Brucella NpeA is a secreted Type IV effector containing an N-WASP-binding short linear motif that promotes niche formation.

The modulation of actin polymerization is a common theme among microbial pathogens. Even though microorganisms show a wide repertoire of strategies to subvert the activity of actin, most of them converge in the ones that activate nucleating factors, such as the Arp2/3 complex. Brucella spp. are intracellular pathogens capable of establishing chronic infections in their hosts. The ability to subvert the host cell response is dependent on the capacity of the bacterium to attach, invade, avoid degradation in the phagocytic compartment, replicate in an endoplasmic reticulum-derived compartment and egress. Even though a significant number of mechanisms deployed by Brucella in these different phases have been identified and characterized, none of them have been described to target actin as a cellular component. In this manuscript, we describe the identification of a novel virulence factor (NpeA) that promotes niche formation. NpeA harbors a short linear motif (SLiM) present within an amphipathic alpha helix that has been described to bind the GTPase-binding domain (GBD) of N-WASP and stabilizes the autoinhibited state. Our results show that NpeA is secreted in a Type IV secretion system-dependent manner and that deletion of the gene diminishes the intracellular replication capacity of the bacterium. In vitro and ex vivo experiments demonstrate that NpeA binds N-WASP and that the short linear motif is required for the biological activity of the protein.IMPORTANCEThe modulation of actin-binding effectors that regulate the activity of this fundamental cellular protein is a common theme among bacterial pathogens. The neural Wiskott-Aldrich syndrome protein (N-WASP) is a protein that several pathogens target to hijack actin dynamics. The highly adapted intracellular bacterium Brucella has evolved a wide repertoire of virulence factors that modulate many activities of the host cell to establish successful intracellular replication niches, but, to date, no effector proteins have been implicated in the modulation of actin dynamics. We present here the identification of a virulence factor that harbors a short linear motif (SLiM) present within an amphipathic alpha helix that has been described to bind the GTPase-binding domain (GBD) of N-WASP stabilizing its autoinhibited state. We demonstrate that this protein is a Type IV secretion effector that targets N-WASP-promoting intracellular survival and niche formation.

If You're Not Confused, You're Not Paying Attention: Ochrobactrum Is Not Brucella.

Bacteria of the genus Brucella are facultative intracellular parasites that cause brucellosis, a severe animal and human disease. Recently, a group of taxonomists merged the brucellae with the primarily free-living, phylogenetically related Ochrobactrum spp. in the genus Brucella. This change, founded only on global genomic analysis and the fortuitous isolation of some opportunistic Ochrobactrum spp. from medically compromised patients, has been automatically included in culture collections and databases. We argue that clinical and environmental microbiologists should not accept this nomenclature, and we advise against its use because (i) it was presented without in-depth phylogenetic analyses and did not consider alternative taxonomic solutions; (ii) it was launched without the input of experts in brucellosis or Ochrobactrum; (iii) it applies a non-consensus genus concept that disregards taxonomically relevant differences in structure, physiology, population structure, core-pangenome assemblies, genome structure, genomic traits, clinical features, treatment, prevention, diagnosis, genus description rules, and, above all, pathogenicity; and (iv) placing these two bacterial groups in the same genus creates risks for veterinarians, medical doctors, clinical laboratories, health authorities, and legislators who deal with brucellosis, a disease that is particularly relevant in low- and middle-income countries. Based on all this information, we urge microbiologists, bacterial collections, genomic databases, journals, and public health boards to keep the Brucella and Ochrobactrum genera separate to avoid further bewilderment and harm.

Aborto em bovinos e bubalinos: causas específicas e inespecíficas / Abortion in cattle and buffaloes: specific and non-specific causes

O aborto é caracterizado como a expulsão do feto sem viabilidade para fora do ambiente uterino da progenitora durante o período que vai do 42° dia a o 260° dia. São descritos diversos fatores infecciosos e não infecciosos como etiologia para o aborto. Dentre os infecciosos, destacam-se as infecções por bactérias, vírus, protozoários e fungos. Enquanto as causas não infecciosas englobam falhas de manejo nutricional, intoxicações e medicamentos que ocasionalmente podem levar à morte fetal. Essa mortalidade fetal é causa importante de perdas reprodutivas na cadeia produtiva de animais domésticos, especialmente bovinos e bubalinos. Ambas as espécies participam da produtividade econômica no Brasil e compartilham de diversas doenças que são causas de aborto. Nesse contexto, o objetivo desta revisão foi reunir e discorrer sobre as principais informações concernentes às possíveis etiologias do aborto, sejam elas de origem infecciosa ou não infecciosas nas espécies bovinas e bubalinas no Brasil.

