Seroprevalences of Toxoplasma gondii and Neospora caninum infections in Jordanian women who had a recent spontaneous abortion.

This cross-sectional study investigates Toxoplasma gondii and Neospora caninum among 445 recently spontaneously aborted (RSA) Jordanian women using ELISA and indirect fluorescent antibody (at a cut-off value of 1/200) tests, respectively. The type of hospital, age, cat and dog contacts, raw and barbecued meat and wild plant consumption, number of abortions, and stillbirths were tested as independent variables using univariate and multivariate logistic regression analyses. The true seroprevalences were 22.1% for T. gondii-IgG, 22.7% for N. caninum-IgG, 2.6% for T. gondii-IgM, 10.6% for N. caninum-IgM, 0% for T. gondii-IgG and IgM, 6.7% for N. caninum-IgG and IgM, and 4.6% and 0% for both parasite IgG and IgM, respectively. T. gondii-IgM-seropositivity was associated with the number of abortions with odds ratios (OR) of 2.4 and eating barbecued meat (OR = 0.12). N. caninum-IgG-seropositivity was associated with having a dog in the house (OR = 2.6), and with stillbirth (OR = 0.1). N. caninum-IgM was associated with visiting a private-hospital (OR = 2.7). RSA Jordanian women are equally exposed to both parasites with significantly (p < 0.05) higher seroprevalence of N. caninum-IgM compared to T. gondii-IgM suggestive of active infections among RSA women in Jordan.

Seroprevalences of Toxoplasma gondii and Neospora caninum infections in Jordanian women who had a recent spontaneous abortion / Soroprevalências de infecções por Toxoplasma gondii e Neospora caninum em mulheres jordanianas que tiveram um aborto espontâneo recente

Abstract This cross-sectional study investigates Toxoplasma gondii and Neospora caninum among 445 recently spontaneously aborted (RSA) Jordanian women using ELISA and indirect fluorescent antibody (at a cut-off value of 1/200) tests, respectively. The type of hospital, age, cat and dog contacts, raw and barbecued meat and wild plant consumption, number of abortions, and stillbirths were tested as independent variables using univariate and multivariate logistic regression analyses. The true seroprevalences were 22.1% for T. gondii-IgG, 22.7% for N. caninum-IgG, 2.6% for T. gondii-IgM, 10.6% for N. caninum-IgM, 0% for T. gondii-IgG and IgM, 6.7% for N. caninum-IgG and IgM, and 4.6% and 0% for both parasite IgG and IgM, respectively. T. gondii-IgM-seropositivity was associated with the number of abortions with odds ratios (OR) of 2.4 and eating barbecued meat (OR = 0.12). N. caninum-IgG-seropositivity was associated with having a dog in the house (OR = 2.6), and with stillbirth (OR = 0.1). N. caninum-IgM was associated with visiting a private-hospital (OR = 2.7). RSA Jordanian women are equally exposed to both parasites with significantly (p < 0.05) higher seroprevalence of N. caninum-IgM compared to T. gondii-IgM suggestive of active infections among RSA women in Jordan.

Resumo Este é um estudo transversal, investigando Toxoplasma gondii e Neospora caninum entre 445 mulheres jordanianas recentemente abortadas espontaneamente (RSA), usando-se ELISA e testes de anticorpos fluorescentes indiretos (com valor de corte de 1/200), respectivamente. Tipo de hospital, idade, contato com o cão, consumo de carne, número de abortos foram testados como variáveis independentes, usando-se análises de regressão logística univariada e multivariada. As verdadeiras seroprevalências foram 22,1% para T. gondii-IgG; 22,7% para N. caninum-IgG; 2,6% para T. gondii-IgM; 10,6% para N. caninum-IgM, 0% para T. gondii-IgG e IgM, 6,7% para N. caninum-IgG e IgM, e 4,6% e 0% para ambos os parasitas IgG e IgM, respectivamente. A soropositividade para T. gondii-IgM foi associada ao número de abortos com "odds ratio" (OR) de 2,4 e ingestão de carne grelhada (OR = 0,12). A soropositividade para N. caninum-IgG foi associada à presença de cachorro em casa (OR = 2,6) e natimorto (OR = 0,1). N. caninum-IgM foi associada à visita a um hospital privado (OR = 2,7). Mulheres jordanianas com RSA estão igualmente expostas a ambos os parasitas com soroprevalência significativamente (p <0,05) maior de N. caninum-IgM, em comparação com T. gondii-IgM, sugestivo de infecções ativas entre mulheres com RSA na Jordânia.

Age, gender and climate associations with the seroprevalence of Neospora species infection in horses in Jordan.

