First Report of Ascochyta Leaf Spot of Quinoa Caused by Ascochyta sp. in the United States.

The Andean crop quinoa (Chenopodium quinoa Willd.), an amaranthaceous pseudograin, is an important food and export crop for this region. Quinoa is susceptible to Ascochyta leaf spot reportedly caused by Ascochyta hyalospora and/or A. caulina (1,2), and quinoa seeds can be infested by A. hyalospora (3). Quinoa fields were established in Pennsylvania during summer 2011. Widespread leafspot symptoms were observed on quinoa in mid-August 2011 in Centre County, PA. Tan to reddish-brown, irregularly shaped lesions were observed with numerous black pycnidia randomly distributed within each lesion. Crushed pycnidia revealed sub-hyaline to light brown, 1 to 2, or less often 3 septate, cylindrical to ovoid spores, 13 to 25 µm long by 5 to 10 µm wide. Pure cultures of Ascochyta were obtained by plating pycnidia from surface disinfested leaves onto half strength acidified potato dextrose agar (APDA). To obtain conidia for pathogenicity trials, cultures were transferred to oatmeal agar and placed in a 20°C incubator with a 12-h photoperiod. Conidia were harvested by scraping 2-week-old cultures. The conidial suspension was filtered through cheesecloth and adjusted to 1.8 × 105 conidia/mL. Tween 20 (0.1%) was added to the final inoculum and sprayed (with a Crown Spra-tool) onto ten 1-month old quinoa plants. Six plants sprayed with sterile water with 0.1% Tween 20 served as controls. Plants were placed in a growth chamber and bagged for 48 h to maintain >95% humidity. After 48 h, tan, irregularly shaped lesions were observed on inoculated plants, but no symptoms were observed on control plants. Plants were grown for 2 more weeks to observe symptom development, and then leaves with characteristic lesions were collected for isolation. Symptomatic leaves were surface disinfested in 10% bleach for 1 min and tissue from the lesion periphery was plated onto APDA. Obtained cultures were morphologically and molecularly identical to those obtained from quinoa fields. For molecular identification of the pathogen, DNA was extracted from cultures of Ascochyta and amplified using ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) primers. Sequences obtained shared 99% maximum identity with a GenBank accession of A. obiones (GU230752.1), a species closely related to A. hyalospora and A. caulina (4). However, the obtained pathogen is morphologically more similar to A. hyalospora and A. chenopodii, but not to A. caulina or A. obiones. At this time, final species identification is impossible because no GenBank sequence data is available for A. hyalospora or A. chenopodii. To our knowledge, this is the first report of Ascochyta leaf spot of quinoa in the United States. The impact of Ascochyta leaf spot on domestic and global quinoa production is unknown, but management of foliar diseases of quinoa, including Ascochyta leaf spot, is a critical component of any disease management program for quinoa. References: (1) S. Danielsen. Food Rev. Int. 19:43, 2003. (2) M. Drimalkova. Plant Protect. Sci. 39:146, 2003. (3) G. Boerema. Neth. J. Plant. Pathol. 83:153, 1977. (4) J. de Gruyter. Stud. Mycol. 75:1, 2012.

First Report of Passalora Leaf Spot of Quinoa Caused by Passalora dubia in the United States.

