Nonsense-mediated mRNA decay in the ADAMTS13 gene caused by a 29-nucleotide deletion.

BACKGROUND: In mammalian cells a regulatory mechanism, known as nonsense-mediated mRNA decay, degrades mRNA harboring premature termination codons. This mechanism is intron-dependent and functions as a quality control mechanism to eliminate abnormal transcripts and modulates the levels of a variety of naturally occurring transcripts. DESIGN AND METHODS: In this study, we explored the molecular mechanism of ADAMTS13 deficiency in two compound heterozygous siblings carrying a 29-nucleotide deletion mutation located in exon 3 (c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA) in one allele and a single base (A) insertion mutation (c.4143_4144insA) in the second CUB domain previously reported in the other allele. Real-time quantitative reverse transcriptase polymerase chain reaction was used to explore whether the premature termination codons introduced by the deletion of the 29 nucleotides triggered the nonsense-mediated mRNA decay. RESULTS: In vitro-expression studies demonstrated that the premature termination codons inserted by the 29 bp deletion probably lead to a reduction of ADAMTS13 mRNA levels through the regulatory mechanisms of nonsense-mRNA decay. Furthermore, the 4143_4144insA mutation causes an impairment of secretion that leads to retention of the mutant protein in the endoplasmic reticulum, as observed in immunofluorescence studies. CONCLUSIONS: In conclusion, this work reports how two different ADAMTS13 gene defects acting at two different levels, i.e, impairment of steady-state mRNA level caused by the premature termination codon mediated decay mechanism induced by the 29 bp deletion mutation and alteration of the secretion pathway due to 4143_4144insA, lead to a severe deficiency of ADAMTS13.

Cold storage of citrated whole blood induces drastic time-dependent losses in factor VIII and von Willebrand factor: potential for misdiagnosis of haemophilia and von Willebrand disease.

This study investigates the effect of pre-analytic storage conditions on the laboratory evaluation of von Willebrand disease (VWD) and haemophilia. Samples from healthy controls and patients with VWD were stored as whole blood and as separated plasma, both at room temperature and on crushed ice, for two different time periods (3 or 6 h). In samples from healthy individuals (n=10) and in patients with suspected type 1 VWD (n=10), storage of whole blood on ice caused a drastic time-dependent decrease in von Willebrand factor (VWF):ristocetin cofactor activity, in VWF:antigen activity and factor VIII activity (mean+/-SD) to 35+/-18, 55+/-23 and 53+/-15% of baseline levels after 6 h storage, respectively. Patients with type 2 VWD and non-detectable VWF:ristocetin cofactor activity did not demonstrate such drastic cold-induced losses in VWF and factor VIII levels. Storage of plasma caused only minor changes in VWF levels. The cold-induced loss in VWF might thus depend on the presence of platelets and of high molecular weight VWF. Chilling of platelets induces a clustering of the glycoprotein Ib subunit. We therefore hypothesize that cold-induced loss in VWF might be due to a cold-promoted binding of VWF to glycoprotein VWF receptor Ib alpha. These results suggest a serious potential for misdiagnosis of haemophilia or VWD due to inappropriate pre-analytical handling of blood.

ADAMTS13 autoantibodies in patients with thrombotic microangiopathies and other immunomediated diseases.

Autoantibodies neutralizing human ADAMTS13 (a disintegrin-like and metalloproteinase with thrombospondin type 1 motif), the metalloprotease that physiologically cleaves von Willebrand factor, are a major cause of severe deficiency of the protease and of acquired thrombotic thrombocytopenic purpura (TTP). We evaluated prevalence of anti-ADAMTS13 antibodies in 59 patients with thrombotic microangiopathies (TMAs) and in 160 patients with immunologic or thrombocytopenic diseases different from TTP, using an enzyme-linked immunosorbent assay (ELISA). Immunoglobulin G (IgG) antibodies directed against ADAMTS13 were found in 97% of untreated patients with acute acquired TMA who had plasma levels of ADAMTS13 activity below 10%. The corresponding prevalence of IgM antibodies was 11%. In contrast, anti-ADAMTS13 antibodies of G or M isotypes were detected in 20% of patients with TMA with ADAMTS13 activity above 10%. The ELISA was more sensitive than the standard functional inhibitor assay for detecting antibodies against ADAMTS13. Patients with thrombocytopenia from various causes (n = 50), systemic lupus erythematosus (SLE; n = 40), and the antiphospholipid antibody syndrome (APS; n = 55) had prevalences of IgG antibodies of 8%, 13%, and 5% respectively, only slightly higher than the prevalence in 111 healthy donors (4%). A rather high prevalence of anti-ADAMTS13 IgM antibodies was found in patients with SLE and APS (18% each). The clinical significance of IgM antibodies in these groups is unclear. In conclusion, the ELISA method detected anti-ADAMTS13 IgG antibodies in a very large proportion of patients with acquired TMA associated with severe ADAMTS13 deficiency, and was more sensitive than the inhibitor assay.

The course of ADAMTS-13 activity and inhibitor titre in the treatment of thrombotic thrombocytopenic purpura with plasma exchange and vincristine.