A cross-sectional study was carried out on a sample of 379 horses to determine the seroprevalence of Neospora spp. in Jordan using the indirect fluorescent antibody test. Five variables, namely locality (n=10), climatic zone (n=4), age group (n=3), gender, and breed were tested as risk factors for Neospora-immunoglobulin (Ig)G seropositivity at four cutoff titers (1:50, 1:200, 1:400, and 1:800) using univariate and multivariate logistic regression analyses. A total of 122 (32%; 95% CI: 28, 37) sera samples had anti-Neospora-IgG at a cutoff titer of 1:50. Increased Neospora-IgG seropositivity was found in horses in three localities (Madaba, Zarka, and Petra) and was associated with the following variables: cool temperate climate; age >14 years; and female gender. Seropositivity was found among horses from Madaba at all cutoff titers, Zarka at titers >1:200, and Petra at titers <1:200. Cool temperate climate was associated with titers <1:400. Horses aged >14 years were found to be associated with seropositivity at titers ≥1:200. Female gender was associated with high seropositivity at >1:800.

Age, gender and climate associations with the seroprevalence of Neospora species infection in horses in Jordan / Idade, sexo e associações climáticas com a soroprevalência da infecção por Neospora em cavalos da Jordânia

Abstract A cross-sectional study was carried out on a sample of 379 horses to determine the seroprevalence of Neospora spp. in Jordan using the indirect fluorescent antibody test. Five variables, namely locality (n=10), climatic zone (n=4), age group (n=3), gender, and breed were tested as risk factors for Neospora-immunoglobulin (Ig)G seropositivity at four cutoff titers (1:50, 1:200, 1:400, and 1:800) using univariate and multivariate logistic regression analyses. A total of 122 (32%; 95% CI: 28, 37) sera samples had anti-Neospora-IgG at a cutoff titer of 1:50. Increased Neospora-IgG seropositivity was found in horses in three localities (Madaba, Zarka, and Petra) and was associated with the following variables: cool temperate climate; age >14 years; and female gender. Seropositivity was found among horses from Madaba at all cutoff titers, Zarka at titers >1:200, and Petra at titers <1:200. Cool temperate climate was associated with titers <1:400. Horses aged >14 years were found to be associated with seropositivity at titers ≥1:200. Female gender was associated with high seropositivity at >1:800.

Resumo Um estudo transversal foi realizado, na Jordânia, em uma amostra de 379 cavalos, para determinar a soroprevalência de Neospora spp., usando-se o teste de anticorpos fluorescentes indiretos. Cinco variáveis: localidade (n=10), zona climática (n=4), grupo etário (n=3), sexo e raça, foram testadas como fatores de risco para soropositividade para Neospora-imunoglobulina (Ig)G, considerando-se quatro pontos de corte (1:50, 1:200, 1:400 e 1:800) por meio de análises de regressão logística univariada e multivariada. Um total de 122 (32%; 95% CI: 28, 37) amostras de soros apresentaram anti-Neospora-IgG, utilizando-se como ponto de corte o título de 1:50. Cavalos de três localidades apresentaram aumento da soropositividade para Neospora-IgG (Madaba, Zarka e Petra) o que foi associado às seguintes variáveis: clima temperado fresco; idade >14 anos; e sexo feminino. Os cavalos de Madaba apresentaram soropositividade em todos os títulos utilizados como ponto de corte; os cavalos de Zarka em títulos >1:200; e os cavalos de Petra em títulos <1:200. O clima temperado fresco foi associado aos títulos <1:400. Cavalos com idade >14 anos estiveram associados à soropositividade nos títulos ≥1:200. O sexo feminino esteve associado à alta soropositividade nos títulos >1:800.

Flock-level seroprevalence of, and risk factors for, Neospora caninum among sheep and goats in northern Jordan.

During the period January 2002 to December 2003, serum samples were collected from 104 small ruminant flocks consisting of 18 sheep flocks, 27 goat flocks and 59 mixed flocks containing both sheep and goats in northern Jordan. Only female animals were sampled. At least 5 females aged over 2 years per flock per species were sampled and examined for anti-Neospora caninum antibodies using ELISA. To increase the chances of detecting positive flocks, sick or older ewes were sampled. Also, N. caninum DNA was investigated in 7 sheep brains using PCR technique and 1 was found positive. The flock-level true seroprevalence in small ruminants was 53% (95% CI: 43,63). The true flock-level seroprevalence was higher in sheep (92%) than goats (12%) (OR=55; 95% CI: 17,197). Similarly, the individual-level seroprevalence in sheep and goat was 63% and 2% respectively (OR=25; 95% CI: 16,39). Out of 32 production and health management variables, the presence of dogs with the flock (OR=3.6, 95% CI: 1.2,10) enhanced seropositivity. Cold temperate climate (OR=0.1, 95% CI: 0.03,0.4), veterinary supervision (OR=0.2, 95% CI: 0.06,0.6) and buying healthy animals to replace those culled (OR=0.3, 95% CI: 0.1,0.97) reduced the risk of seropositivity. Both sheep and goats in Jordan are exposed to N. caninum infection with higher seroprevalence in sheep than goats. The contribution of N. caninum to abortion in small ruminant flock needs to be evaluated. Educating the farmers with regard to the role of dogs in transmitting N. caninum infection is expected to enhance small ruminant health in Jordan.

Rapid detection and differentiation of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR.

A two-tube real-time assay, developed in a LightCycler, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO(4)-3'), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 degrees C was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85+/-0.5 and 56 degrees C determined from temperature-dependent dye-DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli-C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples.