundary, the strain gradually decreases, and the instability of the primary key stratum significantly impacts the mining space below, leading to the closure of interlayer voids or the redistribution of water-conducting fissure patterns. Field measurements of the water-conducting fracture zone reveal that postmining roof fractures can be classified into tensile-shear, throughgoing, and discrete types, with decreasing water-conducting capacity in that order, the measured development height of the water-conducting fracture zone (51 m) aligns closely with the theoretical height (51.37 m) and the numerical simulation height (49.17 m). Finally, from the perspective of key stratum instability, the disaster mechanisms of dynamic water inrush and hydrostatic pressure water inrush beneath the karst aquifers in the northern Guizhou coalfield were revealed. The findings provide valuable insights for water prevention and control efforts in the Qianbei coalfield mining area.

Small molecule induced interfacial defect healing to construct inverted perovskite solar cells with high fill factor and stability.

Chemical defects at the surface and grain boundaries of perovskite crystals cause deterioration of conversion efficiency and stability of perovskite solar cells (PSCs). In this study, a multifunctional additive, 5-fluoro-2-pyrimidine carbonitrile (FPDCN) molecule, is added into the perovskite precursor solution in order to passivate the uncoordinated Pb2+ by the cyanogen (-CN) group and pyrimidine N in FPDCN. Interestingly, fluorine (F) atoms interact with FA+ to form hydrogen bonds, which could regulate the perovskite crystallization process for the formation of high-quality perovskite crystals. Besides, the F atoms in FPDCN increase the water contact angle of perovskite films. As a result, the carrier extraction and transport in the perovskite film are significantly enhanced, and the non-radiative recombination is suppressed. The corresponding devices achieve a champion photovoltaic conversion efficiency (PCE) of 20.7 % and a fill factor (FF) of over 83 %. The device based on FPDCN shows long-term stability under a high-humidity atmospheric environment by maintaining 85 % of the initial efficiency after aging of 700 h in the glove box. This study provides a simple and convenient method to prepare stable and efficient PSCs by optimizing the perovskite precursor solution.

Phase 1b study of first-line fuzuloparib combined with modified FOLFIRINOX followed by fuzuloparib maintenance monotherapy in pancreatic adenocarcinoma.

BACKGROUND: Chemotherapy remains the standard first-line treatment for pancreatic adenocarcinoma, but with limited efficacy. We aimed to explore the feasibility of adding the PARP inhibitor fuzuloparib to mFOLFIRINOX in the locally advanced/metastatic (LA/M) setting. METHODS: This was the dose-escalation and -expansion, phase 1b portion of a phase 1b/2 study. Patients were given oral fuzuloparib at escalating doses starting at 30 mg twice daily (BID) plus intravenous mFOLFIRINOX q2w for 8-12 cycles, followed by maintenance fuzuloparib at 150 mg BID. Cohorts at the maximal tolerated dose (MTD) and lower dose of fuzuloparib were expanded. Primary endpoints were dose-limiting toxicity (DLT), MTD, and recommended phase 2 dose (RP2D). RESULTS: As of data cutoff on Jan 15, 2023, 39 patients were recruited. 12 patients were enrolled during dose escalation (30 mg [n = 4]; 60 mg [n = 6]; 100 mg [n = 2]). DLT occurred in 1 patient in 60 mg cohort and 1 patient in 100 mg cohort. 60 mg BID was determined to be the MTD, and then 60 and 30 mg cohorts were expanded to 22 and 15 patients, respectively. The most common grade ≥ 3 treatment-related adverse events were hematologic toxicities. Efficacy in 60 mg cohort seemed to be most favorable, with an objective response rate of 50.0% (95% CI, 26.0-74.0) and disease control rate of 94.4% (95% CI, 72.7-99.9). CONCLUSIONS: First-line fuzuloparib plus mFOLFIRINOX followed by maintenance fuzuloparib was generally safe and showed encouraging anti-tumor activity in patients with LA/M pancreatic adenocarcinoma. The RP2D of fuzuloparib combination was 60 mg BID. TRIAL REGISTRATION: ClinicalTrials.gov, NCT04228601.

Machine-learning-based prediction by stacking ensemble strategy for surgical outcomes in patients with degenerative cervical myelopathy.