Abortion is characterized as the expulsion of the non-viable fetus outside the mother's uterine environment during the period between the 42nd day to the 260th day. Several infectious and non-infectious factors are described as etiology for miscarriage. Among the infectious, infections by bacteria, viruses, protozoa, and fungi stand out, while non-infectious causes include failures in nutritional management, poisoning, and medications that occasionally can lead to fetal death. This fetal mortality is an important cause of reproductive losses in the production chain of domestic animals, especially cattle and buffaloes. Both species participate in economic productivity in Brazil and share several diseases that are causes of abortion. In this context, this review aimed to gather and discuss the main information concerning the possible etiologies of abortion, whether of infectious or non-infectious origin in bovine and buffalo species in Brazil.

Chronic prostatitis in a dog infected with a smooth strain of Brucella spp

Dogs may be occasionally infected by smooth strains of Brucella spp. The infection is usually associated with the ingestion of contaminated material from parturition or abortion, or other tissues from infected farm animals, particularly cattle and pigs. A 6-year-old, male mixed breed dog from a rural area was admitted at a veterinary clinic for clinical examination. The dog had bilateral perineal hernia with dysuria and dyschezia, as well as small firm testicles with scrotal adhesions. Serological tests, including buffered plate antigen, serum agglutination test, and 2-mercaptoethanol test, were positive for smooth Brucella spp. strains, whereas a rapid slide agglutination test was negative for B. canis. Blood and prostate tissue samples yielded no bacterial isolates. Histopathology demonstrated interstitial lymphoplasmacytic and histiocytic infiltration of the prostate gland, with fibrosis and occasional disruption of glandular architecture. Immunohistochemistry demonstrated abundant Brucella spp. antigens in the cytoplasm of macrophages. This report supports the notion that not only B. canis, but also smooth Brucella spp. must be considered in the differential diagnosis of prostatitis in dogs.(AU)

Chronic prostatitis in a dog infected with a smooth strain of Brucella spp

Dogs may be occasionally infected by smooth strains of Brucella spp. The infection is usually associated with the ingestion of contaminated material from parturition or abortion, or other tissues from infected farm animals, particularly cattle and pigs. A 6-year-old, male mixed breed dog from a rural area was admitted at a veterinary clinic for clinical examination. The dog had bilateral perineal hernia with dysuria and dyschezia, as well as small firm testicles with scrotal adhesions. Serological tests, including buffered plate antigen, serum agglutination test, and 2-mercaptoethanol test, were positive for smooth Brucella spp. strains, whereas a rapid slide agglutination test was negative for B. canis. Blood and prostate tissue samples yielded no bacterial isolates. Histopathology demonstrated interstitial lymphoplasmacytic and histiocytic infiltration of the prostate gland, with fibrosis and occasional disruption of glandular architecture. Immunohistochemistry demonstrated abundant Brucella spp. antigens in the cytoplasm of macrophages. This report supports the notion that not only B. canis, but also smooth Brucella spp. must be considered in the differential diagnosis of prostatitis in dogs.

The one hundred year journey of the genus Brucella (Meyer and Shaw 1920).

The genus Brucella, described by Meyer and Shaw in 1920, comprises bacterial pathogens of veterinary and public health relevance. For 36 years, the genus came to include three species that caused brucellosis in livestock and humans. In the second half of the 20th century, bacteriologists discovered five new species and several 'atypical' strains in domestic animals and wildlife. In 1990, the Brucella species were recognized as part of the Class Alphaproteobacteria, clustering with pathogens and endosymbionts of animals and plants such as Bartonella, Agrobacterium and Ochrobactrum; all bacteria that live in close association with eukaryotic cells. Comparisons with Alphaproteobacteria contributed to identify virulence factors and to establish evolutionary relationships. Brucella members have two circular chromosomes, are devoid of plasmids, and display close genetic relatedness. A proposal, asserting that all brucellae belong to a single species with several subspecies debated for over 70 years, was ultimately rejected in 2006 by the subcommittee of taxonomy, based on scientific, practical, and biosafety considerations. Following this, the nomenclature of having multiples Brucella species prevailed and defined according to their molecular characteristics, host preference, and virulence. The 100-year history of the genus corresponds to the chronicle of scientific efforts and the struggle for understanding brucellosis.

