Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 47
Filter
Add more filters











Publication year range
1.
J Agric Food Chem ; 72(39): 21935-21945, 2024 Oct 02.
Article in English | MEDLINE | ID: mdl-39311423

ABSTRACT

Maize chlorotic mottle virus (MCMV) is one of the main viruses causing significant losses in maize. N6-methyladenosine (m6A) RNA modification has been proven to play important regulatory roles in plant development and stress response. In this study, we found that MCMV infection significantly up-regulated the m6A level in maize, and methylated RNA immunoprecipitation sequencing (MeRIP-seq) and RNA sequencing (RNA-seq) were performed to investigate the distribution of m6A modified peaks and gene expression patterns in MCMV-infected maize plants. The results showed that 1325 differentially methylated genes (DMGs) and 47 differentially methylated and expressed genes (DMEGs) were identified and analyzed. Moreover, the results of virus-induced gene silencing (VIGS) assays showed that ZmECT18 and ZmGST31 were required for MCMV infection, while silencing of ZmMTC, ZmSCI1 or ZmTIP1 significantly promoted MCMV infection in maize. Our findings provided novel insights into the regulatory roles of m6A modification in maize response to MCMV infection.


Subject(s)
Adenosine , Gene Expression Regulation, Plant , Plant Diseases , Plant Proteins , Zea mays , Zea mays/genetics , Zea mays/virology , Zea mays/immunology , Zea mays/metabolism , Adenosine/analogs & derivatives , Adenosine/metabolism , Plant Diseases/virology , Plant Diseases/genetics , Plant Proteins/genetics , Plant Proteins/metabolism , Plant Proteins/immunology , Disease Resistance/genetics , Methylation , RNA, Plant/genetics , RNA, Plant/metabolism , Tombusviridae
2.
J Agric Food Chem ; 72(38): 20783-20793, 2024 Sep 25.
Article in English | MEDLINE | ID: mdl-39267339

ABSTRACT

Cytidine has a broad range of applications in the pharmaceutical field as an intermediate of antitumor or antiviral agent. Here, a series of new cytidine peptide compounds were synthesized using cytidine and Boc group-protected amino acids and analyzed for their antiviral activities against tobacco mosaic virus (TMV). Among these compounds, the structure of an effective antiviral cytidine peptide SN11 was characterized by 1H NMR, 13C NMR, and high-resolution mass spectrometer. The compound SN11 has a molecular formula of C15H22N6O8 and is named 2-amino-N-(2- ((1- (3,4-dihydroxy-5-(hydroxymethyl) tetrahydrofuran-2-yl) -2-oxo-1,2-dihydropyrimidin-4-yl) amino) -2-oxyethyl) amino). The protection, inactivation, and curation activities of SN11 at a concentration of 500 µg/mL against TMV in Nicotiana glutinosa were 82.6%, 84.2%, and 72.8%, respectively. SN11 also effectively suppressed the systemic transportation of a recombinant TMV carrying GFP reporter gene (p35S-30B:GFP) in Nicotiana benthamiana by reducing viral accumulation to 71.3% in the upper uninoculated leaves and inhibited the systemic infection of TMV in Nicotiana tabacum plants. Furthermore, the results of RNA-seq showed that compound SN11 induced differential expression of genes involved in the biogenesis and function of ribosome, plant hormone signal transduction, plant pathogen interaction, and chromatin. These results validate the antiviral mechanisms of the cytidine peptide compound and provide a theoretical basis for their potential application in the management of plant virus diseases.


Subject(s)
Antiviral Agents , Cytidine , Nicotiana , Peptides , Plant Diseases , Tobacco Mosaic Virus , Tobacco Mosaic Virus/drug effects , Antiviral Agents/pharmacology , Antiviral Agents/chemistry , Antiviral Agents/chemical synthesis , Cytidine/pharmacology , Cytidine/analogs & derivatives , Cytidine/chemistry , Nicotiana/virology , Nicotiana/chemistry , Nicotiana/genetics , Peptides/chemistry , Peptides/pharmacology , Peptides/chemical synthesis , Plant Diseases/virology
3.
Physiol Plant ; 176(4): e14475, 2024.
Article in English | MEDLINE | ID: mdl-39140303