BACKGROUND: Machine learning (ML) is extensively employed for forecasting the outcome of various illnesses. The objective of the study was to develop ML based classifiers using a stacking ensemble strategy to predict the Japanese Orthopedic Association (JOA) recovery rate for patients with degenerative cervical myelopathy (DCM). METHODS: A total of 672 patients with DCM were included in the study and labeled with JOA recovery rate by 1-year follow-up. All data were collected during 2012-2023 and were randomly divided into training and testing (8:2) sub-datasets. A total of 91 initial ML classifiers were developed, and the top 3 initial classifiers with the best performance were further stacked into an ensemble classifier with a supported vector machine (SVM) classifier. The area under the curve (AUC) was the main indicator to assess the prediction performance of all classifiers. The primary predicted outcome was the JOA recovery rate. RESULTS: By applying an ensemble learning strategy (e.g., stacking), the accuracy of the ML classifier improved following combining three widely used ML models (e.g., RFE-SVM, EmbeddingLR-LR, and RFE-AdaBoost). Decision curve analysis showed the merits of the ensemble classifiers, as the curves of the top 3 initial classifiers varied a lot in predicting JOA recovery rate in DCM patients. CONCLUSIONS: The ensemble classifiers successfully predict the JOA recovery rate in DCM patients, which showed a high potential for assisting physicians in managing DCM patients and making full use of medical resources.

Association Between Serum Interleukin-32 Level and Disease Status in Cases with Neuromyelitis Optica Spectrum Disorders.

Background: Various cytokines are involved in the pathogenesis of neuromyelitis optica spectrum disorders (NMOSD), but whether serum interleukin-32 (IL-32) level is related to disease activity in cases with NMOSD remains poorly understood. Thus, we investigated the underlying role of IL-32 in NMOSD cases. Methods: Our observation recruited 32 cases with acute NMOSD, 36 NMOSD cases in remission, and 60 healthy individuals in this study. Serum concentrations of IL-32 were detected using ELISA. The associations among IL-32 levels and clinical characteristics were assessed by Spearman correlation coefficient and logistic regression analysis. Results: IL-32 concentrations were strongly increased in cases with acute NMOSD [(52.06 ± 16.56) pg/mL] and NMOSD in remission [(25.78 ± 8.31) pg/mL] compared with healthy controls [(10.83 ± 6.94) pg/mL] (all p <0.001). ROC analysis suggested that the AUC for IL-32 and the combined diagnosis of acute NMOSD was 0.811 (P = 0.026, 95% CI 0.673-0.949), with a sensitivity of 0.800 and a specificity of 0.806. The level of IL-32 was positively correlated with EDSS scores in patients with acute NMOSD (r = 0.620, p < 0.001). EDSS score was independently associated with increased serum levels of LI-32 (B = 1.529, p < 0.001). Conclusion: Higher level of IL-32 is related to disease severity in NMOSD. Therefore, serum IL-32 may be a novel biomarker for acute NMOSD.

Impact of Prior Chemotherapy on Response to Second-line Pembrolizumab in Urothelial Cancer: Exploratory Analysis of the Phase 3 KEYNOTE-045 Trial.

BACKGROUND AND OBJECTIVE: Until recently, the standard first-line treatment for advanced urothelial carcinoma (UC) was platinum-based combination chemotherapy followed by avelumab maintenance therapy for patients without progressive disease (PD). For patients with advanced UC who experience PD or recurrence, standard-of-care treatment is pembrolizumab monotherapy based on the phase 3 KEYNOTE-045 study. This post hoc analysis of the KEYNOTE-045 study evaluated the efficacy of pembrolizumab compared with chemotherapy by the best response to prior platinum-based chemotherapy. METHODS: Patients with advanced UC that progressed or recurred after first-line platinum-based chemotherapy were randomly assigned 1:1 to receive either pembrolizumab 200 mg every 3 wk (Q3W) for ≤2 yr or investigator's choice of chemotherapy (paclitaxel [175 mg/m2], docetaxel [75 mg/m2], or vinflunine [320 mg/m2], each Q3W). Endpoints included overall survival (OS) from the initiation of the last treatment prior to death, objective response rate (ORR), and duration of response (DOR) as per Response Evaluation Criteria in Solid Tumors version 1.1 from the date of the first response. KEY FINDINGS AND LIMITATIONS: An objective response to pembrolizumab was observed in all groups in terms of a prior response to first-line platinum-based chemotherapy. Median OS, ORR, and median DOR were numerically greater with pembrolizumab than with chemotherapy across subgroups. Patients with PD as the best response to prior platinum-based chemotherapy had the poorest OS outcomes. Limitations include a lack of formal hypothesis testing. CONCLUSIONS AND CLINICAL IMPLICATIONS: When compared with chemotherapy, prolonged OS and durable responses to second-line pembrolizumab were observed independently of the response to or type of prior platinum-based chemotherapy. These findings further support pembrolizumab as second-line treatment for advanced UC.