Brucella Genomics: Macro and Micro Evolution.

Brucella organisms are responsible for one of the most widespread bacterial zoonoses, named brucellosis. The disease affects several species of animals, including humans. One of the most intriguing aspects of the brucellae is that the various species show a ~97% similarity at the genome level. Still, the distinct Brucella species display different host preferences, zoonotic risk, and virulence. After 133 years of research, there are many aspects of the Brucella biology that remain poorly understood, such as host adaptation and virulence mechanisms. A strategy to understand these characteristics focuses on the relationship between the genomic diversity and host preference of the various Brucella species. Pseudogenization, genome reduction, single nucleotide polymorphism variation, number of tandem repeats, and mobile genetic elements are unveiled markers for host adaptation and virulence. Understanding the mechanisms of genome variability in the Brucella genus is relevant to comprehend the emergence of pathogens.

Marcadores moleculares para la taxonomía e identificación del género Brucella (Alphaproteobacteria) / Molecular markers for the taxonomy and identification of the genus Brucella (Alphaproteobacteria)

Introducción: El género Brucella está incluido en la familia Brucellaceae que pertenece al orden Rhizobiales y es reconocido por su alto grado de patogenicidad. Las bacterias de este género son responsables de la brucelosis, enfermedad que ha sido reportada como una de las zoonosis más importantes a nivel mundial por su incidencia en el ganado y el hombre. Los estudios previos para la clasificación taxonómica del género, se han basado fundamentalmente en el análisis del gen 16S ARNr. Sin embargo, pocas investigaciones se han dirigido a la identificación de marcadores moleculares que distingan a sus miembros de otros grupos de bacterias. Objetivo: Identificar inserciones en secuencias de proteínas conservadas, que pudieran ser utilizados como marcadores moleculares para la taxonomía y diagnóstico de especies del género Brucella. Métodos: Las secuencias homólogas de las proteínas analizadas fueron obtenidas de bases de datos internacionales y, posteriormente, alineadas con el programa ClustalX2, para ello fueron considerados los parámetros sugeridos en la literatura. Resultados: Se identificaron inserciones en las proteínas oxoglutarato deshidrogenasa (componente E1) y ADN ligasa A específicas del género Brucella. Conclusiones: Las inserciones halladas pueden ser empleadas como complemento a los métodos tradicionales de clasificación taxonómica y para el diagnóstico molecular de bacterias incluidas en el género Brucella(AU)

Introduction: Brucella is a genus from the Brucellaceae family, Rhizobiales order. This genus is recognized for its high pathogenicity. Brucella bacteria cause brucellosis, a disease reported as one of the most important zoonoses worldwide due to its incidence in cattle and people. Previous studies on taxonomic classification of the genus have been mainly based on the analysis of gene 16S rDNA. However, few studies have been aimed at identification of molecular markers distinguishing its members from other groups of bacteria. Objective: Identify insertions in preserved protein sequences which could be used as molecular markers for the taxonomy and diagnosis of species from the Brucella genus. Methods: The homologous sequences for the proteins analyzed were obtained from international databases and aligned with the software ClustalX2, considering the parameters suggested in the literature. Results: Insertions were identified in the proteins oxoglutarate dehydrogenase (component E1) and DNA ligase A, specific of the genus Brucella. Conclusions: The insertions found may be used as complements to the traditional methods for taxonomic classification and for the molecular diagnosis of bacteria from the genus Brucella(AU)

Dendritic cells and Brucella spp. interaction: the sentinel host and the stealthy pathogen.

