HHV-6B- and HHV-7-associated choroiditis secondary to acute myelogenous leukemia: a case report.

We report a case of human herpes virus 6 (HHV-6)- and human herpes virus 7 (HHV-7)-associated choroiditis in an immunocompromised woman. A 42-year-old Chinese woman with a history of acute myelogenous leukemia presented with blurred vision and black floaters in her right eye. Anterior segment examination findings were normal. Ophthalmoscopic examination revealed a subretinal lesion in the superonasal peripapillary region with several punctate hemorrhages. Optical coherence tomography showed a crater-like choroidal protuberance, associated with retinal pigment epithelium rupture and full-thickness retinal edema in the involved area. Indocyanine green angiography demonstrated a broad hypofluorescent lesion in the choroid. The patient was diagnosed with choroiditis. Subsequently, metagenomic next-generation sequencing revealed HHV-6B and HHV-7 DNA in the aqueous humor. Therefore, antiviral therapy was initiated. The patient experienced resolution of all symptoms and signs after treatment with intravenous foscarnet and oral acyclovir. The findings in this case indicate that HHV-6 and HHV-7 can cause ocular infection, particularly in immunocompromised patients.

Meningitis associated with HHV-7 in an Iranian immunocompetent adolescent girl.

There is limited literature regarding meningitis associated with HHV-7. This article reports an immunocompetent adolescent girl who developed fever, headache, and meningism which CSF molecular analysis with PCR was positive only for HHV-7. Interestingly, persistent cavum septum pellucidum and cavum vergae were observed on brain magnetic resonance imaging. The patient received antibiotics, dexamethasone, and acyclovir and then she gained full recovery. HHV-7 is a rare and yet possible pathogen in patients with meningitis, and this is the first described case report from Iran.

Frequency evaluation and molecular characterization of HHV-6 and HHV-7 among children under 5 years with fever and skin rash.

Skin rash is one of the most common complications during childhood. Viral agents play an essential role in the development of such symptoms. Present study aims to determine the prevalence and genetic variability of Human Herpesvirus 6 and 7 (HHV-6 and HHV-7) infections and their subtypes in children under 5 years of age with skin rash and negative for rubella and measles. We used serum and throat swap samples from 196 children with skin rash and fever. ELISA and IFA tests were performed to detect antibodies against HHV6/7. Sequencing was performed using Sanger sequencing, and BioEdit and MEGA10 software were used for sequence analysis. According to the results, 66% and 40% of cases were positive for HHV-6 IgM and HHV-7 IgM, respectively. According to the molecular analysis, HHV-6 Nested-PCR was positive in 18% of cases, however, HHV-7 Nested-PCR was positive in 7.7% of cases. On the other hand, HHV-6 IgG and HHV-7 IgG were positive in 91% and 55% of study cases, respectively. For HHV-6, we found some genetic variabilities resulting in antigenic changes compared to reference strains. HHV-7 isolates showed no genetic differentiation and had a stable gene sequence. Based on the results, the detection of some cases of HHV6/7 primary infection and the presence of specific symptoms of roseola in the study population needs continuous evaluation of HHV6/7 frequency and distribution, also genetic variabilities of HHV6. This can pave the way for investigating HHV6 immune evasion and vaccine research and studying the relationship between viral genetic variations and other factors like disease severity. Furthermore, it is necessary to determine the relation between HHV6 genetic changes and latent infection to be considered in possible future vaccines and antiviral drug development.

Anterior Uveitis Associated with Human Herpesvirus 7 Infection Diagnosed by Multiplex Polymerase Chain Reaction Assay: A Case Report.