A comprehensive evaluation of the frog effect on drivers in mountain highway tunnels - The effect of low-volume intermittent information.

OBJECTIVE: The driver's inability to fully absorb and react to operational cues while driving is like boiling a frog in warm water. With intermittent, low-volume information, drivers can underreact by ignoring these minor but continuous changes. This paper aims to provide an opportunity to test the effects of intermittently occurring low-volume information on drivers. METHODS: A real vehicle test with naturalistic driving was used to collect driving speed data from 40 drivers on a highway tunnel section in Chongqing, China, where nine tunnels are located. Drivers were classified into three categories according to the degree of compliance of their driving speed with the speed limit required by traffic signs, and drivers were analyzed in terms of their sensitivity to traffic signs and their reaction to driving maneuvers. RESULTS: Conservative drivers are the most absorbent of low-volume intermittent information, and the cumulative effect of the frog effect does not exceed 2.00 km; eager drivers tend to ignore this information, and the cumulative effect of the frog effect reaches 2.91 km; and the general type of driver is in the middle of these two types of drivers, and the frog effect gradually penetrates the driving speed in a weakly increasing manner, up to a maximum of 9.8 km. CONCLUSION: At the beginning of a journey, drivers are most sensitive to traffic signs, and low-volume intermittent information can also play a role in guiding driving operations effectively at this time. However, as the driving distance increases, the effect of the frog effect on different types of drivers gradually increases, even exceeding the effect caused by the black-and-white hole effect, especially when driving in tunnel groups. Considering the driving characteristics of different types of drivers to improve the deployment of low-volume intermittent information and reduce the distance of the frog effect can effectively improve driving safety.

Characterizing Biphoton Spatial Wave Function Dynamics with Quantum Wavefront Sensing.

With an extremely high dimensionality, the spatial degree of freedom of entangled photons is a key tool for quantum foundation and applied quantum techniques. To fully utilize the feature, the essential task is to experimentally characterize the multiphoton spatial wave function including the entangled amplitude and phase information at different evolutionary stages. However, there is no effective method to measure it. Quantum state tomography is costly, and quantum holography requires additional references. Here, we introduce quantum Shack-Hartmann wavefront sensing to perform efficient and reference-free measurement of the biphoton spatial wave function. The joint probability distribution of photon pairs at the back focal plane of a microlens array is measured and used for amplitude extraction and phase reconstruction. In the experiment, we observe that the biphoton amplitude correlation becomes weak while phase correlation shows up during free-space propagation. Our work is a crucial step in quantum physical and adaptive optics and paves the way for characterizing quantum optical fields with high-order correlations or topological patterns.

Genetic associations between gut microbiota and type 2 diabetes mediated by plasma metabolites: a Mendelian randomization study.

Background: Numerous research studies have indicated a possible association between type 2 diabetes (T2DM) and gut microbiota. To explore specific metabolic pathways connecting gut microbiota and T2DM, we employed Mendelian randomization (MR) and linkage disequilibrium score regression (LDSC) techniques. Methods: This research utilized data from genome-wide association studies (GWAS) that are publicly accessible. We evaluated the genetic correlation between gut microbiota and T2DM using LDSC. Causality was primarily determined through the inverse variance weighted (IVW) method. To verify the robustness of our results, we conducted sensitivity analyses using several approaches, including the weighted median, MR-Egger, and MR-PRESSO. We integrated summary effect estimates from LDSC, along with forward and reverse MR, into a meta-analysis for T2DM using various data sources. Additionally, mediation analysis was performed to explore the impact of plasma metabolites on the relationship between gut microbiota and T2DM. Results: Our study indicated a significant genetic correlation between genus RuminococcaceaeUCG005 (Rg = -0.26, Rg_P = 2.07×10-4) and T2DM. Moreover, the forward MR analysis identified genus RuminococcaceaeUCG010 (OR = 0.857, 95% CI 0.795, 0.924; P = 6.33×10-5) and order Clostridiales (OR = 0.936, 95% CI 0.878, 0.997; P = 0.039) as being significantly associated with a decreased risk of T2DM. The analysis also highlighted several plasma metabolites as significant mediators in these relationships, with metabolites like octadecadienedioate (C18:2-DC) and branched chain 14:0 dicarboxylic acid being notably involved. Conclusion: The findings demonstrate a significant impact of gut microbiota on T2DM via plasma metabolites, suggesting potential metabolic pathways for therapeutic targeting. This study enhances our understanding of the microbiota's role in T2DM pathogenesis and supports the development of microbiota-based interventions.

