Genetic variability among U.S.-sentinel cotton plot cotton leafroll dwarf virus and globally available reference isolates based on ORF0 diversity.

The aphid-transmitted polerovirus, cotton leafroll dwarf virus (CLRDV), first characterized from symptomatic cotton plants in South America (S.A.), has recently been identified in commercial cotton plantings in the United States (U.S.). Here, the CLRDV intra-specific diversity was investigated by comparative sequence analysis of the most divergent CLRDV coding region, ORF0/P0. Bayesian analysis of ORF0 sequences for U.S. and reference populations resolved three well-supported sister clades comprising one U.S. and two South America lineages. Principal component analysis (PCA) identified seven statistically-supported intra-specific populations. The Bayesian phylogeny- and principal component analysis (PCA) dendrogram-inferred relationships were congruent. Population analysis of ORF0 sequences indicated most lineages have evolved under negative selection, albeit certain sites/isolates evolved under positive selection. Both U.S. and South American isolates exhibited extensive ORF0 diversity. At least two U.S. invasion foci were associated with their founder populations in Alabama-Georgia (AL-GA) and eastern Texas (TX). The AL-GA founder is implicated as the source of recent widespread expansion and establishment of secondary disease foci throughout the southeastern-central U.S. Based on the geographically-restricted distribution, spread of another extant TX population appeared impeded by a population bottleneck. Extant CLRDV isolates represent several putative introductions potentially associated with catastrophic weather events dispersing viruliferous cotton aphids of unknown origin(s).

A Previously Undescribed Polerovirus (Solemoviridae) Infecting Theobroma cacao Germplasm.

Cacao Theobroma cacao L. (Malvaceae) is an economically important crop cultivated in tropical climates for the bean from which chocolate and other products are made (Zarrillo et al., 2018). Virus-like symptoms consisting of discoloration, leaf distortion with downward rolling of leaves, and yellow speckling or mottling (Fig. S1), were observed in imported cacao germplasm at the USDA-ARS-SHRS cacao quarantine facilities in the fall of 2020. Total RNA was isolated from leaves collected from four symptomatic plants using silica RNA extraction method (Rott and Jelkmann, 2001). Ribosomal RNA (rRNA)-depleted RNA samples were used for cDNA library construction, followed by high throughput sequencing on Illumina® NovaSeq 6000 platform (Novogene Corp., Sacramento, CA). Quality-filtered, 150-bp paired-ended reads (2,601,293-3,104,474) were assembled de novo using SPAdes v.3.14.1 (Nurk et al., 2013). The contigs (200,799 to 276,851) were queried against the NCBI virus reference sequence (RefSeq) database using the discontiguous megablast algorithm (https://blast.ncbi.nlm.nih.gov/Blast.cgi?). The resultant contigs (n=1,344) were 150-nt to 1463-nt in length (k-mer coverage from 6.3x to 26,721.7x) and shared their highest nucleotide (nt) identity with potato leafroll virus (PLRV; NC_001747; genus Polerovirus; family Solemoviridae), at 69.1%-72.8%. The contigs pooled from the four samples were assembled into 15 scaffolds. BLASTn analyses of the 15 scaffolds against the RefSeq database indicated the best matches were to thirteen other polerovirus species, with top hits to cereal yellow dwarf virus-RPV (D10206) and pepper vein yellows virus (LC528383), having similarity scores of 66.2% and 100% respectively. The 15 scaffolds matched to the 5' terminal end, ORF1-2, ORF3, ORF4 and ORF3-5 of the different polerovirus genomes. For confirmatory sequencing, total RNA was subjected to reverse transcription using SuperScript IV (Invitrogen, Carlsbad, CA), followed by RT-PCR amplification with general polerovirus primers PoconF/PoconcpR (Xiang et al., 2008) expected to yield an amplicon of ~1,400-bp located at the 3' end of the RNA-dependent, RNA polymerase (RdRp), including the complete coat protein (CP) and movement protein (MP) genes. Amplicons were ligated to pGEM-T Easy vector (Promega, Madison, WI) and sequenced bi-directionally by Sanger sequencing (Eton Bio, Research Triangle Park, NC). BLASTn analysis of the polerovirus-like nt sequences (GenBank accession nos. (ON745771-ON745774) indicated the closest relatives were potato leafroll virus (OK058524) and cucumber aphid-borne yellows virus (FJ460218), at 71% and 73%, respectively. The CP amino acid (aa) sequence shared the greatest similarity to cereal yellow dwarf virus RPV (NP_840023), at 53%, and the MP aa sequence shared the greatest aa similarity to wheat yellow leaf dwarf virus-GPV (YP_003029842), at 38%. These results provide robust support for the association of a previously undescribed polerovirus with symptomatic cacao trees, herein named, cacao leafroll virus (Solemoviridae; Polerovirus). Although Koch's postulates have not been completed to confirm causality, the presence of this virus in cacao germplasm undermine efforts to distribute pathogen-free germplasm and may pose a risk to cacao production in trees established from virus-infected plant material. To our knowledge, this is the first report of a polerovirus infecting cacao trees. All trees of these accessions at the quarantined facility in Miami, FL have been destroyed.

First report of grapevine rupestris vein feathering virus in grapevines from Washington State.