ABSTRACT

Rhizoctonia solani is a fungal pathogen that causes significant losses in agricultural production. Because of its rapid transmission and broad host range, the exploration of genes involved in defense responses to the infection of R. solani has become an important task. Here, we performed a time-course RNA-Seq experiment to explore crucial genes or pathways involved in host responses to R. solani AG3-TB infection at 6, 12, 24, 36, 48, and 72 hours post inoculation (hpi). GO and KEGG enrichment analysis revealed that most DEGs were enriched in the basal metabolism pathways, including carbohydrate metabolic processes and the biosynthesis of amino acids. Moreover, catalase (CAT) and superoxide dismutase (SOD) were up-regulated, and transcription factors (TFs) such as WRKY, AP2, and MYB were increased significantly compared to the control (0 hpi). Silencing of WRKY70 and catalase-3 exhibited elevated susceptibility to the fungal infection. To summarize, the TFs WRKY70 and WRKY75, genes involved in jasmonic acid (JA), salicylic acid (SA), and brassinosteroids (BR) signaling pathways, and defense-related enzymes may play crucial roles in the host responses to R. solani AG3-TB infection.


Subject(s)
Disease Resistance , Gene Expression Regulation, Plant , Plant Diseases , Rhizoctonia , Transcription Factors , Rhizoctonia/physiology , Rhizoctonia/pathogenicity , Plant Diseases/microbiology , Plant Diseases/genetics , Plant Diseases/immunology , Disease Resistance/genetics , Transcription Factors/metabolism , Transcription Factors/genetics , Oxylipins/metabolism , Cyclopentanes/metabolism , Salicylic Acid/metabolism , Plant Proteins/genetics , Plant Proteins/metabolism , Signal Transduction/genetics , Host-Pathogen Interactions/genetics
4.
Mol Plant Pathol ; 25(5): e13462, 2024 May.
Article in English | MEDLINE | ID: mdl-38695630

ABSTRACT

MicroRNAs (miRNAs) are widely involved in various biological processes of plants and contribute to plant resistance against various pathogens. In this study, upon sugarcane mosaic virus (SCMV) infection, the accumulation of maize (Zea mays) miR398b (ZmmiR398b) was significantly reduced in resistant inbred line Chang7-2, while it was increased in susceptible inbred line Mo17. Degradome sequencing analysis coupled with transient co-expression assays revealed that ZmmiR398b can target Cu/Zn-superoxidase dismutase2 (ZmCSD2), ZmCSD4, and ZmCSD9 in vivo, of which the expression levels were all upregulated by SCMV infection in Chang7-2 and Mo17. Moreover, overexpressing ZmmiR398b (OE398b) exhibited increased susceptibility to SCMV infection, probably by increasing reactive oxygen species (ROS) accumulation, which were consistent with ZmCSD2/4/9-silenced maize plants. By contrast, silencing ZmmiR398b (STTM398b) through short tandem target mimic (STTM) technology enhanced maize resistance to SCMV infection and decreased ROS levels. Interestingly, copper (Cu)-gradient hydroponic experiments demonstrated that Cu deficiency promoted SCMV infection while Cu sufficiency inhibited SCMV infection by regulating accumulations of ZmmiR398b and ZmCSD2/4/9 in maize. These results revealed that manipulating the ZmmiR398b-ZmCSD2/4/9-ROS module provides a prospective strategy for developing SCMV-tolerant maize varieties.


Subject(s)
Disease Resistance , MicroRNAs , Plant Diseases , Potyvirus , Zea mays , Zea mays/virology , Zea mays/genetics , Potyvirus/physiology , Potyvirus/pathogenicity , Plant Diseases/virology , Plant Diseases/genetics , Disease Resistance/genetics , MicroRNAs/genetics , MicroRNAs/metabolism , Plant Proteins/metabolism , Plant Proteins/genetics , Gene Expression Regulation, Plant , Reactive Oxygen Species/metabolism
5.
Int J Biol Macromol ; 268(Pt 1): 131628, 2024 May.
Article in English | MEDLINE | ID: mdl-38631577