Macrophage-derived exosomal miR-155 regulating hepatocyte pyroptosis in MAFLD.

Background: Previous studies have shown that pyroptosis in hepatocyte is essential for the development of MAFLD. Growing evidence has shown that exosomal miRNAs-mediated communication between inflammatory cells and hepatocyte is an important link in MAFLD. In the present study, we aim to elucidate whether macrophage-derived exosomal miRNAs contribute to the hepatocyte pyroptosis in the pathophysiological process of MAFLD. Methods: The effects of hepatocyte pyroptosis were investigated in an HFD-induced MAFLD mouse model and in the liver tissues from patients with MAFLD using immunohistochemistry, real-time PCR, Western blotting, and luciferase reporter assay, among other techniques. MiR-155 inhibitor tail injections and AAV-FoxO3a-GFP were also administered to respectively inhibit or overexpress its expression in an HFD-induced MAFLD mouse model. Results: Hepatocyte pyroptosis was heightened in the liver tissue of patients with MAFLD or HFD-induced MAFLD mouse. Importantly, treatment with a caspase-1 inhibitor or overexpression of FoxO3a reversed this trend. Our study also demonstrated that miR-155 expression and the number of infiltrated macrophages were increased, and knockdown of miR-155 attenuated hepotocyte pyroptosis and liver fibrosis in HFD-induced mouse. In addition, we demonstrated that macrophage-derived exosomal miR-155 was transferred to hepatocytes, leading to hepatocyte pyroptosis in MAFLD mouse. Furthermore, blockade of exosome secretion improved hepotocyte pyroptosis and liver fibrosis in HFD-induced mouse. On the contrary, macrophage-derived exosomal miR-155 worsened hepotocyte pyroptosis. Moreover, we found that miR-155 promoted hepatocyte pyroptosis in MAFLD by down-regulating FoxO3a. Conclusions: Taken together, our results demonstrated that macrophage-derived exosomal miR-155 promotes hepatocyte pyroptosis and liver fibrosis in MAFLD.

Mimics of Host Defense Peptides Derived from Dendronized Polylysines for Antibacterial and Anticancer Therapy.

Bacteria in tumor microenvironments promote carcinogenesis and trigger complications, suggesting the significance of intervening in bacterial growth in cancer treatment. Here, dendrimer-derived mimics (DMs) of host defense peptides (HDPs) were designed for antibacterial and anticancer therapy, which feature a dendronized polylysine core and polycaprolactone arms. DMs displayed not only remarkable activities against Staphylococcus aureus and human lung cancer cells, but also exceptional selectivity. The membranolytic mechanism revealed by morphology analysis explained their low susceptibility to induce resistance. Further, the optimized DM inhibited tumor growth in the subcutaneous tumor model when administered via intraperitoneal injection and exhibited negligible toxicity to tissues. Overall, we combined the superiority of dendrimers and the mechanism from HDPs to design agents with dual antibacterial and anticancer activities that possess great potential for clinical oncology therapy.

Exploring the relationship between anal fistula and colorectal cancer based on Mendelian randomization and bioinformatics.

The association between anal fistula patients and colorectal cancer, as well as the potential pathophysiological mechanisms, remains unclear. To explore the relationship between anal fistula and colorectal cancer and its potential mechanisms. Analysis of GEO and TCGA databases. Disease-related genes were also referenced from Coremine Medical, GeneCard and OMIM. Core hub genes were identified through protein-protein interaction analysis by intersecting differentially expressed genes from the datasets with disease data. On one hand, a prognostic model was developed using genes and its prognostic role was validated. On the other hand, the optimal diagnostic genes were selected through machine learning. Mendelian randomization (MR) analysis was conducted to explore the potential causal link between anal fistula and colorectal cancer. Thirteen core genes were identified (TMEM121B, PDGFRA, MID2, WNT10B, HOXD13, BARX1, SIX2, MMP1, SNAL1, CDKN2A, ITGB3, TIMP1, CALB2). Functional enrichment analysis revealed that the intersecting genes between anal fistula and colorectal cancer were associated with extracellular matrix components, signalling pathways, cell growth, protein modification, as well as important roles in cellular activities, tissue and organ development, and biological function maintenance. These genes were also involved in pathways related to Wnt signalling and colorectal cancer development. Prognostic analysis and immune infiltration analysis indicated a close relationship between core hub genes and the prognosis and immune infiltration in colorectal cancer. Machine learning showed that core genes played an essential role in the diagnostic differentiation of colorectal cancer. MR results suggested no causal relationship between anal fistula and colorectal cancer. This study identified shared core genes between anal fistula and colorectal cancer, involved in various pathways related to tumour development. These genes play crucial roles in prognosis and diagnosis.