The Andean seed crop quinoa, Chenopodium quinoa Willd., is an important export of Bolivia, Ecuador, and Peru. Key foliar diseases of quinoa include quinoa downy mildew (caused by Peronospora variabilis Gäum) (1), Ascochyta leaf spot (caused by Ascochyta sp.) (1), and a Cercospora-like leaf spot, the latter of which has been observed on cultivated quinoa (Jose B. Ochoa, unpublished) and native Chenopodium species. Passalora dubia (Riess) U. Braun (syn. Cercospora dubia) was tested in Europe as a biological control agent for Chenopodium album (3) and has been reported on C. album in the United States (U.S. National Fungus Collections). Quinoa field plots were established in Pennsylvania during summer 2011 and Cercospora-like leaf spot symptoms were first observed on quinoa in Centre Co. and Lancaster Co. in August 2011, after an extended rainy period. Foliar symptoms were round to oval, brown to grey-black lesions, less than 1 cm in diameter, with darker brown, reddish margins. Similar symptoms were observed on C. album weeds within both fields. Using a hand lens, conidia were observed within sporulating lesions. Conidia were hyaline and septate, 25 to 98 µm × 5 to 10 µm, and had an average of six cells per conidium. The fungus was isolated by picking single conidia from sporulating lesions (under a dissecting scope) and incubated on V8 agar in the dark at 20°C to induce sporulation. For DNA extraction, cultures were grown in potato dextrose broth amended with yeast extract. The internal transcribed spacer (ITS) region was amplified using primers ITS4 and ITS5 (2), and the resulting sequence shared 99% maximum identity with a vouchered isolate of P. dubia (GenBank EF535655). To test the pathogenicity of our P. dubia isolate, 5.9 × 103 conidia/ml (suspended in sterile water with 0.1% Tween 20) or the control solution with no conidia were sprayed, using an atomizer, onto 2-month-old quinoa plants, with 18 replications per treatment. Plants were covered with a humidity dome and maintained at >99% RH for 48 h. Plants were grown in the greenhouse at approximately 65% RH. After 1 month, circular to oval light brown lesions (<1 cm diameter) with darker margins were observed on approximately 10% of the leaves of inoculated plants, whereas no symptoms were observed on the control plants. Infected leaves were collected, incubated in a humidity chamber, and conidia were picked from sporulating lesions and inoculated onto V8 agar amended with 3% (w/v) fresh, ground quinoa plant tissue (4). Cultures were maintained at 20°C with 16-h photoperiod to induce sporulation. The identity of the reisolated fungus was confirmed morphologically and by DNA sequencing to be identical to the isolate used to test Koch's postulates. P. dubia was also isolated from C. album lesions and infected C. album may have served as a source of inoculum for quinoa. To our knowledge, this is the first report of Passalora leaf spot of quinoa in the United States. References: (1) S. Danielsen. Food Rev. Int. 19:43, 2003. (2) S. Goodwin et al. Phytopathology 91:648, 2001. (3) P. Scheepens et al. Integ. Pest. Man. Rev. 2:71, 1997. (4) M. Vathakos. Phytopathology 69:832, 1979.

Detection and expression of enterotoxin genes in endophytic strains of Bacillus cereus.

AIMS: The aim of this study was to determine whether endophytic Bacillus cereus isolates from agronomic crops possessed genes for the nonhaemolytic enterotoxin (Nhe) and haemolysin BL (HBL) and, therefore, have the potential to cause diarrhoeal illness in humans. METHODS AND RESULTS: PCR followed by sequencing confirmed the presence of enterotoxin genes nheA, nheB, nheC, hblA, hblC, hblD in endophytic B. cereus. All nhe genes were detected in 59% of endophytic B. cereus, while all hbl genes were detected in 44%. All six genes were detected in 41% of isolates. Enterotoxin genes were not detected in 15% of B. cereus isolates. Reverse transcriptase real-time PCR confirmed that endophytic B. cereus could express enterotoxin genes in pure culture. CONCLUSIONS: This study showed that endophytic B. cereus isolates that possess genes for enterotoxin production are present in agronomic crops. Other endophytic B. cereus isolates lacked specific genes or lacked all nhe and hbl genes. Additionally, host, country of origin and tissue of origin had no impact on the enterotoxin genes detected. SIGNIFICANCE AND IMPACT OF THE STUDY: Bacillus cereus with the potential of causing diarrhoeal illness in humans is a cosmopolitan endophytic inhabitant of plants, not incidental surface inhabitants or contaminants, as often suggested by previous research.

First Report of Quinoa Downy Mildew Caused by Peronospora variabilis in the United States.