As dendritic cells (DCs) are among the first cells to encounter antigens, these cells trigger both innate and T cell responses, and are the most potent antigen-presenting cells. Brucella spp., which is an intracellular facultative and stealthy pathogen, is able to evade the bactericidal activities of professional phagocytes. Several studies have demonstrated that Brucella can survive and replicate intracellularly, thereby provoking impaired maturation of DCs. Therefore, the interaction between DCs and Brucella becomes an interesting model to study the immune response. In this review, we first will describe the most common techniques for DCs differentiation in vitro as well as general features of brucellosis. Then, the interaction of DCs and Brucella, including pathogen recognition, molecular mechanisms of bacterial pathogenesis, and intracellular trafficking of Brucella to subvert innate response, will be reviewed. Finally, we will debate diversity in immunological DC response and the controversial role of DC activation against Brucella infection.

Prediction of Structure and Molecular Interaction with DNA of BvrR, a Virulence-Associated Regulatory Protein of Brucella.

Brucellosis, also known as "undulant fever" is a zoonotic disease caused by Brucella, which is a facultative intracellular bacterium. Despite efforts to eradicate this disease, infection in uncontrolled domestic animals persists in several countries and therefore transmission to humans is common. Brucella evasion of the innate immune system depends on its ability to evade the mechanisms of intracellular death in phagocytic cells. The BvrR-BvrS two-component system allows the bacterium to detect adverse conditions in the environment. The BvrS protein has been associated with genes of virulence factors, metabolism, and membrane transport. In this study, we predicted the DNA sequence recognized by BvrR with Gibbs Recursive Sampling and identified the three-dimensional structure of BvrR using I-TASSER suite, and the interaction mechanism between BvrR and DNA with Protein-DNA docking and molecular dynamics (MD) simulation. Based on the Gibbs recursive Sampling analysis, we found the motif AAHTGC (H represents A, C, and T nucleotides) as a possible sequence recognized by BvrR. The docking and EMD simulation results showed that C-terminal effector domain of BvrR protein is likely to interact with AAHTGC sequence. In conclusion, we predicted the structure, recognition motif, and interaction of BvrR with DNA.

Immune Response to Mucosal Brucella Infection.

Brucellosis is one of the most prevalent bacterial zoonosis of worldwide distribution. The disease is caused by Brucella spp., facultative intracellular pathogens. Brucellosis in animals results in abortion of fetuses, while in humans, it frequently manifests flu-like symptoms and a typical undulant fever, being osteoarthritis a common complication of the chronic infection. The two most common ways to acquire the infection in humans are through the ingestion of contaminated dairy products or by inhalation of contaminated aerosols. Brucella spp. enter the body mainly through the gastrointestinal and respiratory mucosa; however, most studies of immune response to Brucella spp. are performed analyzing models of systemic immunity. It is necessary to better understand the mucosal immune response induced by Brucella infection since this is the main entry site for the bacterium. In this review, some virulence factors and the mechanisms needed for pathogen invasion and persistence are discussed. Furthermore, some aspects of local immune responses induced during Brucella infection will be reviewed. With this knowledge, better vaccines can be designed focused on inducing protective mucosal immune response.

Epidemiological study of swine brucellosis in household farms in Federal District of Brazil / Estudo epidemiológico de brucelose em suínos em criatórios de subsistência do Distrito Federal, Brasil

Brucellosis is caused by 10 species of Brucella sp. and is responsible for huge economic losses. There are no specific prophylactic measures present for household pigs, which can be also reservoirs, in the brazilian National Program for the Control and Eradication of Animal Brucellosis and Tuberculosis. Therefore, we conducted a cross-sectional study of blood serum samples from 1793 household pigs from 823 farms in Federal District of Brazil. Serum samples were collected between August and October in 2011, 2012, and 2014 by the veterinarians under the Secretary of Agriculture. The Rose Bengal plate test (RBPT) was used for screening for antibodies against smooth Brucella sp. Positive results were confirmed by the slow agglutination test (SAT) and 2-mercaptoethanol test (2-ME). Among the 1793 samples screened with RBPT, 125 were positive for antibodies against smooth Brucella sp.; 46 (32%) of these samples showed agglutination in SAT, but only one (0.8%) sample was considered positive by 2-ME. The animal with the positive blood serum was traced back in a household farm whose owner had supplemented feeds with cow milk whey. For preventing swine brucellosis, it is necessary to prevent the cross-infection either by the consumption of contaminated cow milk or by direct contact with infected animals. The government policy should enhance the sanitary education for encouraging household farmers to employ prophylactic measures and ensure biosecurity. The present study results indicate that swine brucellosis risk in household farms occurs in a low prevalence rate in pigs from the Federal District of Brazil.