BACKGROUND: Herpetic anterior uveitis (AU) is usually caused by the herpes simplex virus, varicella-zoster virus, and cytomegalovirus. Herein, we report a case of herpetic AU associated with human herpesvirus 7 (HHV-7) infection. STUDY DESIGN: A case report. CASE PRESENTATION: A 49-year-old female patient presented with complaints of blurred vision and hyperemia in the right eye. Slit-lamp examination revealed bilateral fine and a few small white keratic precipitates (KPs), Descemet membrane folds in the right eye, and severe and mild cellular infiltration in the anterior chamber of the right and left eye, respectively. HHV-7 viral DNA was detected by a polymerase chain reaction assay of an aqueous humor sample. The AU improved significantly with topical steroids. CONCLUSION: We report a rare case of herpetic AU characterized by fine and small white KPs in which only HHV-7 DNA was detected in the aqueous humor.

Human herpesvirus 7 encephalitis in an immunocompetent adult and a literature review.

BACKGROUND: Human herpesvirus 7 (HHV-7) is a common virus that infects children early and is accompanied by lifelong latency in cells, which is easy to reactivate in immunodeficient adults, but the underlying pathological mechanism is uncertain in immunocompetent adults without peculiar past medical history. Even though the clinical manifestation of the encephalitis caused by HHV-7 is uncommon in immunocompetent adults, the HHV-7 infection should not be neglected for encephalitis for unknown reasons. CASE PRESENTATION: We reported here a case of HHV-7 encephalitis with epileptic seizures. While the brain computer tomography was standard, electroencephalography displayed slow waves in the temporal and bilateral frontal areas, then HHV-7 DNA was detected in the metagenomic next-generation sequencing of cerebrospinal fluid. Fortunately, the patient recovered after treatment and was discharged 2 months later. We also collected the related cases and explored a better way to illuminate the underlying mechanism. CONCLUSION: The case indicates clinicians should memorize HHV-7 as an unusual etiology of encephalitis to make an early diagnosis and therapy.

Development of a PCR assay for the detection of human herpes virus type 7.

A PCR assay has been developed to identify the DNA of the human herpes virus type 7. The search and selection of conserved regions was carried out by comparing the whole genome nucleotide sequences of HHV-7. A fragment duplicated in the HHV-7 genomes was chosen as a target for amplification. The performance of the assay was tested on a synthetic matrix and clinical samples. The developed assay has high sensitivity and specificity and showed good efficiency in detecting HHV-7 DNA in clinical samples.

Human Herpes Virus 7-related encephalopathy in children.

BACKGROUND: Primary HHV7 infection is almost ubiquitous, and it can present as exanthema subitem. Little is known on the clinical relevance of HHV7 neuroinvasion in immunocompetent children. METHODS: We describe 12 patients (median age 9.45 years, 50% males) with acute encephalopathy and active HHV7 infection. In all patients, HHV7-DNA was detected on cerebrospinal fluid (CSF) by RT-PCR. RESULTS: 7/12 patients had meningoencephalitis (two with ADEM and one with MOG antibody-associated CIS); 5/12 showed acute neuropsychiatric symptoms. EEG showed anomalies exclusively in patients with meningoencephalitis. Six patients had RMN anomalies. CSF HHV7 copies ranged between 20 and 3,500 copies/mL (median 66 copies/mL) and mean HHV7 CSF/blood ratio was 0.75. Outcome was favorable in all children, although 3/12 had minor neurobehavioral sequelae. Mean follow-up period of 5.2 months. CONCLUSIONS: HHV7 can determine neuroinvasion in immunocompetent children, leading to acute encephalopathy. Blood-brain barrier damage and high CSF/blood viral copies ratio correlated with a more severe presentation. We speculate on the importance of immune-mediated mechanisms in provoking clinical features.

Dynamics of salivary human herpesvirus-6 and -7 shedding in pregnant women.

