In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor.

Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10-9 - 200 × 10-9 M), detection limit (1.0 × 10-9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.

Complete genome sequence of an oryctes rhinoceros nudivirus isolated from Korean rhinoceros beetles (Trypoxylus dichotomus) in Korea.

Nudivirus-infected Korean rhinoceros beetles (Trypoxylus dichotomus) were first identified in 2015, and while a complete genome sequence of the virus has long been uploaded to the NCBI database, it has not been examined in detail. Here, we describe the genomic characteristics of Trypoxylus dichotomus nudivirus (TdNV), which represents a new Oryctes rhinoceros nudivirus (OrNV) strain, isolated from infected T. dichotomus in the Republic of Korea. We examined factors derived by the cross-species infection of OrNV from nucleotide levels to the whole genome level. Our genomic analysis study suggests that TdNV-Korea is highly conserved with other OrNVs in terms of genomic structures and genome size. Our investigation of the genomic structure revealed that TdNV-Korea has the least number of open reading frames (ORFs) of all available OrNV genomes; three hypothetical genes were notably absent only in TdNV-Korea. In addition, the genomic alteration of the nudivirus core genes discloses that various amino acid mutations caused by single-nucleotide polymorphism and short indels (insertion/deletion) were found in most of the nudivirus core genes of TdNV-Korea. Our findings provide a valuable resource for those seeking a greater understanding of cross-species nudivirus transmission and will certainly provide valuable insight for reconstruction and reinterpretation of future and previously identified OrNV strains.

Aptameric Fluorescent Biosensors for Liver Cancer Diagnosis.

Liver cancer is a prevalent global health concern with a poor 5-year survival rate upon diagnosis. Current diagnostic techniques using the combination of ultrasound, CT scans, MRI, and biopsy have the limitation of detecting detectable liver cancer when the tumor has already progressed to a certain size, often leading to late-stage diagnoses and grim clinical treatment outcomes. To this end, there has been tremendous interest in developing highly sensitive and selective biosensors to analyze related cancer biomarkers in the early stage diagnosis and prescribe appropriate treatment options. Among the various approaches, aptamers are an ideal recognition element as they can specifically bind to target molecules with high affinity. Furthermore, using aptamers, in conjunction with fluorescent moieties, enables the development of highly sensitive biosensors by taking full advantage of structural and functional flexibility. This review will provide a summary and detailed discussion on recent aptamer-based fluorescence biosensors for liver cancer diagnosis. Specifically, the review focuses on two promising detection strategies: (i) Förster resonance energy transfer (FRET) and (ii) metal-enhanced fluorescence for detecting and characterizing protein and miRNA cancer biomarkers.

Selection and Comparative Gene Expression of Midgut-Specific Targets for Drosophila suzukii.

Spotted-wing drosophila (SWD), Drosophila suzukii, is a destructive and invasive pest that attacks most small fruits and cherries. The current management for SWD involves the use of conventional insecticides. In an effort to develop a biologically based control option, the application of RNA interference (RNAi) has been investigated. To develop an RNAi approach, suitable targets must be identified, and an efficient delivery method must be developed for introducing the double-stranded RNA (dsRNA) in the midgut. In D. suzukii, we previously found that dsRNA nucleases actively degrade dsRNA molecules in the midgut. In this study, we focused on identifying biological targets focused on the midgut membrane. The profile of midgut-specific genes was analyzed and compared with the genes expressed in the whole-body using transcriptome analysis. Differential gene expression analysis revealed that 1921 contigs were upregulated and 1834 contigs were downregulated in the midgut when compared to genes from other body tissues. We chose ten midgut-specifically upregulated genes and empirically confirmed their expressions. We are particularly interested in the midgut membrane proteins, including G protein-coupled receptors (GPCRs) such as diuretic hormone 31 (DH31) receptor, neuropeptide F (NPF) recepror, toll-9, adhesion receptors, methuselah (mth), and gustatory receptor, because insect GPCRs have been offered great potential for next-generation pest management.

Effects of nonnutritional sugars on lipid and carbohydrate content, physiological uptake, and excretion in Drosophila suzukii.