ABSTRACT

MicroRNAs (miRNAs) play important roles in plant defense against various pathogens. ε-poly-l-lysine (ε-PL), a natural anti-microbial peptide produced by microorganisms, effectively suppresses tobacco mosaic virus (TMV) infection. To investigate the anti-viral mechanism of ε-PL, the expression profiles of miRNAs in TMV-infected Nicotiana tabacum after ε-PL treatment were analyzed. The results showed that the expression levels of 328 miRNAs were significantly altered by ε-PL. Degradome sequencing was used to identify their target genes. Integrative analysis of miRNAs target genes and gene-enriched GO/KEGG pathways indicated that ε-PL regulates the expression of miRNAs involved in critical pathways of plant hormone signal transduction, host defense response, and plant pathogen interaction. Subsequently, virus induced gene silencing combined with the short tandem targets mimic technology was used to analyze the function of these miRNAs and their target genes. The results indicated that silencing miR319 and miR164 reduced TMV accumulation in N. benthamiana, indicating the essential roles of these miRNAs and their target genes during ε-PL-mediated anti-viral responses. Collectively, this study reveals that microbial source metabolites can inhibit plant viruses by regulating crucial host miRNAs and further elucidate anti-viral mechanisms of ε-PL.


Subject(s)
Gene Expression Regulation, Plant , MicroRNAs , Nicotiana , Polylysine , Tobacco Mosaic Virus , Nicotiana/genetics , Nicotiana/virology , MicroRNAs/genetics , MicroRNAs/metabolism , Polylysine/pharmacology , Transcriptome , Plant Diseases/virology , Plant Diseases/genetics , Antiviral Agents/pharmacology , Gene Expression Profiling
6.
Pestic Biochem Physiol ; 201: 105893, 2024 May.
Article in English | MEDLINE | ID: mdl-38685255

ABSTRACT

Potato virus Y (PVY) is one of the most important pathogens in the genus Potyvirus that seriously harms agricultural production. Copper (Cu), as a micronutrient, is closely related to plant immune response. In this study, we found that foliar application of Cu could inhibit PVY infection to some extent, especially at 7 days post inoculation (dpi). To explore the effect of Cu on PVY infection, transcriptome sequencing analysis was performed on PVY-infected tobacco with or without Cu application. Several key pathways regulated by Cu were identified, including plant-pathogen interaction, inorganic ion transport and metabolism, and photosynthesis. Moreover, the results of virus-induced gene silencing (VIGS) assays revealed that NbMLP423, NbPIP2, NbFd and NbEXPA played positive roles in resistance to PVY infection in Nicotiana benthamiana. In addition, transgenic tobacco plants overexpressing NtEXPA11 showed increased resistance to PVY infection. These results contribute to clarify the role and regulatory mechanism of Cu against PVY infection, and provide candidate genes for disease resistance breeding.


Subject(s)
Copper , Disease Resistance , Nicotiana , Plant Diseases , Potyvirus , Nicotiana/virology , Nicotiana/genetics , Potyvirus/physiology , Copper/pharmacology , Plant Diseases/virology , Disease Resistance/genetics , Plant Proteins/genetics , Plant Proteins/metabolism , Gene Expression Profiling , Plants, Genetically Modified/virology , Gene Expression Regulation, Plant , Transcriptome
7.
Plant Dis ; 2024 Apr 08.
Article in English | MEDLINE | ID: mdl-38587797