Reactivation of Betaherpesvirinae (Human herpesvirus 6A: HHV-6A, -6B, HHV-7) may be associated with mental illness and host fatigue. This study aimed to determine whether viral reactivation, measured by monitoring salivary viral DNA load, can be used to monitor depression in pregnant and postpartum women. Saliva samples were collected from 64 pregnant women at five points of observation periods. The HHV-6- and HHV-7-specific qPCRs were carried out to measure viral DNA load. When HHV-6 DNA was detected in saliva, nested PCR was used to discriminate between HHV-6A and -6B. In both viruses, a significant correlation was observed between detection frequency and viral DNA load in saliva. In the low-shedding group, HHV-6 DNA was significantly higher in the third trimester (p < 0.0001), the time of delivery (p = 0.0003), 1 month after birth (p = 0.0023) compared with the first trimester, and HHV-7 was at the time of delivery (p = 0.0277) and 1 month after birth (p = 0.0235). Most of the detected HHV-6 DNAs in saliva were HHV-6B. Both viral DNA loads were significantly lower (HHV-6: p = 0.0101, HHV-7: p = 0.0044) in the subjects with abnormal Edinburgh Postnatal Depression Scale (EPDS) scores. The detection rate and viral DNA load of both viruses in saliva increased after the third trimester. Salivary virus DNA shedding was significantly lower in subjects with an abnormal EPDS score.

The Roseoloviruses Downregulate the Protein Tyrosine Phosphatase PTPRC (CD45).

Like all herpesviruses, the roseoloviruses (HHV6A, -6B, and -7) establish lifelong infection within their host, requiring these viruses to evade host antiviral responses. One common host-evasion strategy is the downregulation of host-encoded, surface-expressed glycoproteins. Roseoloviruses have been shown to evade the host immune response by downregulating NK-activating ligands, class I MHC, and the TCR/CD3 complex. To more globally identify glycoproteins that are differentially expressed on the surface of HHV6A-infected cells, we performed cell surface capture of N-linked glycoproteins present on the surface of T cells infected with HHV6A, and compared these to proteins present on the surface of uninfected T cells. We found that the protein tyrosine phosphatase CD45 is downregulated in T cells infected with HHV6A. We also demonstrated that CD45 is similarly downregulated in cells infected with HHV7. CD45 is essential for signaling through the T cell receptor and, as such, is necessary for developing a fully functional immune response. Interestingly, the closely related betaherpesviruses human cytomegalovirus (HCMV) and murine cytomegalovirus (MCMV) have also separately evolved unique mechanisms to target CD45. While HCMV and MCMV target CD45 signaling and trafficking, HHV6A acts to downregulate CD45 transcripts. IMPORTANCE Human herpesviruses-6 and -7 infect essentially 100% of the world's population before the age of 5 and then remain latent or persistent in their host throughout life. As such, these viruses are among the most pervasive and stealthy of all viruses. Host immune cells rely on the presence of surface-expressed proteins to identify and target virus-infected cells. Here, we investigated the changes that occur to proteins expressed on the cell surface of T cells after infection with human herpesvirus-6A. We discovered that HHV-6A infection results in a reduction of CD45 on the surface of infected T cells and impaired activation in response to T cell receptor stimulation.

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

Metagenomic next-generation sequencing of viruses, bacteria, and fungi in the epineurium of the facial nerve with Bell's palsy patients.

Bell's palsy (BP) represents a major cause leading to facial paralysis in the world. The etiology of BP is still unknown, and virology is the prevailing theory. The purpose of this study is to explore the pathogenic microorganisms that may be related to BP, and it is of great significance to study the pathogenesis and treatment of BP. Metagenomic next-generation sequencing (mNGS) detection was performed in the epineurium of the facial nerve of 30 BP patients who underwent facial nerve epineurium decompression. A total of 84 pathogenic microorganisms were detected in 30 clinical samples, including 4 viruses, 10 fungi, and 70 bacteria. The species with the highest detection frequency in virus was human betaherpesvirus 7 (HHV-7). The species with the highest detection frequency in Fungi was Malassezia restricta. The species with the highest detection frequency in Bacteria was Pseudomonas aeruginosa. In this study, mNGS method was firstly used to detect the pathogenic microorganisms in the epineurium of the facial nerve with BP patients. We have for the first time identified HHV-7 and aspergillus in the epineurium of the facial nerve of BP patients. These results suggest that these two pathogenic microorganisms should be considered in the pathogenesis of BP.