Early recurrence and extensive retroperitoneal metastasis after surgery for high­grade mucinous tubular and spindle cell carcinoma: A case report and literature review.

Mucinous tubular and spindle cell carcinoma (MTSCC) is a rare subtype of renal cancer. The present report details the treatment experience of a case of MTSCC, where the patient underwent a right-side laparoscopic nephrectomy in October 2020 at Zhuji People's Hospital (Zhuji, China). A total of 3 months post-operation, multiple metastases were discovered in the right renal area and retroperitoneum, with rapid disease progression observed in the subsequent 2 months. Treatment with tislelizumab combined with pazopanib was ineffective, and the patient subsequently died. Although MTSCC is generally considered a low-grade 'indolent' tumor, with most patients achieving long-term survival post-surgery, a minority of cases, especially those of a higher grade, may experience postoperative recurrence and metastasis. Due to the rarity of metastatic MTSCC, most studies are based on small sample sizes or case reports, and there is a lack of standardized systemic treatment and follow-up strategies for metastatic MTSCC. The present paper summarizes and analyzes the clinical features, treatment methods and prognosis of metastatic MTSCC cases reported in the literature, aiming to provide assistance for the treatment and follow-up management of metastatic MTSCC. Even in cases of distant metastasis, aggressive surgical treatment, metastasectomy combined with molecular targeted or immunotherapy, may still be recommended.

An outbreak of Mycoplasma pneumoniae in children after the COVID-19 pandemic, Shanghai, China, 2023.

Background: During the coronavirus disease 2019 (COVID-19) pandemic, the infection of Mycoplasma pneumoniae (MP) decreased significantly. At the beginning of the summer of 2023, there was an increasing trend of MP infection in China and the MP pneumonia (MPP) is surging when it comes to the school season and lasts for several months which has attracted widespread attention. Objective: This study aims to investigate the prevalent characteristics of the MP and the difference between the COVID-19 pandemic and the post in Shanghai, China. Methods: The demographic information and the results of laboratory pathogen detection from July 2021 to May 2024 were collected and analyzed to find out the prevalent characteristics of MP. Two periods, during the COVID-19 pandemic and the post-pandemic, were divided and compared. The P1 genotyping and macrolide resistance-associated gene of 23 s rRNA were detected using the remaining MP-positive samples. Results: During the COVID-19 pandemic, the prevalence of the MP has significantly decreased. Female children are more susceptible to MP infection than the male. The school-aged group (>6 years) had the highest infection rate. The rate of MP P1 genotype during post panel is higher than that during COVID-19 pandemic, which is dominant from July 2021 to May 2024, while the macrolide-resistant associated mutations (A2063G) keep high percentage during or post pandemic. Conclusion: After the COVID-19 pandemic, an outbreak of MP infection occurred from summer onwards in 2023 with children in Shanghai, China. Immunity debt and high rate of macrolide-resistance may take effects in this MP epidemic. Continuous surveillance of MP is necessary to help to alert the prevalence of MPP.

[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR­1301­3p/KIF23 axis.

Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR­545­3p (5'­TGGCTCAGTTCAGCAGGAAC­3') was actually for miR­24­3p (5'­UGGCUCAGUUCAGCAGGAACAG­3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR­670­5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I.  The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR­670­5p and miR­545­3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].

Smoking behaviors, physical activities, pulmonary diseases and COVID-19 severity: A Mendelian randomization study.