ABSTRACT

Tomato yellow mottle-associated virus (TYMaV) belongs to the genus Cytorhabdovirus in the family Rhabdoviridae and has been reported to infect a variety of Solanaceae crops, such as Solanum lycopersicum, S. nigrum, Capsicum annuum and Nicotiana benthamiana (Li et al. 2022, Li et al. 2023, Xu et al. 2017, Zhou et al. 2019). In August 2022, about 500 out of 2000 tobacco (N. tabacum) plants showing leaf distortion, crinkling and mosaic symptoms were found in one tobacco growing field in Xingren City, Guizhou Province, China. To identify the causal pathogen(s), leaves from 20 symptomatic tobacco plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq) and assembly. Briefly, total RNA was extracted with TRIzol Reagent (Takara, Kusatsu, Japan). A small RNA cDNA library was constructed by the small RNA Sample Pre Kit. sRNA-Seq was performed with an Illumina NovaSeq 6000 platform. About 29 million reads were obtained and 334 contigs generated after removal of host-derived sequences. Among them, 31 unique contigs mapped to the TYMaV genome (NC_034240.1), covering 28.43% of the genome with the mean read coverage of 0.92%. Meanwhile, 226 contigs mapped to the genome of a potyvirus, chilli veinal mottle virus (ChiVMV, NC_005778.1), covering 88.79% of the genome with the mean read coverage of 0.83%. To verify the sRNA-Seq result for TYMaV identification, reverse transcription (RT)- PCR was performed with specific primers TYMaV-F (5'-CTGACGTAGTGTTGGCAGAT-3') and TYMaV-R (5'-AACCTCCATGCAGAACCATGG-3'). The expected-size 936-bp fragment was amplified from total RNA of all 20 samples. Dot enzyme-linked immunosorbent assays (Dot-ELISA) with antibody for TYMaV (kindly provided by Dr. Zhenggang Li from Guangdong Academy of Agricultural Sciences) were performed and further verified TYMaV infection. In addition, five asymptomatic tobacco plants from the same field as controls were used to detect TYMaV by RT-PCR and Dot-ELISA, and all samples showed negative test results. Subsequently, 17 primer pairs (Supplementary Table 1) were used to obtain the full-length sequence of TYMaV from a single positive tobacco sample by RT-PCR, followed by Sanger sequencing at Sangon Biotech (Shanghai, China). The resulting amplicon sequences were assembled into a nearly full-length genome sequence of a TYMaV isolate from tobacco in Guizhou (TYMaV-GZ). BLASTn analysis of the 13, 393 nt-long sequence (GeneBank accession number, PP444718) revealed 84.7% and 87.2% nt sequence identity with the TYMaV tomato isolate (KY075646.1) and the TYMaV S. nigrum isolate (MW527091.1), respectively. Moreover, five S. nigrum plants showing leaf crinkling and mosaic symptoms from tobacco fields tested positive for TYMaV by RT-PCR assay, suggesting a potential spread of TYMaV between tobacco and S. nigrum, which may serve as a reservoir for the virus in the tobacco fields. However, the transmission route of TYMaV remains unknown, and further verification is needed. To our knowledge, this is the first report of TYMaV infecting tobacco crop in China. It will be important to assess the potential economic importance of TYMaV to tobacco production in China and elsewhere, and to elucidate the respective roles of this virus and ChiVMV in the leaf distorting and yellowing symptoms.

8.
Virology ; 594: 110061, 2024 06.
Article in English | MEDLINE | ID: mdl-38518441

ABSTRACT

The occurrence of geminiviruses causes significant economic losses in many economically important crops. In this study, a novel geminivirus isolated from tobacco in Sichuan province of China, named tomato leaf curl Chuxiong virus (TLCCxV), was characterized by small RNA-based deep sequencing. The full-length of TLCCxV genome was determined to be 2744 nucleotides (nt) encoding six open reading frames. Phylogenetic and genome-wide pairwise identity analysis revealed that TLCCxV shared less than 91% identities with reported geminiviruses. A TLCCxV infectious clone was constructed and successfully infected Nicotiana benthamiana, N. tabacum, N. glutinosa, Solanum lycopersicum and Petunia hybrida plants. Furthermore, expression of the V2, C1 and C4 proteins through a potato virus X vector caused severe chlorosis or necrosis symptom in N. benthamiana. Taken together, we identified a new geminivirus in tobacco plants, and found that V2, C1 and C4 contribute to symptom development.


Subject(s)
Begomovirus , Geminiviridae , Geminiviridae/genetics , Nicotiana , Phylogeny , Virulence , Plant Diseases , Begomovirus/genetics , China
9.
Molecules ; 29(6)2024 Mar 21.
Article in English | MEDLINE | ID: mdl-38543048

ABSTRACT

SYAUP-491 is a novel alkyl sulfonamide. In this study, in vivo and in vitro tests were performed along with a proteomic analysis to determine the effects and underlying mechanisms of the antibacterial activity of SYAUP-491 against the causative agent of bacterial leaf blight in rice. The antibacterial test results suggested that SYAUP-491 exhibited significant activities against Xanthomonas oryzae pv. oryzae (Xoo) in vitro and in vivo. The minimal EC50 values reached 6.96 µg/mL and the curative activity reached 74.1%. Detailed studies demonstrated that SYAUP-491 altered membrane permeability and caused morphological changes. Based on proteomics results, SYAUP-491 might inhibit bacterial protein synthesis. SYAUP-491 may disrupt and alter cell membrane permeability and could further act on ribosomes in the bacterial body. Given the above results, SYAUP-491 could serve as a new lead compound in the research of antibacterial control of plant pathogenic bacterial disease.