A brucelose, enfermidade causada por 10 espécies de Brucella sp, pode afetar várias espécies de animais. A doença é responsável por perdas econômicas em diversos setores, inclusive na suinocultura. Não existem medidas profiláticas específicas para suínos no Programa Nacional de Controle e Erradicação da Brucelose Animal e Tuberculose-PNCEBT. Foi realizado um estudo transversal durante o período de agosto a outubro em 2011, 2012 e 2014 para o estudo de soroprevalência. Os analistas veterinários da Secretaria de Agricultura coletaram sangue de 1793 suínos de 823 criatórios no Distrito Federal. O teste Rosa de Bengala (RBPT) foi utilizado como triagem para a pesquisa de anticorpos contra Brucella sp. Os resultados positivos foram confirmados pelo teste de aglutinação lenta (SAT) e teste de 2-mercaptoetanol (2-ME) em série. Das 1793 amostras testadas pelo RBPT, 125 foram reagentes; sendo que 32% (46) destas amostras apresentaram aglutinação no SAT, mas apenas uma (0,8%) amostra foi confirmada positiva pelo teste 2-ME. O animal positivo foi rastreado em uma chácara de subsistência cujo dono tinha hábito de fornecer soro de leite de vaca aos suínos. Para prevenira brucelose suína, é necessário evitar a infecção cruzada pelo consumo de leite de vaca contaminado ou pelo contato direto com animais infectados. A política do governo deve melhorar a educação sanitária para incentivar a agricultura familiar a empregar medidas profiláticas e garantir a biossegurança. Os resultados do presente estudo indicam que o risco de brucelosesuína é baixo entre os criatórios de suínos do Distrito Federal.

Epidemiological study of swine brucellosis in household farms in Federal District of Brazil / Estudo epidemiológico de brucelose em suínos em criatórios de subsistência do Distrito Federal, Brasil

Brucellosis is caused by 10 species of Brucella sp. and is responsible for huge economic losses. There are no specific prophylactic measures present for household pigs, which can be also reservoirs, in the brazilian National Program for the Control and Eradication of Animal Brucellosis and Tuberculosis. Therefore, we conducted a cross-sectional study of blood serum samples from 1793 household pigs from 823 farms in Federal District of Brazil. Serum samples were collected between August and October in 2011, 2012, and 2014 by the veterinarians under the Secretary of Agriculture. The Rose Bengal plate test (RBPT) was used for screening for antibodies against smooth Brucella sp. Positive results were confirmed by the slow agglutination test (SAT) and 2-mercaptoethanol test (2-ME). Among the 1793 samples screened with RBPT, 125 were positive for antibodies against smooth Brucella sp.; 46 (32%) of these samples showed agglutination in SAT, but only one (0.8%) sample was considered positive by 2-ME. The animal with the positive blood serum was traced back in a household farm whose owner had supplemented feeds with cow milk whey. For preventing swine brucellosis, it is necessary to prevent the cross-infection either by the consumption of contaminated cow milk or by direct contact with infected animals. The government policy should enhance the sanitary education for encouraging household farmers to employ prophylactic measures and ensure biosecurity. The present study results indicate that swine brucellosis risk in household farms occurs in a low prevalence rate in pigs from the Federal District of Brazil.(AU)