The nonnutritive sugar, erythritol, has the potential to be a human-safe management tool for the small fruits and cherry pest, Drosophila suzukii, or spotted-wing drosophila. Feeding on erythritol decreases fly survival and oviposition by starving and creating an osmotic imbalance in the body. Recently, we demonstrated that erythritol combined with another nonnutritive sugar, sucralose, was fed upon more than erythritol alone and hastens D. suzukii mortality. This suggests that sucralose is a suitable nonnutritive phagostimulant alternative to sucrose. Although promising, the nutritional and physiological impacts of sucralose on D. suzukii are unknown. In this study, we investigated whether sucralose is metabolized or excreted by D. suzukii when fed various erythritol, sucrose, and sucralose formulations. We found that sucralose cannot be metabolized or converted into any nutritional substitutes or storage carbohydrates in D. suzukii. Instead, sucralose molecules were largely accumulated in the hemolymph and slowly excreted from the body, creating a significant osmotic imbalance in D. suzukii. To excrete unused sugars, flies will use their own body fluids to restore homeostasis, resulting in losing a substantial amount of body weight and becoming desiccated in the process. In summary, ingesting sucralose leads to starvation and hyperosmotic pressure in the body, causing a decrease in fitness. With confirmation of sucralose being non-metabolizable and phagostimulative to D. suzukii, the erythritol+sucralose formulation is a promising insecticide for growers to use.

Coleopteran-specific StaufenC functions like Drosophila melanogaster Loquacious-PD in dsRNA processing.

In Drosophila melanogaster, PD isoform of the double-stranded RNA binding protein (dsRBP) Loquacious (Loqs-PD) facilitates dsRNA cleavage to siRNA by Dicer-2. StaufenC (StauC) was discovered as a coleopteran-specific dsRBP required for dsRNA processing in coleopteran insects. Here, we show that StauC is essential for the high RNAi efficiency observed in coleopterans. Knockdown of StauC but not the homologs of Loqs-PD and R2D2 evoked a long-lasting insensitivity to RNAi in the coleopteran cell line, Ledp-SL1. The dsRNA insensitivity induced by StauC knockdown could not be overcome merely by an increase in dose or time of exposure to dsRNA or expression of Loquacious or R2D2. Furthermore, StauC but not Loqs and R2D2 are required for processing of dsRNA into siRNA. StauC overexpression also partly restored the impaired RNAi caused by the knockdown of Loqs-PD in D. melanogaster Kc cells. However, StauC was unable to compensate for the loss-of-the function of Dcr-2 or R2D2. Overall, these data suggest that StauC functions like Lops-PD in processing dsRNA to siRNA.

Identification and functional analysis of dsRNases in spotted-wing drosophila, Drosophila suzukii.

RNAi efficiency in insects is different from species to species; some species in Coleoptera are relatively more amenable to RNA interference (RNAi) than other species. One of the major factors is the presence of dsRNA-degrading enzymes, called dsRNases, in saliva, gut, or hemolymph in insects, which degrade the double-stranded RNA (dsRNA) introduced, resulting in the low efficacy of RNAi. In this study, we report a dsRNA-degrading activity in the gut homogenates from the spotted-wing drosophila, Drosophila suzukii, by ex vivo assay. Then, we identified two Drosophila suzukii dsRNase genes, named DrosudsRNase1 and DrosudsRNase2. In silico analysis shows that the gene structures are similar to dsRNases found in other insects. When dsRNases expressed in Sf9 cells were compared for their dsRNA degrading activities, dsRNase1 was more vital than dsRNase2. Both dsRNases were expressed highly and exclusively in the gut compared to the rest of body. Also, they were highly expressed during larval and adult stages but not in embryonic and pupal stages, suggesting the dsRNases protect foreign RNA molecules received during the feeding periods. DsRNase1 was expressed at a higher level in adults, whereas dsRNase2 showed more expression in early larvae. Our study on the tissue and development-specific patterns of dsRNases provides an improved understanding of the RNAi application for the management of D. suzukii.

Candidate genetic determinants of intraspecific variation in pea aphid susceptibility to RNA interference.