Quinoa, Chenopodium quinoa Willd., is an Andean crop prized for its high nutritional value and adaptability to harsh environments. Quinoa is plagued by downy mildew caused by Peronospora variabilis Gäum (formerly Peronospora farinosa f. sp. chenopodii Byford) (1). Quinoa production has spread beyond native Andean ranges and quinoa downy mildew has been reported in India, Canada, and Denmark (1). During the summer of 2011, quinoa trials were established to determine the ability of quinoa to grow under Mid-Atlantic conditions and monitor for regional disease problems. In July, after cool, rainy conditions, downy mildew-like symptoms were observed on quinoa at research plots in Centre and Lancaster counties of Pennsylvania. Symptoms and signs consisted of irregularly shaped areas of foliar chlorosis or pink discoloration accompanied by dense, gray sporulation on both leaf surfaces. Sporangia were tan to gray-brown, semi-ovoid, often with a pedicel, mean length of 31 µm, and mean width of 23 µm. Sporangiophores branched dichotomously, and the terminal branchlets curved and tapered to a point. Orange oospores were present in field samples of leaf tissue. DNA was extracted from infected foliar tissue and sporangial suspensions. A seminested PCR protocol (2) was used to obtain partial internal transcribed spacer (ITS) sequences of six Peronospora isolates. The sequences shared 99% maximum identity to a known P. variabilis accession (FM863721.2) in GenBank. A voucher specimen was deposited into the U.S. National Fungus Collections (BPI 882064). Pathogenicity of each of two strains of P. variabilis was confirmed by inoculating quinoa with sporangia (4). Sporangia were shaken from leaves in sterile distilled water and the suspension was filtered through cheesecloth. A 0.01% Tween solution was added and the suspension diluted to 103 sporangia/ml. With an atomizer, a 10-ml sporangial suspension (or sterile water for noninoculated control plants) was sprayed onto one flat of 18 2-week-old quinoa plants, and relative humidity was increased to saturation using a humidity dome for 24 h. After 1 week, chlorosis and pink discoloration were noted on leaves of inoculated quinoa, and after 18 h of subsequent increased humidity (>95% relative humidity), dense gray sporulation was observed. No symptoms were noted on noninoculated control plants. Sporangia and sporangiophores were examined morphologically and confirmed to be P. variabilis, confirming Koch's postulates. For culture maintenance, 2-week-old quinoa leaves were placed onto a sporangial suspension on top of 1% water agar and maintained in a growth chamber at 20°C with 16 h of light per day. Quinoa downy mildew is seedborne (3) and initial infections may have occurred from oospores in the pericarp, despite intensive processing of consumable quinoa seeds to remove saponins. To our knowledge, this is the first report of quinoa downy mildew in the United States and also the first report of P. variabilis in the United States. References: (1) Y. Choi et al. Mycopathologia 169:403, 2010. (2) D. Cooke et al. Fungal Genet. Biol. 30:17, 2000. (3) S. Danielson et al. Seed Sci. Technol. 32:91, 2004. (4) J. Ochoa et al. Plant Pathol. 48:425, 1999.

Viability and stability of biological control agents on cotton and snap bean seeds.

Cotton and snap bean were selected for a multi-year, multi-state regional (south-eastern USA) research project to evaluate the efficacy of both commercial and experimental bacterial and fungal biological control agents for the management of damping-off diseases. The goal for this portion of the project was to determine the viability and stability of biological agents after application to seed. The biological seed treatments used included: (1) Bacillaceae bacteria, (2) non-Bacillaceae bacteria, (3) the fungus Trichoderma and (4) the fungus Beauveria bassiana. Seed assays were conducted to evaluate the following application factors: short-term (< or = 3 months) stability after seed treatment; quality (i.e. isolate purity); compatibility with chemical pesticides and other biocontrol agents; application uniformity between years and plant species. For the bacterial treatments, the Bacillaceae genera (Bacillus and Paenibacillus) maintained the greatest population of bacteria per seed, the best viability over time and the best application uniformity across years and seed type. The non-Bacillaceae genera Burkholderia and Pseudomonas had the least viability and uniformity. Although Beauveria bassiana was only evaluated one year, the seed fungal populations were high and uniform. The seed fungal populations and uniformity for the Trichoderma isolates were more variable, except for the commercial product T-22. However, this product was contaminated with a Streptomyces isolate in both the years that it was evaluated. The study demonstrated that Bacillaceae can be mixed with Trichoderma isolates or with numerous pesticides to provide an integrated pest control/growth enhancement package.