A brucelose, enfermidade causada por 10 espécies de Brucella sp, pode afetar várias espécies de animais. A doença é responsável por perdas econômicas em diversos setores, inclusive na suinocultura. Não existem medidas profiláticas específicas para suínos no Programa Nacional de Controle e Erradicação da Brucelose Animal e Tuberculose-PNCEBT. Foi realizado um estudo transversal durante o período de agosto a outubro em 2011, 2012 e 2014 para o estudo de soroprevalência. Os analistas veterinários da Secretaria de Agricultura coletaram sangue de 1793 suínos de 823 criatórios no Distrito Federal. O teste Rosa de Bengala (RBPT) foi utilizado como triagem para a pesquisa de anticorpos contra Brucella sp. Os resultados positivos foram confirmados pelo teste de aglutinação lenta (SAT) e teste de 2-mercaptoetanol (2-ME) em série. Das 1793 amostras testadas pelo RBPT, 125 foram reagentes; sendo que 32% (46) destas amostras apresentaram aglutinação no SAT, mas apenas uma (0,8%) amostra foi confirmada positiva pelo teste 2-ME. O animal positivo foi rastreado em uma chácara de subsistência cujo dono tinha hábito de fornecer soro de leite de vaca aos suínos. Para prevenira brucelose suína, é necessário evitar a infecção cruzada pelo consumo de leite de vaca contaminado ou pelo contato direto com animais infectados. A política do governo deve melhorar a educação sanitária para incentivar a agricultura familiar a empregar medidas profiláticas e garantir a biossegurança. Os resultados do presente estudo indicam que o risco de brucelosesuína é baixo entre os criatórios de suínos do Distrito Federal.(AU)

Association of an IRF3 putative functional uORF variant with resistance to Brucella infection: A candidate gene based analysis of InDel polymorphisms in goats.

Brucellosis is an important zoonotic disease caused by infection with Brucella spp. It generates major economic losses in livestock production worldwide. Goats are the principal hosts of B. melitensis, the main infection agent of caprine and human brucellosis. The selection of resistance-related genes is considered one of the best long-term means to improve control to bacterial infection in domestic ruminants. We performed a candidate gene association study to test if six short insertion/deletion polymorphisms (InDels) at bacterial-infection related genes influence the resistance to Brucella infection in female creole goats. InDels (IRF3-540: rs660531540, FKBP5-294: rs448529294, TIRAP-561: rs657494561, PTPRT-588: rs667380588, KALRN-989: rs667660989 and RAB5a-016: rs661537016) were resolved by PCR-capillary electrophoresis in samples from 64 cases and 64 controls for brucellosis. Allelic frequencies were significantly different between cases and controls at IRF3-540 and KALRN-989 (p = 0.001 and 0.005). Indeed, the minor alleles (a and k) at InDels IRF3-540 and KALRN-989 were more frequent among controls than cases, providing evidence that these alleles confer protection against Brucella infection. Moreover, IRF3-540 a-containing genotypes (Aa and aa) were associated with absence of Brucella-specific antibodies in goats (p = 0.003; OR = 3.52; 95% CI = 1.55-7.96), and more specifically, a-allele was associated with resistance to Brucella infection in a dose-dependent manner. Also, we observed that the IRF3-540 deletion (a-allele) extends a conserved upstream ORF by 75 nucleotides to the main ORF, and thus it may decrease gene expression by reducing translation efficiency from the main ORF. These results suggest a potential functional role of IRF3-540 deletion in genetic resistance to Brucella infection in goats.

A Closed-tube Loop-Mediated Isothermal Amplification Assay for the Visual Endpoint Detection of Brucella spp. and Mycobacterium avium subsp. paratuberculosis.

LAMP (loop-mediated isothermal amplification) is an isothermal nucleic acid amplification technique that is characterized by its efficiency, rapidity, high yield of final product, robustness, sensitivity, and specificity, with the blueprint that it can be implemented in laboratories of low technological complexity. Despite the conceptual complexity underlying the mechanistic basis for the nucleic acid amplification, the technique is simple to use and the amplification and detection can be carried out in just one step. In this chapter, we present a protocol based on LAMP for the rapid identification of isolates of Brucella spp. and Mycobacterium avium subsp. paratuberculosis, two major bacterial pathogens in veterinary medicine.