Subject(s)
Oryza , Xanthomonas , Proteomics , Anti-Bacterial Agents/pharmacology , Sulfonamides , Oryza/microbiology , Plant Diseases/prevention & control , Plant Diseases/microbiology , Microbial Sensitivity Tests
10.
J Agric Food Chem ; 72(7): 3506-3519, 2024 Feb 21.
Article in English | MEDLINE | ID: mdl-38346922

ABSTRACT

Microbial secondary metabolites produced by Streptomyces have diverse application prospects in the control of plant diseases. Herein, the fermentation filtrate of Streptomyces SN40 effectively inhibited the infection of tobacco mosaic virus (TMV) in Nicotiana glutinosa and systemic infection of potato virus Y (PVY) in Nicotiana benthamiana. Additionally, metabolomic analysis indicated that anisomycin (C14H19NO4) and trans-3-indoleacrylic acid (C11H9NO2) were highly abundant in the crude extract and that anisomycin effectively suppressed the infection of TMV as well as PVY. Subsequently, transcriptomic analysis was conducted to elucidate its mechanisms on the induction of host defense responses. Furthermore, the results of molecular docking suggested that anisomycin can potentially bind with the helicase domain (Hel) of TMV replicase, TMV coat protein (CP), and PVY helper component proteinase (HC-Pro). This study demonstrates new functions of anisomycin in virus inhibition and provides important theoretical significance for the development of new biological pesticides to control diverse plant viruses.


Subject(s)
Potyvirus , Streptomyces , Tobacco Mosaic Virus , Anisomycin , Molecular Docking Simulation , Tobacco Mosaic Virus/genetics , Streptomyces/genetics , Antiviral Agents/pharmacology , Plant Diseases
11.
Pest Manag Sci ; 80(4): 2170-2178, 2024 Apr.
Article in English | MEDLINE | ID: mdl-38284497

ABSTRACT

BACKGROUND: Rhizoctonia solani Kühn is a pathogenic fungus causing tobacco target spot disease, and leads to great losses worldwide. At present, resistant varieties and effective control strategy on tobacco target spot disease are very limited. Host-induced gene silencing (HIGS) as well as the exogenous dsRNA can be used to suppress disease progression, and reveal the function of crucial genes involved in the growth and pathogenesis of the fungus. RESULTS: The silencing of endoPGs or RPMK1 in host plants by TRV-based HIGS resulted in a significant reduction in disease development in Nicotiana benthamiana. In vitro analysis validated that red fluorescence signals were consistently observed in the hyphae treated with Cy3-fluorescein-labeled dsRNA at 12, 24, 48 and 72 h postinoculation (hpi). Additionally, application of dsRNA-endoPGs, dsRNA-RPMK1 and dsRNA-PGMK (fusion of partial endoPGs and RPMK1 sequences) effectively inhibited the hyphal growth of R. solani YC-9 in vitro and suppressed disease progression in the leaves, and quantitative real-time PCR confirmed that the application of dsRNAs significantly reduced the expression levels of endoPGs and RPMK1. CONCLUSION: These results provide theoretical basis and new direction for RNAi approaches on the prevention and control of disease caused by R. solani. © 2024 Society of Chemical Industry.