Inflammatory Cytokine-Producing Cells and Inflammation Markers in the Synovium of Osteoarthritis Patients Evidenced in Human Herpesvirus 7 Infection.

A direct association between joint inflammation and the progression of osteoarthritis (OA) has been proposed, and synovitis is considered a powerful driver of the disease. Among infections implicated in the development of joint disease, human herpesvirus 7 (HHV-7) infection remains poorly characterized. Therefore, we assessed synovitis in OA patients; determined the occurrence and distribution of the HHV-7 antigen within the synovial membrane of OA-affected subjects; and correlated plasma levels of the pro-inflammatory cytokines tumor necrosis factor (TNF), interleukin-6 (IL-6), and TNF expressed locally within lesioned synovial tissues with HHV-7 observations, suggesting differences in persistent latent and active infection. Synovial HHV-7, CD4, CD68, and TNF antigens were detected immunohistochemically. The plasma levels of TNF and IL-6 were measured by an enzyme-linked immunosorbent assay. Our findings confirm the presence of persistent HHV-7 infection in 81.5% and reactivation in 20.5% of patients. In 35.2% of patients, virus-specific DNA was extracted from synovial membrane tissue samples. We evidenced the absence of histopathologically detectable synovitis and low-grade changes in the majority of OA patients enrolled in the study, in both HHV-7 PCR+ and HHV-7 PCR‒ groups. The number of synovial CD4-positive cells in the HHV-7 polymerase chain reaction (PCR)+ group was significantly higher than that in the HHV-7 PCR‒ group. CD4- and CD68-positive cells were differently distributed in both HHV-7 PCR+ and HHV-7 PCR‒ groups, as well as in latent and active HHV-7 infection. The number of TNF+ and HHV-7+ lymphocytes, as well as HHV-7+ vascular endothelial cells, was strongly correlated. Vascular endothelial cells, especially in the case of infection reactivation, appeared vulnerable. The balance between virus latency and reactivation is a long-term relationship between the host and infectious agent, and the immune system appears to be involved in displaying overreaction when a shift in the established equilibrium develops.

Human Herpesvirus-6 Reactivation, Mitochondrial Fragmentation, and the Coordination of Antiviral and Metabolic Phenotypes in Myalgic Encephalomyelitis/Chronic Fatigue Syndrome.

Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) is a multifactorial disorder with many possible triggers. Human herpesvirus (HHV)-6 and HHV-7 are two infectious triggers for which evidence has been growing. To understand possible causative role of HHV-6 in ME/CFS, metabolic and antiviral phenotypes of U2-OS cells were studied with and without chromosomally integrated HHV-6 and with or without virus reactivation using the histone deacetylase inhibitor trichostatin-A. Proteomic analysis was conducted by pulsed stable isotope labeling by amino acids in cell culture analysis. Antiviral properties that were induced by HHV-6 transactivation were studied in virus-naive A549 cells challenged by infection with influenza-A (H1N1) or HSV-1. Mitochondria were fragmented and 1-carbon metabolism, dUTPase, and thymidylate synthase were strongly induced by HHV-6 reactivation, whereas superoxide dismutase 2 and proteins required for mitochondrial oxidation of fatty acid, amino acid, and glucose metabolism, including pyruvate dehydrogenase, were strongly inhibited. Adoptive transfer of U2-OS cell supernatants after reactivation of HHV-6A led to an antiviral state in A549 cells that prevented superinfection with influenza-A and HSV-1. Adoptive transfer of serum from 10 patients with ME/CFS produced a similar fragmentation of mitochondria and the associated antiviral state in the A549 cell assay. In conclusion, HHV-6 reactivation in ME/CFS patients activates a multisystem, proinflammatory, cell danger response that protects against certain RNA and DNA virus infections but comes at the cost of mitochondrial fragmentation and severely compromised energy metabolism.