The therapeutic efficacy of plasma exchange (PE) in thrombotic thrombocytopenic purpura (TTP) is attributed to the restoration in ADAMTS-13 (a disintegrin and metalloproteinase with thrombospondin motif-13) activity by substitution of the enzyme and removal of ADAMTS-13-neutralizing autoantibodies. We explored this rationale by analysing ADAMTS-13 activity and corresponding inhibitor levels during PE-treatment in 27 episodes from 23 adults with TTP. All patients with an initial episode of TTP (n = 14) and nine of 11 patients with a relapse showed severe ADAMTS-13 deficiency. ADAMTS-13 inhibitors were detected in 81% of these patients. Twenty-one patients responded to PE-therapy and two patients died. For patients with severe ADAMTS-13 deficiency, 15 patients (71%) showed a PE-induced recovery in ADAMTS-13 activity and six patients (29%) had persistent severe ADAMTS-13 deficiency despite clinical response. Three patients with recurrent TTP demonstrated a permanent increase in inhibitor titre during therapy. Six patients (43%) with an initial episode of TTP displayed a transient increase in inhibitor titre during PE-therapy, which was associated with deterioration in clinical and haematological symptoms of TTP. Treatment with vincristine induced an immediate increase in platelet count and ADAMTS-13 activity in seven of eight patients. We conclude that ADAMTS-13 activity and inhibitor levels, as measured using current methodology, do not solely determine the clinical course of TTP.

ADAMTS-13 activity in patients with brain and prostate tumors is mildly reduced, but not correlated to stage of malignancy and metastasis.

Impaired Von Willebrand factor cleaving activity of ADAMTS-13 was demonstrated in patients with metastasizing and malignant tumors. To investigate the relevance of ADAMTS-13 for tumor progression, we determined ADAMTS-13 activity and VWF:Ag in 80 patients with various malignancies: 30 patients with benign brain tumors, 30 patients with malignant brain tumors, 10 patients with local prostate tumors and 10 patients with metastatic prostate tumors. We found mild ADAMTS-13 deficiency in 17/80 tumor patients, but there was no significant difference in ADAMTS-13 activity between the age- and sex-matched patients with benign and malignant brain tumors nor between the age matched patients with local and metastatic prostate tumors. Patients with malignant brain tumors could only be distinguished from patients with benign tumors by elevated levels of VWF:Ag (p=0.018). Our data are hence in variance to previous studies, which found a distinct inverse correlation between ADAMTS-13 activity and level of metastasis and/or malignancy in diverse cancer-types.

Increased incidence of thrombophilic abnormalities in patients with cranial dural arteriovenous fistulae.

Cranial dural arteriovenous fistulae (DAVF) may occur post-traumatic or sporadic. The physiopathologic mechanisms of sporadic DAVF are still unclear. A dural sinus thrombosis followed by an increase in venous pressure and/or an increased procoagulatory activity of the coagulation system are associated at least with some DAVF. The objective of this study was to investigate the coagulation profile in patients with DAVF. Thus the association of thrombophilic abnormalities, sinus thrombosis and DAVF should be analyzed. A total of 15 patients with cranial DAVF were included in this study. Blood samples were analyzed for 20210A mutation of the prothrombin gene, resistance to activated protein C and factor V Leiden mutation. Fibrinogen (Fib), Textarin time (TT), antithrombin (AT), protein C and protein S activity, von Willebrand factor antigen (vWF:Ag), Ristocetin cofactor activity (vWF:RCo), D-Dimer (DD) and coagulation factor VIII-activity (F VIII) were determined in all patients. Blood was screened for the occurrence of lupus antiphospholipid antibodies and cardiolipin antibodies. Thrombophilic risk factors were found in 5 (33%) of the 15 patients with cranial DAVF. Four patients had a heterozygote 20210A mutation of the prothrombin gene and one patient had a heterozygote FV Leiden mutation. Sinus thrombosis was detected in two patients with grade 2b DAVF and was associated with a 20210A mutation of the prothrombin gene in both patients. Additionally, one patient had deficient protein C activity and screening for cardiolipin antibodies was positive in three patients. In the current series the frequency of prothrombin Gene 20210A mutation was higher in patients with DAVF compared to the general population, whereas the incidence of Factor V Leiden mutation was not. Therefore in patients with cranial DAVF thrombophilic abnormalities should be considered in the post-operative/post-interventional management.

Increased levels of plasma tissue factor pathway inhibitor in patients with glioblastoma and intracerebral metastases.

Tissue Factor Pathway Inhibitor (TFPI) prevents further participation of Tissue Factor (TF) in the coagulation process by forming a stable quaternary complex of TF-FVIIa-FXa-TFPI. Recently, plasma TFPI level were found to be elevated in patients with malignant disease outside the brain. Therefore the aim of this study was to investigate the TFPI plasma level in patients with primary brain tumors and intracerebral metastases. From May 2000 to December 2001 the total tissue factor pathway inhibitor antigen (TFPI) was preoperatively determined in blood samples of 225 patients with primary or metastatic brain tumors. Tumor histology classified as benign (WHO grade I and II) and malignant (WHO grade III and IV, intracerebral metastases) was correlated to plasma TFPI-levels. Plasma TFPI was significantly higher in patients with malignant tumors including intracerebral metastasis compared to benign tumors (80.1 +/- 34.31 versus 64.3 +/- 25.8 ng ml-1 [p < 0.01; t-test]). To exclude the influence of primary systemic neoplasms with secondary brain metastasis on plasma TFPI-level a subgroup of patients with primary brain tumors (meningioma, astrocytoma, oligodendroglioma and glioblastoma) was separated. In this group TFPI-level was also significantly elevated in patients with malignant (n = 66) (78.6 +/- 29.9) compared to benign brain tumors (n = 127) (64.3 +/- 25.8 ng ml-1 [p < 0.01; t-test]). To the authors' knowledge this is the first study describing the correlation of increased plasma TFPI and malignancy in patient with brain tumors. Further studies are needed to clarify the pathogenic mechanism and the clinical relevance of this phenomenon.