Since the first report of grapevine rupestris vein feathering virus (GRVFV; genus Marafivirus, family Tymoviridae) in a Greek grapevine causing chlorotic discoloration of leaf veins (El Beaino et al., 2001), GRVFV was reported in some European countries, and in Australia, China, Korea, New Zealand, Uruguay, and Canada (Blouin et al., 2017; Cho et al., 2018; Reynard et al., 2017). In the USA, the virus was reported only from California in vines showing Syrah decline symptoms (Al Rwahnih et al., 2009). During virus surveys conducted between 2015 and 2019, 424 samples (petioles from individual or composite of five vines, with 4 petioles/vine) with and without discernible symptoms were collected randomly from 39 Vitis vinifera cultivars in vineyards and nurseries in eastern Washington State. Total RNA was isolated from these samples separately using SpectrumTM Plant Total RNA Kit (Sigma-Aldrich) and subjected individually to Illumina RNAseq (Huntsman Cancer Institute, Salt Lake City, UT). An average of ~28 million 120-base pair (bp) paired-end reads using HiSeq2500 platform and an average of ~18 million 145-bp paired-end reads using Novaseq 6000 platform were obtained per sample. The contigs from de novo assembly of quality-filtered reads from each sample (CLC Genomics workbench 12) were subjected to BLASTn analysis against the virus database from GenBank. In addition to grapevine viruses and viroids previously reported in Washington State, GRVFV-specific sequences were obtained in samples from 11 of the 39 cultivars; namely, Muscat Ottonel, Pinot gris and Sangiovese from vineyards and Aglianico, Bonarda, Cabernet Sauvignon, Chardonnay, Garnacha Tinta, Riesling, Tempranillo and Valdiguie from nurseries. BLASTn analysis of the 73 GRVFV-specific contigs, ranging in size between 500 nt and 6474 nt, showed sequence identity between 79.4% and 95.5% with GRVFV sequences deposited in GenBank. The data also revealed that GRVFV was always present as coinfection with one or more viruses and viroids (grapevine leafroll-associated virus 3, grapevine red blotch virus, grapevine virus A and B, grapevine rupestris stem pitting-associated virus, hop stunt viroid and grapevine yellow speckle viroid 1) making it difficult to correlate presence of the virus with specific symptoms. To confirm the presence of GRVFV, samples from cvs. Sangiovese (n = 45) and Pinot gris (n = 1) were tested by RT-PCR using custom designed primers SaF-215 (5'- TACAAGGTGAATTGCTCCACAC -3') and SaR-1027 (5'-TCATTGGCGATGCGTTCG-3') to amplify the 813 bp sequence covering partial replicase associated polyprotein region of the virus genome. Sanger sfour amplicons (MT782067-MT782070) showed identities from 86% (700 bp out of 813 bp) with an Australian isolate (MT084811.1) to 90.9% (738 bp out of 813 bp) with an isolate from New Zealand (MF000326.1). Additional studies are in progress to examine the etiology, genetic diversity and impact of GRVFV in Washington vineyards.

First Report of grapevine red globe virus in grapevines in Washington State.

Grapevine red globe virus (GRGV; genus Maculavirus, family Tymoviridae) has been reported in grapevines (Vitis spp.) from Italy, Greece, France, China, Spain and Germany and in California, U.S.A. (Sabanadzovic et al. 2000; Cretazzo et al. 2017; Fan et al. 2016; Ruiz-Garcia et al., 2018). During surveys of grapevine nurseries, a total of 241 composite samples, each consisting of four petioles from mature leaves/vine from five asymptomatic grapevines, from 33 grapevine (Vitis vinifera) cultivars were collected. Total RNA isolated from these samples using Spectrum Total RNA isolation kit (Sigma-Aldrich, St. Louis, MO) was subjected to high-throughput sequencing (HTS) on an Illumina HiSeq2500 or Novaseq 6000 platforms in paired-end mode (Genomics Core Facility, Huntsman Cancer Institute, Utah University, Salt Lake City, UT). After trimming raw reads based on quality and ambiguity, the paired-end quality reads of approximately 120 (HiSeq) or 145 (Novaseq) base pair (bp) length were assembled de novo into a pool of contigs (CLC Genomics workbench 12). These contigs were subjected to BLASTn analysis against the nonredundant virus database from GenBank (http://www.ncbi.nlm.nih.gov/blast). A total of 49 contig sequences, ranging from 200 to 1645 bp in length with an average coverage ranging up to 418.7, aligning with GRGV genome were detected in cvs. Aglianico, Cabernet franc, Pinot gris and Riesling. BLASTn analysis of contigs greater than 500 bp length showed sequence identity between 88.5% and 95% with corresponding GRGV sequences reported from other countries. These results indicated the presence of genetically distinct isolates of GRGV. HTS data also revealed coinfection of GRGV in all samples with one or more of the following virus and/or viroids: grapevine rupestris stem pitting associated virus, grapevine rupestris vein feathering virus, hop stunt viroid or grapevine yellow speckle viroid-1. To further confirm infection by GRGV, total RNA was extracted from two asymptomatic Pinot gris vines previously tested positive in HTS using Spectrum Total RNA isolation kit and subjected to reverse transcription-PCR using primers specific to the replicase polyprotein gene of the virus (RG4847F: 5'-TGGTCTGTTGTTCGCATCTT-3' and RG6076R: 5' CGGAAGGGGAAGCATTGATCT-3', Cretazzo et al., 2017). Sequence analysis of the approximately1,250 bp amplicons (accession number MT749359) showed 91.2 % nt sequence identity with corresponding sequence of GRGV isolate from Brazil (KX828704.1). To our knowledge, this is the first report of GRGV in Washington State. Together with the report of the occurrence of GRGV in California (Sabanadzovic et al. 2000), these/span> results indicate wide geographical distribution of the virus. Although GRGV can cause asymptomatic infections in grapevines (Martelli et al. 2002), the economic importance of GRGV as single or coinfections with other viruses needs to be examined to assess the potential significance of the virus to grape production and grapevine certification programs.