Detection of human herpesvirus 6 (HHV-6) and human herpesvirus 7 (HHV-7) DNA in endocervical samples from a positive and negative HPV woman of Córdoba, Argentina.

AIMS: The purpose of the present study was to elucidate the presence of human herpesvirus 6A (HHV-6A), HHV-6B and HHV-7 in samples of the uterine cervix through detection of viral DNA. We analysed normal tissues, samples with low-grade squamous intraepithelial lesions (LSILs) and high-grade squamous intraepithelial lesions (HSILs). We correlated the presence of HHV-6 and HHV-7 with the finding of human papillomavirus (HPV) in mucosal samples. METHODS: Cervical samples were examined and grouped as follows: group 1 (n=29), normal cytology; group 2 (n=61), samples with LSIL; group 3 (n=35), samples with HSIL. Molecular biology examinations were performed in all samples to detect HHV-6, HHV-7 and HPV DNA and to typify HHV-6 species. RESULTS: Group 1: normal cytology and HPV (-): HHV-6: 6.8% (2/29), HHV-7: 79.3% (23/29); group 2: LSIL and HPV (-): HHV-6: 93.1% (27/29), HHV-7: 96.5% (28/29); LSIL and HPV (+): HHV-6: 0% (0/32), HHV-7: 90.6% (29/32); group 3: HSIL and HPV (-): HHV-6: 20% (2/10), HHV-7: 70% (7/10); HSIL HPV (+): HHV-6: 12% (3/25), HHV-7: 68% (17/25). HHV-6A DNA was not detected in any samples. CONCLUSIONS: (1) Both HHV-6 and HHV-7 infect the mucosal cells of the cervix with higher prevalence of HHV-7. (2) The higher prevalence of HHV-6 in LSIL HPV (-) samples compared with those with normal cytology indicates that it constitutes a possible risk factor for atypia production. (3) The presence of HHV-7 in all samples questions its role in the production of atypia. (4) The finding of HHV-6 and HHV-7 suggests that the cervical mucosa is a possible transmission pathway for these viruses.

Age-Related Patterns of DNA Detection and Specific IgG Subclasses in Healthy HHV-6- and HHV-7-Infected Individuals.

Human herpesvirus 6A (HHV-6A), Human herpesvirus 6B (HHV-6B), and Human herpesvirus 7 (HHV-7) can persist by establishing a lifelong infection which could have implications on the immunocompetent host. The aim of this work is to contribute with some knowledge about the HHV-6 A/B and HHV-7 infection in healthy individuals. We have carried out a longitudinal study in seropositive healthy individuals for the detection of viral DNA in saliva and plasma samples, and for determining a specific IgG isotype immune response, which enabled the performance of these viruses to be observed over time. Furthermore, an elderly population was transversely studied to provide data of the activity of these viruses in the older population. In the longitudinal study, HHV-6 DNA was occasionally detected and an isotype immune response with a specific IgG1 profile, while in the older group HHV-6 DNA was frequently detected and an isotype immune response with specific IgG1, IgG3, and IgG4. HHV-7 DNA was frequently detected in both groups and isotype patterns of specific IgG1, IgG3, and IgG4. The results of this study highlight that the long-lasting relationship in healthy HHV-6 A/B-infected individuals have the imprint of age groups.

The role of HHV-6 and HHV-7 infections in the development of fibromyalgia.