Insecticidal activity of the CryIIA protein from the NRD-12 isolate of Bacillus thuringiensis subsp. kurstaki expressed in Escherichia coli and Bacillus thuringiensis and in a leaf-colonizing strain of Bacillus cereus.

A 4.0-kb BamHI-HindIII fragment encoding the cryIIA operon from the NRD-12 isolate of Bacillus thuringiensis subsp. kurstaki was cloned into Escherichia coli. The nucleotide sequence of the 2.2-kb AccI-HindIII fragment containing the NRD-12 cryIIA gene was identical to the HD-1 and HD-263 cryIIA gene sequences. Expression of cryIIA and subsequent purification of CryIIA inclusion bodies resulted in a protein with insecticidal activity against Heliothis virescens, Trichoplusia ni, and Culex quinquefasciatus but not Spodoptera exigua. The 4.0-kb BamII-HindIII fragment encoding the cryIIA operon was inserted into the B. thuringiensis-E. coli shuttle vector pHT3101 (pMAU1). pMAU1 was used to transform an acrystalliferous HD-1 strain of B. thuringiensis subsp. kurstaki and a leaf-colonizing strain of B. cereus (BT-8) by using electroporation. Spore-crystal mixtures from both transformed strains were toxic to H. virescens and T. ni but not Helicoverpa zea or S. exigua.

Soybean-Peanut Rotations for the Management of Meloidogyne arenaria.

Rotating soybean (Glycine max cv. Kirby) with peanut (Arachis hypogaea cv. Florunner) for managing Meloidogyne arenaria race 1 was studied for 3 years (1985-87) in a field near Headland, Alabama. Each year soybean plots had lower soil numbers of M. arenaria second-stage juveniles (J2) at peanut harvest than did plots in peanut monocnlture. Peanut following either 1 or 2 years of soybean resulted in approximately 50% reduction in J2 soil population densities and a 14% (1-year soybean) or 20% (2-year soybean) increase in yields compared with continuous peanut. The soybean-peanut rotation increased peanut yield equal to or higher than the yield obtained with continuous peanut treated with aldicarb at 0.34 g a.i./mL.

Peanut-Cotton Rotations for the Management of Meloidogyne arenaria.

The efficacy of 'Deltapine 90' cotton (Gossypium hirsutum) in rotation with 'Florunner' peanut (Arachis hypogaea) for the management of Meloidogyne arenaria was studied for 2 years in a field in southeastern Alabama. In 1985, M. arenaria juvenile populations in plots with cotton were 98% lower than in plots with peanut. Peanut and cotton yields were increased by treatment with aldicarb (3.3 kg a.i./ha in a 20-cm-band) in 1985 but not in 1986. In 1986, peanut yields were highest and M. arenaria juvenile populations in soil were lowest in plots that had cotton the previous year. In 1986, numbers of M. arenaria juveniles in plots with peanut both years were reduced by treatment with aldicarb to levels found in plots with cotton-peanut rotation. The use of aldicarb in peanut following cotton similarly treated reduced the incidence of southern blight (Sclerotium rolfsii). Cotton-peanut is a good rotation for the management of M. arenaria and to increase peanut yields without the use of nematicides.

Effects of aldicarb on nematodes, early season insect pests, and yield of soybean.

The effects of aldicarb on soybean cyst (Heterodera glycines) and root-knot (Meloidogyne incognita and M. arenaria) nematode populations, early season insect pests and soybean (Glycine max) yield were evaluated in five field experiments in northern and southern Alabama. Aldicarb significantly (P = 0.05) reduced nematode populations in only two cases: M. arenaria in Centennial soybean in the Wiregrass site and M. incognita in Bedford soybean in a Tennessee Valley site. No significant difference (P = 0.05) in mean percentage main stem or petiole girdling by threecornered alfalfa hopper (Spissistilus festinus) or in mean number of plants damaged by lesser cornstalk borer (Elasmopalpus lignosellus) occurred among treatments in any experiment. Soybean yields were significantly (P = 0.05) increased in only two cases: in the nematode susceptible Essex and Cobb cultivars planted in the Tennessee Valley and Gulf Coast sites, respectively. Unusually dry 1986 weather conditions may have reduced the activity of aldicarb.