Smoking behaviors, physical activities, and pulmonary diseases have been revealed to be associated with COVID-19 severity through observational research. The possible causative effect remains undetermined. To investigate this, we thus carried out a Mendelian randomization (MR) analysis. We chose genetic variants from genome-wide association studies that are strongly linked to 5 exposures related to smoking, 1 exposure related to drinking, 3 levels of physical activity, and 3 pulmonary diseases. The COVID-19 Host Genetics Initiative provided summary-level data for severe COVID-19 (13,769 cases and 1,072,442 noncases), hospitalized COVID-19 (32,519 cases and 2,062,805 noncases), and COVID-19 susceptibility (122,616 cases and 2,475,240 noncases). Univariate and multivariate MR analyses were carried out. Significant associations were found between severe COVID-19 and cigarette smoking per day (OR = 1.357, 95% CI: 1.087-1.694), lifetime smoking index (OR = 2.277, 95% CI: 1.602-3.325), and interstitial lung disease (OR = 1.23, 95% CI: 1.112-1.362), hospitalized COVID-19 and lifetime smoking index (OR = 2.199, 95% CI: 1.738-2.781), smoking initiation (OR = 1.419, 95% CI: 1.230-1.637), and interstitial lung disease (OR = 1.146, 95% CI: 1.082-1.214), as well as COVID-19 susceptibility and lifetime smoking index (OR = 1.39, 95% CI: 1.252-1.543), smoking initiation (OR = 1.235, 95% CI: 1.163-1.311), and duration of vigorous activity per day (OR = 0.733, 95% CI: 0.574-0.935). Duration of vigorous activity per day was suggestively inversely linked to hospitalized COVID-19 (OR = 0.434, 95% CI: 0.221-0.853) and severe COVID-19 (OR = 0.323, 95% CI: 0.123-0.850). The association for lifetime smoking index remained consistent with severe COVID-19, hospitalized COVID-19, and COVID-19 susceptibility in multivariable MR analysis. Genetic liability to lifetime smoking index mediated the interstitial lung disease effects on severe COVID-19 risk (21.0%) and hospitalized COVID-19 risk (14.4%). This study identified several smoking behaviors, duration of vigorous activity per day, and interstitial lung disease that may be causally related to COVID-19 severity.

Subanesthetic Dose of Esketamine Improves the Sedative and Analgesic Effects of Dexmedetomidine and Remifentanil in Liposuction Anesthesia: A Prospective, Double-Blinded, Randomized Controlled Trial.

Purpose: Esketamine have anesthetic and analgesic properties. This study aimed to observe the enhancing effect of subanesthetic doses of esketamine (0.15-0.3 mg/kg/h) with dexmedetomidine and remifentanil during anesthesia for liposuction surgery. Patients and Methods: A total of 155 subjects were randomized with a 1:1 ratio to Group E (esketamine-dexmedetomidine/remifentanil, n=78) or Group C (saline-dexmedetomidine/remifentanil group, n=77). The primary outcome was satisfaction of patient and surgical team with the procedure. The secondary outcomes were the postoperative Athens Insomnia Scale (AIS) and Hospital Anxiety and Depression Scale (HADS) scores, hemodynamic and respiratory changes, drug consumption, adverse event rates, and predictors associated with patient satisfaction. Results: Patient and surgical team satisfaction with the procedure was significantly higher in Group E than in Group C (4.7 ± 0.6 vs 4.2 ± 0.7, P < 0.001; 4.7 ± 0.5 vs 4.4 ± 0.7, P = 0.005). The postoperative AIS (4 [1, 6] vs 5 [2, 9], P = 0.012) and HADS-A (1 [0, 3] vs 2 [0, 6], P = 0.012) scores were significantly lower in Group E than in Group C. Hemodynamic and respiratory parameters were more stable in Group E than in Group C, with the lower opioids consumption of sufentanil (0 [0, 4] vs 5 [2.5, 7.7], P < 0.001) and remifentanil (700 [480, 900] vs 800 [500, 1200], P = 0.023) in Group E compared to Group C. On ordinal logistics regression, postoperative sleep quality (OR, 0.70; 95% CI, 0.62-0.79), anxiety level (OR, 0.77; 95% CI, 0.62-0.95) and recovery time in post-anesthesia care unit (PACU) (OR, 0.69; 95% CI, 0.56-0.98) were identified as significant predictors associated with patient satisfaction. Conclusion: A subanesthetic dose of esketamine (0.15-0.3 mg/kg/h) as an adjuvant can improves the sedative and analgesic effects of dexmedetomidine and remifentanil during anesthesia for liposuction surgery. Clinical Trial Registration: ChiCTR2400080363.