Subject(s)
Nicotiana , RNA, Double-Stranded , Nicotiana/genetics , RNA Interference , RNA, Double-Stranded/genetics , RNA, Double-Stranded/pharmacology , Rhizoctonia , Disease Progression
12.
Int J Biol Macromol ; 257(Pt 2): 128685, 2024 Feb.
Article in English | MEDLINE | ID: mdl-38096927

ABSTRACT

Sugarcane mosaic virus (SCMV) is one of the most important pathogens causing maize dwarf mosaic disease, which seriously affects the yield and quality of maize. Currently, the molecular mechanism of non-coding RNAs (ncRNAs) responding to SCMV infection in maize is still uncovered. In this study, a total of 112 differentially expressed (DE)-long non-coding RNAs (lncRNAs), 24 DE-microRNAs (miRNAs), and 1822 DE-messenger RNAs (mRNAs), and 363 DE-lncRNAs, 230 DE-miRNAs, and 4376 DE-mRNAs were identified in maize resistant (Chang7-2) and susceptible (Mo17) inbred lines in response to SCMV infection through whole-transcriptome RNA sequencing, respectively. Moreover, 4874 mRNAs potentially targeted by 635 miRNAs were obtained by degradome sequencing. Subsequently, several crucial SCMV-responsive lncRNA-miRNA-mRNA networks were established, of which the expression levels of lncRNA10865-miR166j-3p-HDZ25/69 (class III homeodomain-leucine zipper 25/69) module, and lncRNA14234-miR394a-5p-SPL11 (squamosal promoter-binding protein-like 11) module were further verified. Additionally, silencing lncRNA10865 increased the accumulations of SCMV and miR166j-3p, while silencing lncRNA14234 decreased the accumulations of SCMV and SPL11 targeted by miR394a-5p. This study revealed the interactions of lncRNAs, miRNAs and mRNAs in maize resistant and susceptible materials, providing novel clues to reveal the mechanism of maize in resistance to SCMV from the perspective of competing endogenous RNA (ceRNA) regulatory networks.


Subject(s)
MicroRNAs , Potyvirus , RNA, Long Noncoding , Saccharum , MicroRNAs/genetics , Transcriptome/genetics , RNA, Long Noncoding/genetics , RNA, Messenger/genetics , Plant Diseases/genetics , Gene Expression Regulation, Plant , Saccharum/genetics , Gene Regulatory Networks
13.
Front Plant Sci ; 14: 1264567, 2023.
Article in English | MEDLINE | ID: mdl-38046597

ABSTRACT

Rhizoctonia solani as a cosmopolitan fungus is the causative agent of many crop diseases and leads to significant economic losses in crop production. To explore the toxin structure and physiological activity of R. solani AG-3 TB, high-performance liquid chromatography (HPLC), infrared absorption spectrum (IR), and nuclear magnetic resonance spectrum (NMR) were required. Here, the compound (methoxymethyl)triphenylphosphonium chloride (MMC) with the molecular formula C20H20ClOP was purified and identified from R. solani AG-3 TB. The pure compound MMC treated at 20 µg/mL, 50 µg/mL, and 100 µg/mL can cause obvious necrosis on leaves, increase active oxygen species (AOS), decrease chlorophyll content, and damage cellular structure. The results enrich the understanding of toxin compounds for R. solani and provide valuable insights into the toxicology of R. solani AG-3 TB.

14.
Plant Dis ; 2023 Dec 06.
Article in English | MEDLINE | ID: mdl-38058007

ABSTRACT

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

15.
Int J Mol Sci ; 24(9)2023 Apr 28.
Article in English | MEDLINE | ID: mdl-37175719

ABSTRACT

Maize lethal necrosis (MLN), one of the most important maize viral diseases, is caused by maize chlorotic mottle virus (MCMV) infection in combination with a potyvirid, such as sugarcane mosaic virus (SCMV). However, the resistance mechanism of maize to MLN remains largely unknown. In this study, we obtained isoform expression profiles of maize after SCMV and MCMV single and synergistic infection (S + M) via comparative analysis of SMRT- and Illumina-based RNA sequencing. A total of 15,508, 7567, and 2378 differentially expressed isoforms (DEIs) were identified in S + M, MCMV, and SCMV libraries, which were primarily involved in photosynthesis, reactive oxygen species (ROS) scavenging, and some pathways related to disease resistance. The results of virus-induced gene silencing (VIGS) assays revealed that silencing of a vitamin C biosynthesis-related gene, ZmGalDH or ZmAPX1, promoted viral infections, while silencing ZmTAT or ZmNQO1, the gene involved in vitamin E or K biosynthesis, inhibited MCMV and S + M infections, likely by regulating the expressions of pathogenesis-related (PR) genes. Moreover, the relationship between viral infections and expression of the above four genes in ten maize inbred lines was determined. We further demonstrated that the exogenous application of vitamin C could effectively suppress viral infections, while vitamins E and K promoted MCMV infection. These findings provide novel insights into the gene regulatory networks of maize in response to MLN, and the roles of vitamins C, E, and K in conditioning viral infections in maize.