Validation of the multiplex PCR for identification of Brucella spp / Validação da técnica de PCR multiplex para identificação de Brucella spp

A multiplex PCR technique for detection of Brucella spp. in samples of bacterial suspension was validated as a complementary tool in the diagnosis of the disease. This technique allows the characterization of the agent without performing biochemical tests, which greatly reduces the time for a final diagnosis, and provides more security for the analyst by reducing the time of exposure to microorganisms. The validation was performed in accordance with the Manual of Diagnostic Tests from OIE (2008) and following the requirements present in the ABNT NBR ISO/IEC 17025:2005. The mPCR validated in this study identified the different species of Brucella ( Brucella abortus , B. suis , B. ovis e B. melitensis ) of bacterial suspension obtained from the slaughterhouse samples, as well as distinguished the biovars (1, 2 e 4; 3b, 5, 6 e 9) of B. abortus in grouped form and differentiated the field strains from vaccine strains, as a quick, useful and less expensive technique in diagnosis of brucellosis in Brazil.(AU)

Validou-se neste trabalho uma técnica de PCR Multiplex (mPCR) para detecção de Brucella spp. em amostras de suspensão bacteriana, como ferramenta complementar no diagnóstico da doença. Esta técnica possibilita a caracterização do agente sem que seja necessária a realização de testes bioquímicos, o que diminui consideravelmente o tempo para o diagnóstico final, além de oferecer mais segurança ao analista ao diminuir o tempo de exposição ao agente infecioso. A validação foi realizada de acordo com o Manual de Testes de Diagnósticos da OIE (2008), seguindo as exigências presentes na norma de qualidade da ABNT NBR ISO/IEC 17025:2005. A mPCR validada neste trabalho identificou as diferentes espécies de Brucella ( Brucella abortus , B. suis , B. ovis e B. melitensis ) em suspensão bacteriana, obtidas a partir de amostras de frigorífico. Além disso, discriminou os biovares (1, 2 e 4; 3b, 5, 6 e 9) de B. abortus , de forma agrupada, e diferenciou cepa vacinal de cepa de campo, sendo esta uma técnica rápida, útil e de menor custo para o auxílio no diagnóstico de brucelose no Brasil.(AU)

Immunization with Brucella VirB proteins reduces organ colonization in mice through a Th1-type immune response and elicits a similar immune response in dogs.

VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs.

Smooth to Rough Dissociation in Brucella: The Missing Link to Virulence.

Dissociation encompasses changes in a series of phenotypes: colony and cell morphology, inmunological and biochemical reactions and virulence. The concept is generally associated to the in vitro transition between smooth (S) and rough (R) colonies, a phenotypic observation in Gram-negative bacteria commonly made since the beginning of microbiology as a science. It is also well known that the loss of the O-polysaccharide, the most external lipopolysaccharide (LPS) moiety, triggers the change in the colony phenotype. Although dissociation is related to one of the most basic features used to distinguish between species, i.e., colony morphology, and, in the case of pathogens, predict their virulence behavior, it has been considered a laboratory artifact and thus did not gain further attention. However, recent insights into genetics and pathogenesis of members of Brucella, causative agents of brucellosis, have brought a new outlook on this experimental fact, suggesting that it plays a role beyond the laboratory observations. In this perspective article, the current knowledge on Brucella LPS genetics and its connection with dissociation in the frame of evolution is discussed. Latest reports support the notion that, by means of a better understanding of genetic pathways linked to R phenotype and the biological impact of this intriguing "old" phenomenon, unexpected applications can be achieved.

Regulation of virulence in Brucella: an eclectic repertoire of transcription factors defines the complex architecture of the virB promoter.

Many intracellular bacterial pathogens use type IV secretion systems to deliver effector molecules and subvert the eukaryotic host cell defenses. The genus Brucella comprises facultative intracellular bacteria that cause brucellosis, a disease affecting a wide range of mammals including humans. The virB operon codes for a type IV secretion system that plays a central role in intracellular survival and replication of Brucella within the host. Expression of the virB genes is under the control of various transcription factors that allow this system to respond to different types of environmental signals, and display binding site structures and arrangements that define the intrinsic complexity of the virB promoter. This review focuses on summarizing the current state of research concerning regulation of the Brucella virB operon, with special emphasis on describing the nature and function of the implicated regulatory elements and examining the involved protein-DNA interactions.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no sêmen / Fluorescent PCR associated with capillary electrophoresis as a diagnostic tool of bacteria in semen

Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10(3) bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial.(AU)

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10(3) bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.(AU)