[Genetic Polymorphism of Durum Wheat (Triticum durum Desf.) Accessions of Azerbaijan].

The genetic diversity of 110 durum wheat genotypes of Azerbaijan was evaluated by ISSR markers. A total of 107 fragments were determined, ranging from 9 to 18 per locus. ISSR primers have revealed a high level of polymorphism (average 82%) among different durum wheat varieties and botanical varieties. The ISSR markers used in the study were quite informative and made it possible to distinguish all durum wheat accessions from each other. Cluster analysis based on ISSR data classified the accessions into 11 major groups. No linkage was observed between the collection site and genetic structure of the samples. On the other hand, a few accessions were detected as unique genotypes and tended to form separate clusters. The estimated gene diversity value was high, both within the whole collection and within the different groups of botanical varieties.

First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan.

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5'TTCGGMSARTGGTTGTGGTCCA 3' and YanR-new 5'TGTTGAGGAGTCTACCTATTTNG 3' (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5'TCACSTTCGGRCCGWSTYTWTCAG 3' (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5'TTGTACCGCTTGATCCACGG 3' et CYDV-rev-New 5'GTCTGCGCGAACCATTGCC 3', both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.

First Report of Faba bean necrotic yellows virus Affecting Legume Crops in Azerbaijan.

A total of 482 chickpea (Cicer arietinum L.), 182 lentil (Lens culinaris Medik.), 12 vetch (Vicia sativa L.), 5 field pea (Pisum sativum L.), and 3 faba bean (Vicia faba L.) samples were collected from plants with symptoms suggestive of a viral infection (leaf rolling, yellowing, and stunting) from the major legume-production areas of Azerbaijan in the 2007 and 2008 growing seasons. All samples were tested by the tissue-blot immunoassay (3) at the Virology Laboratory of ICARDA, Syria using 11 specific legume virus antisera including a monoclonal antibody (2-5H9) (1) for Faba bean necrotic yellows virus (FBNYV). Laboratory tests showed that FBNYV was detected in 73, 61, 11, 3, and 2 samples of chickpea, lentil, vetch, field pea, and faba bean, respectively. Total DNA was extracted from six FBNYV-positive samples (two chickpea, two lentil, and two vetch) and tested by PCR with the following four primer sets (FBNYV, Milk vetch dwarf virus [MDV], Subterranean clover stunt virus [SCSV], and nanovirus DNA-R primers [F103 and R101]) (2). All six Azeri samples as well as the reference nanovirus isolates (SCSV-Australia, MDV-Japan, and FBNYV-Syria) generated amplicons of the expected size (~770 bp) using the nanovirus DNA-R primers (F103 & R101). In addition, Azeri samples and FBNYV-Syria yielded a PCR amplicon of the expected size (666 bp) with the FBNYV primer pair. The MDV- and SCSV-specific primers did not generate amplicons with these six samples. Sequence analysis of the FBNYV amplicons from two isolates (AzL 282-07 from lentil [GenBank Accession No. GQ351600] and AzV 277-07 from vetch [GenBank Accession No. GQ371215]) showed that they were 99% identical with each other. Comparing the sequence of AzL 282-07 with that of other nanoviruses revealed identities of 97% (FBNYV-Spain; DQ830990), 96% (FBNYV-Iran; AM493900), 92% (FBNYV-Syria; Y11408), 92% (FBNYV-Egypt; AJ132183), 78% (MDV; AB044387) and 69% (SCSV-Australia; U16734). FBNYV has been reported to infect food legumes in many countries in West Asia and North Africa and cause economic losses on faba bean in Egypt, Jordan, and Syria. To our knowledge, this is the first record of FBNYV infecting legume crops in Azerbaijan. References: (1) A. Franz et al. Ann. Appl. Biol. 128:255, 1996. (2) S. G. Kumari et al. Phytopathol. Mediterr. 47:42, 2008. (3) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994.