Subject(s)
Ascorbic Acid , Potyvirus , Transcriptome , Potyvirus/physiology , Vitamins , Zea mays/genetics , Plant Diseases/genetics
16.
Front Plant Sci ; 14: 1163679, 2023.
Article in English | MEDLINE | ID: mdl-37063211

ABSTRACT

Potato virus Y (PVY) mainly infects Solanaceous crops, resulting in considerable losses in the yield and quality. Iron (Fe) is involved in various biological processes in plants, but its roles in resistance to PVY infection has not been reported. In this study, foliar application of Fe could effectively inhibit early infection of PVY, and a full-length transcriptome and Illumina RNA sequencing was performed to investigate its modes of action in PVY-infected Nicotiana tabacum. The results showed that 18,074 alternative splicing variants, 3,654 fusion transcripts, 3,086 long non-coding RNAs and 14,403 differentially expressed genes (DEGs) were identified. Specifically, Fe application down-regulated the expression levels of the DEGs related to phospholipid hydrolysis, phospholipid signal, cell wall biosynthesis, transcription factors (TFs) and photosystem I composition, while those involved with photosynthetic electron transport chain (PETC) were up-regulated at 1 day post inoculation (dpi). At 3 dpi, these DEGs related to photosystem II composition, PETC, molecular chaperones, protein degradation and some TFs were up-regulated, while those associated with light-harvesting, phospholipid hydrolysis, cell wall biosynthesis were down-regulated. At 9 dpi, Fe application had little effects on resistance to PVY infection and transcript profiles. Functional analysis of these potentially critical DEGs was thereafter performed using virus-induced gene silencing approaches and the results showed that NbCat-6A positively regulates PVY infection, while the reduced expressions of NbWRKY26, NbnsLTP, NbFAD3 and NbHSP90 significantly promote PVY infection in N. benthamiana. Our results elucidated the regulatory network of Fe-mediated resistance to PVY infection in plants, and the functional candidate genes also provide important theoretical bases to further improve host resistance against PVY infection.

17.
Molecules ; 28(2)2023 Jan 12.
Article in English | MEDLINE | ID: mdl-36677848

ABSTRACT

Tobacco target spot disease is caused by Rhizoctonia solani AG-3 TB, which causes serious harm to the quality and yield of tobacco. In this study, thin layer chromatography (TLC), high performance liquid chromatography (HPLC), infrared absorption spectroscopy (IR), and nuclear magnetic resonance spectroscopy (NMR) were used to purify and identify the potential phytotoxin produced by R. solani AG-3 TB. The result indicated that the purified toxin compound was 3-methoxyphenylacetic acid (3-MOPAA) (molecular formula: C9H10O3). The exogenous purified compound 3-MOPAA was tested, and the results revealed that 3-MOPAA can cause necrosis in tobacco leaves. 3-MOPAA is a derivative of phenylacetic acid (PAA), which should be produced by specific enzymes, such as hydroxylase or methylase, in the presence of PAA. These results enrich the research on the pathogenic phytotoxins of R. solani and provide valuable insights into the pathogenic mechanism of AG-3 TB.