Human herpes virus-6 (HHV-6) and human herpes virus-7 (HHV-7) are immunomodulating viruses potentially affecting the nervous system. We evaluated the influence of HHV-6 and HHV-7 infections on fibromyalgia (FM) clinical course. Forty-three FM patients and 50 control group participants were enrolled. 39.50% (n = 17) FM patients had light A delta and C nerve fiber damage, 27.91% (n = 12) had severe A delta and C nerve fiber damage. 67.44% (n = 29) FM patients had loss of warm sensation in feet, loss of heat pain sensation, and increased cold pain sensation (34.90%, n = 15 in both findings). HHV-6 and HHV-7 genomic sequences in peripheral blood DNA in 23/43 (51.00%) and 34/43 (75.50%) of samples from FM patients and in 3/50 (6.00%) and 26/50 (52.00%) of samples from the control group individuals were detected. Active HHV-6 (plasma viremia) or HHV-7 infection was revealed only in FM patients (4/23, 17.40% and 4/34, 11.80%, respectively). A statistically significant moderate positive correlation was found between A delta and C nerve fiber damage severity and HHV-6 infection (p < 0.01, r = 0.410). 23/43 patients from the FM group and control group participants HHV-6 and 34/45 HHV-7 did have infection markers. A statistically significant moderate positive correlation was found between A delta and C nerve fiber damage severity and HHV-6 infection (p < 0.01, r = 0.410). No difference was found between detection frequency of persistent HHV-6 and HHV-7 infection between FM patients and the control group. Statistically significant correlation was observed between quantitation of changes in QST thermal modalities and HHV-6 infection. There was no correlation between A delta and C nerve fiber damage and HHV-7 infection.

Reactivation of human herpesviruses 6 and 7 in Kawasaki disease.

Objectives: Kawasaki disease (KD) is one of the most common childhood vasculitides. Some serological studies have suggested an etiological relationship between KD and human herpesvirus (HHV)-6 or HHV-7. However, primary or reactivated HHV-6 and -7 has not been fully investigated in patients with KD. Methods: Twenty-three patients with KD were prospectively enrolled in this study. Peripheral blood was collected in the acute and convalescence phases, and HHV-6 and -7 viral loads were measured by real-time PCR. Results: In the acute phase, HHV-6 and -7 DNA was detected in 7 (30%) patients each, compared to 13 (57%) and 9 (39%) patients in the convalescence phase, respectively. HHV-6 and -7 DNA loads were significantly higher in the convalescence phase than in the acute phase. Significant increases in HHV-6 and -7 DNA loads were not observed in disease control patients. Taking into account HHV-6 and -7 serostatus, reactivation of HHV-6 and -7 was observed in 7 and 9 patients, respectively. KD patients with HHV-6 reactivation showed higher C-reactive protein levels and more frequently required steroid therapies than patients without reactivation. Conclusion: HHV-6 and -7 reactivation is frequent in KD patients. HHV-6 reactivation might exacerbate the severity of KD.

Simultaneous Detection of Beta and Gamma Human Herpesviruses by Multiplex qPCR Reveals Simple Infection and Coinfection Episodes Increasing Risk for Graft Rejection in Solid Organ Transplantation.

Herpesviruses are common components of the human microbiome that become clinically relevant when a competent immunosurveillance is compromised, such as in transplantation. Members of the beta and gamma subfamilies are associated with a wide diversity of pathologies, including end-organ disease and cancer. In this study, we developed a multiplex qPCR technique with high specificity, sensitivity, efficiency and predictability that allowed the simultaneous detection and quantification of beta and gamma human herpesviruses. The technique was tested in a cohort of 34 kidney- or liver-transplanted pediatric patients followed up for up to 12 months post-transplant. Viral load was determined in 495 leukocyte-plasma paired samples collected bi-weekly or monthly. Human herpesvirus (HHV) 7 was the herpesvirus most frequently found in positive samples (39%), followed by Epstein-Barr virus (EBV) (20%). Also, EBV and HHV7 were present in the majority of coinfection episodes (62%). The share of positive samples exclusively detected either in leukocytes or plasma was 85%, suggesting that these herpesviruses tended to take a latent or lytic path in an exclusive manner. Infection by human cytomegalovirus (HCMV) and HHV6, as well as coinfection by EBV/HHV7 and EBV/HHV6/HHV7, were associated with graft rejection (RR = 40.33 (p = 0.0013), 5.60 (p = 0.03), 5.60 (p = 0.03) and 17.64 (p = 0.0003), respectively). The routine monitoring of beta and gamma herpesviruses should be mandatory in transplant centers to implement preventive strategies.