RNA interference (RNAi) plays a key role in insect defense against viruses and transposable elements, and it is being applied as an experimental tool and for insect pest control. However, RNAi efficiency is highly variable for some insects, notably the pea aphid Acyrthosiphon pisum. In this study, we used natural variation in RNAi susceptibility of pea aphids to identify genes that influence RNAi efficiency. Susceptibility to orally-delivered dsRNA against the gut aquaporin gene AQP1 (ds-AQP1) varied widely across a panel of 83 pea aphid genotypes, from zero to total mortality. Genome-wide association between aphid performance on ds-AQP1 supplemented diet and aphid genetic variants yielded 103 significantly associated single nucleotide polymorphisms (SNPs), including variants in 55 genes, at the 10-4 probability cut-off. When ds-AQP1 was co-administered with dsRNA against six candidate genes, aphid mortality was reduced for three (50%) genes: the orthologs of the Drosophila genes trachealess (CG42865), headcase (CG15532) and a gene coding a peritrophin-A domain (CG8192), indicating that these genes function to promote RNAi efficiency against AQP1 in the pea aphid. Aphid susceptibility (quantified as mortality) to ds-AQP1 was correlated with RNAi against a further gene, snakeskin with essential gut function unrelated to AQP1, for some but not all aphid genotypes tested, suggesting that the determinants of RNAi efficiency may be partly gene-specific. This study demonstrates high levels of natural variation in susceptibility to RNAi and demonstrates the value of harnessing this variation to identify genes influencing RNAi efficiency.

Evaluation of inhibitor of apoptosis genes as targets for RNAi-mediated control of insect pests.

Apoptosis has been widely studied from mammals to insects. Inhibitor of apoptosis (IAP) protein is a negative regulator of apoptosis. Recent studies suggest that iap genes could be excellent targets for RNA interference (RNAi)-mediated control of insect pests. However, not much is known about iap genes in one of the well-known insect model species, Tribolium castaneum. The orthologues of five iap genes were identified in T. castaneum by searching its genome at NCBI (https://www.ncbi.nlm.nih.gov/) and UniProt (https://www.uniprot.org/) databases using Drosophila melanogaster and Aedes aegypti IAP protein sequences as queries. RNAi assays were performed in T. castaneum cell line (TcA) and larvae. The knockdown of iap1 gene induced a distinct apoptotic phenotype in TcA cells and induced 91% mortality in T. castaneum larvae. Whereas, knockdown of iap5 resulted in a decrease in cell proliferation in TcA cells and developmental defects in T. castaneum larvae which led to 100% mortality. Knockdown of the other three iap genes identified did not cause a significant effect on cells or insects. These data increase our understanding of iap genes in insects and provide opportunities for developing iap1 and iap5 as targets for RNAi-based insect pest control.

Identification of target genes for RNAi-mediated control of the Twospotted Spider Mite.

RNA interference (RNAi) is being developed for the management of pests that destroy crops. The twospotted Spider Mite (TSSM), Tetranychus urticae is a worldwide pest due to its unique physiological and behavioral characteristics including extraordinary ability to detoxify a wide range of pesticides and feed on many host plants. In this study, we conducted experiments to identify target genes that could be used for the development of RNAi-based methods to control TSSM. Leaf disc feeding assays revealed that knockdown in the expression genes coding for proteins involved in the biosynthesis and action of juvenile hormone (JH) and action of ecdysteroids [Methoprene-tolerant (Met), retinoid X receptor ß, farnesoic acid O-methyltransferase, and CREB-binding protein] caused 35-56% mortality. Transgenic tobacco plants expressing hairpin dsRNA targeting Met gene were generated and tested. About 48% mortality was observed in TSSM raised on transgenic tobacco plants expressing dsMet. These studies not only broaden our knowledge on understanding hormone action in TSSM but also identified target genes that could be used in RNAi-mediated control of TSSM.

Double-stranded RNA binding protein, Staufen, is required for the initiation of RNAi in coleopteran insects.