Subject(s)
Nicotiana , Toxins, Biological , Pyrrolidinones , Rhizoctonia
18.
Front Plant Sci ; 13: 1027404, 2022.
Article in English | MEDLINE | ID: mdl-36438146

ABSTRACT

Cucumber green mottle mosaic virus (CGMMV) infection causes acidification and rot of watermelon flesh, resulting in serious economic losses. It is widely reported the interaction relationship between boron and reactive oxygen species (ROS) in regulating normal growth and disease resistance in plants. Our previous results demonstrated that exogenous boron could improve watermelon resistance to CGMMV infection. However, the roles of ROS-related genes regulated by boron in resistance to CGMMV infection are unclear. Here, we demonstrated that CGMMV symptoms were alleviated, and viral accumulations were decreased by boron application in Nicotiana benthamiana, indicating that boron contributed to inhibiting CGMMV infection. Meanwhile, we found that a number of differentially expressed genes (DEGs) associated with inositol biosynthesis, ethylene synthesis, Ca2+ signaling transduction and ROS scavenging system were up-regulated, while many DEGs involved in ABA catabolism, GA signal transduction and ascorbic acid metabolism were down-regulated by boron application under CGMMV infection. Additionally, we individually silenced nine ROS-related genes to explore their anti-CGMMV roles using a tobacco rattle virus (TRV) vector. The results showed that NbCat1, NbGME1, NbGGP and NbPrx Q were required for CGMMV infection, while NbGST and NbIPS played roles in resistance to CGMMV infection. The similar results were obtained in watermelon by silencing of ClCat, ClPrx or ClGST expression using a pV190 vector. This study proposed a new strategy for improving plant resistance to CGMMV infection by boron-regulated ROS pathway and provided several target genes for watermelon disease resistance breeding.

19.
Front Microbiol ; 13: 1001327, 2022.
Article in English | MEDLINE | ID: mdl-36304957

ABSTRACT

Rhizoctonia solani has a broad host range and results in significant losses in agricultural production. Here, an integrated transcriptomic analysis was performed to reveal the critical genes responsible for the pathogenesis of R. solani AG-3 TB on Nicotiana tabacum at different infection stages. The results showed that various differential expressed genes (DEGs) were enriched in fatty acid metabolism, amino sugar, carbon metabolism, and cellular carbohydrate biosynthetic process at the early (6-12 hpi), middle (24-36 hpi), and late stage (48-72 hpi) of infection. Specifically, several critical genes such as shikimate kinase that were involved in the biosynthesis of an important fungal toxin, phenylacetic acid (PAA) showed markedly increase at 24 hpi. Additionally, the genes expression levels of carbohydrate-active enzymes (CAZymes) and cell wall degrading enzymes (CWDEs) were significantly increased at the late infection stage. Furthermore, we identified 807 potential secreted proteins and 78 small cysteine-rich proteins, which may function as fungal effectors and involved in the pathogenicity. These results provide valuable insights into critical and potential genes as well as the pathways involved in the pathogenesis of R. solani AG-3 TB.

20.
J Agric Food Chem ; 70(39): 12270-12286, 2022 Oct 05.
Article in English | MEDLINE | ID: mdl-36126240

ABSTRACT

Cucumber green mottle mosaic virus (CGMMV) infection causes "blood flesh" symptoms in watermelon fruits, which severely reduces yield and edibleness. However, the growth of watermelon fruits is strongly associated with boron (B), a trace element for improving fruit quality. In this study, B-gradient hydroponic experiments (B concentration: 0, 2.86, and 5.72 mg·L-1 H3BO3) and foliar-spray experiments (B concentration: 30 and 300 mg·L-1 H3BO3) were performed. We found that the B-supplement could inhibit CGMMV infection and especially relieve "blood flesh" symptoms in watermelon fruits. The nutrient element, soluble sugar, and cell wall polysaccharide contents and their metabolism- and transport-related gene expressions were determined in leaves and fruits of the watermelons in B-gradient hydroponic and foliar-spray experiments. We found that the accumulation and metabolism of nutrients and carbohydrates in cells were disrupted by CGMMV infection; however, the B-supplement could restore and maintain their homeostasis. Additionally, we uncovered that NIP5;1 and SWEET4, induced by B-application with CGMMV infection, could majorly contribute to the resistance to CGMMV infection by regulating nutrient elements and carbohydrate homeostasis. These results provided a novel insight into the molecular mechanism of B-mediated CGMMV suppression and an efficient method of B-application for the improvement of watermelon quality after CGMMV infection.


Subject(s)
Citrullus , Trace Elements , Boron , Carbohydrates , Plant Diseases , Sugars , Tobamovirus
SELECTION OF CITATIONS
SEARCH DETAIL