RNA interference (RNAi) is being used to develop methods to control pests and disease vectors. RNAi is robust and systemic in coleopteran insects but is quite variable in other insects. The determinants of efficient RNAi in coleopterans, as well as its potential mechanisms of resistance, are not known. RNAi screen identified a double-stranded RNA binding protein (StaufenC) as a major player in RNAi. StaufenC homologs have been identified in only coleopteran insects. Experiments in two coleopteran insects, Leptinotarsa decemlineata and Tribolium castaneum, showed the requirement of StaufenC for RNAi, especially for processing of double-stranded RNA (dsRNA) to small interfering RNA. RNAi-resistant cells were selected by exposing L. decemlineata, Lepd-SL1 cells to the inhibitor of apoptosis 1 dsRNA for multiple generations. The resistant cells showed lower levels of StaufenC expression compared with its expression in susceptible cells. These studies showed that coleopteran-specific StaufenC is required for RNAi and is a potential target for RNAi resistance. The data included in this article will help improve RNAi in noncoleopteran insects and manage RNAi resistance in coleopteran insects.

Accumulation of dsRNA in endosomes contributes to inefficient RNA interference in the fall armyworm, Spodoptera frugiperda.

RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects.

RNA interference in the Colorado potato beetle, Leptinotarsa decemlineata: Identification of key contributors.

RNA interference (RNAi) is a useful reverse genetics tool for investigation of gene function as well as for practical applications in many fields including medicine and agriculture. RNAi works very well in coleopteran insects including the Colorado potato beetle (CPB), Leptinotarsa decemlineata. We used a cell line (Lepd-SL1) developed from CPB to identify genes that play key roles in RNAi. We screened 50 genes with potential functions in RNAi by exposing Lepd-SL1 cells to dsRNA targeting one of the potential RNAi pathway genes followed by incubation with dsRNA targeting inhibitor of apoptosis (IAP, silencing of this gene induces apoptosis). Out of 50 genes tested, silencing of 29 genes showed an effect on RNAi. Silencing of five genes (Argonaute-1, Argonaute-2a, Argonaute-2b, Aubergine and V-ATPase 16 kDa subunit 1, Vha16) blocked RNAi suggesting that these genes are essential for functioning of RNAi in Lepd-SL1 cells. Interestingly, Argonaute-1 and Aubergine which are known to function in miRNA and piRNA pathways respectively are also critical to siRNA pathway. Using 32P labeled dsRNA, we showed that these miRNA and piRNA Argonautes but not Argonaute-2 are required for processing of dsRNA to siRNA. Transfection of pIZT/V5 constructs containing these five genes into Sf9 cells (the cells where RNAi does not work well) showed that expression of all genes tested, except the Argonaute-2a, improved RNAi in these cells. Results from Vha16 gene silencing and bafilomycin-A1 treatment suggest that endosomal escape plays an important role in dsRNA-mediated RNAi in Lepd-SL1 cells.

Toxicity and synergic repellency of plant essential oil mixtures with vanillin against Aedes aegypti (Diptera: Culicidae).

In all triplicate tests of six plant essential oils and of vanillin mixtures, we corroborated strong insecticidal and repellent activities against adult Aedes aegypti (L.). Essential oils with potent toxic fumigant activities also exhibited repellency. Compared with N, N-diethyl-3-methylbenzamide, 5% of the essential oil concentrations of cassia, lemongrass, lemon eucalyptus, and xanthoxylum oils did not show repellent effects. However, a composition oflemongrass oil, xanthoxylum oil, and vanillin (1:3:1, vol:vol:wt) provided 270 min of complete protection time (CPT) compared with 247.5 min CPT with 15% N, N-diethyl-3-methylbenzamide. The CPT depended on concentration, presence ofvanillin, or on both factors. When we applied a mixture of lemongrass oil: xanthoxylum oil: vanillin (1:1:1, vol:vol:wt) to the Viscopearl formulation, or porous cellulose beads, it provided gradual release of volatile compounds, thus showing >90% of repellency for 2 h. The behavioral and electrophysiological approaches we drew upon in our current study demonstrated that plant essential oil mixtures combined with vanillin showed strong and durable repellency to the mosquito. We claim that such combinations of plant essential oils and vanillin found in current study propose a viable commercial product suitable for future application in protecting a person from mosquito bites.