The Combined Effect of Robot-assisted Therapy and Activities of Daily Living Training on Upper Limb Recovery in Persons With Subacute Stroke: A Randomized Controlled Trial.

OBJECTIVES: To evaluate the effectiveness of robot-assisted therapy (RAT) followed by activities of daily living (ADL) training in comparison with conventional rehabilitation therapy (CRT) and ADL training in individuals with subacute stroke. DESIGN: A single-blind, 2-arm, parallel-group, open-level, randomized controlled trial. SETTING: A tertiary care teaching hospital in India. PARTICIPANTS: Forty-four persons (n=44) with first-ever stroke (in subacute stage) were enrolled from August 2021 to July 2023. INTERVENTION: Participants in the RAT group (n=22) received RAT for 30 minutes, followed by ADL training for 30 minutes. In contrast, participants in the CRT group (n=22) received CRT (30 minutes) followed by ADL training (30 minutes). Both groups received allocated interventions for 15 days over 3 weeks (5 days/week, 3 weeks). MAIN OUTCOME MEASURES: Primary outcome: Motor domain score of the Fugl-Meyer Assessment scale for upper extremity (FMA-UE). SECONDARY OUTCOMES: the other domains scores of FMA-UE (UL -sensation, -joint motions, -joint pain); Modified Ashworth Scale (MAS) (spasticity); hand-function (HF) and ADL-domain scores of the stroke impact scale (SIS); WHOQQL-BREF questionnaires (QOL). Participants were assessed at enrolment and follow-up at 3, 6, and 12 weeks. RESULTS: Persons who received RAT and ADL training reported significant improvement (P<.05) in UL motor function (mean difference [MD]=3.54;(95% confidence interval [CI]: 1.28 to 5.79]), UL passive joint motions (MD=2.54; [95% CI: 1.56 to 3.52]), SIS-HF (MD=6.37;[95% CI: 4.75 to 7.99]), SIS-ADL (MD=7.13 [95% CI: 3.52 to 8.74]), and in all domains of WHOQOL-BREF (except environmental domain) compared with persons who received CRT and ADL training at 12 weeks. CONCLUSIONS: The findings indicate that RAT followed by ADL training is more effective than CRT followed by ADL training in motor improvement, SIS-HF, SIS-ADL, and QOL at 12 weeks.

Warmer temperatures trigger insecticide-associated pest outbreaks.

BACKGROUND: Rising global temperatures are associated with emerging insect pests, reflecting earlier and longer insect activity, faster development, more generations per year and changing species' ranges. Insecticides are often the first tools available to manage these new threats. In the southeastern US, sweet potato whitefly (Bemisia tabaci) has recently become the major threat to vegetable production. We used data from a multi-year, regional whitefly monitoring network to search for climate, land use, and management correlates of whitefly activity. RESULTS: Strikingly, whiteflies were detected earlier and grew more abundant in landscapes with greater insecticide use, but only when temperatures were also relatively warm. Whitefly outbreaks in hotter conditions were not associated with specific active ingredients used to suppress whiteflies, which would be consistent with a regional disruption of biocontrol following sprays for other pests. In addition, peak whitefly detections occurred earlier in areas with more vegetable production, but later with more cotton production, consistent with whiteflies moving among crops. CONCLUSION: Altogether, our findings suggest possible links between warmer temperatures, more abundant pests, and frequent insecticide applications disrupting biological control, though this remains to be explicitly demonstrated. Climate-initiated pesticide treadmills of this type may become an increasingly common driver of emerging pest outbreaks as global change accelerates. © 2023 Society of Chemical Industry.

Organophosphorus poisoning induced delayed neurotoxicity: a report of two cases.

INTRODUCTION: Organophosphorus compounds (OPC) are one of the most commonly used pesticides worldwide and are often misused for suicidal poisoning due to their easy availability. Acute manifestations and management of organophosphorus (OP) poisoning have been reported several times. Organophosphorus-induced delayed neurotoxicity (OPIDN) is a rare delayed presentation of OP poisoning that involves central-peripheral distal axonopathy. CASE PRESENTATION: In this study, we report two cases of OPIDN developed after a few weeks of OP poisoning. Clinical features, electrodiagnostic study findings, and rehabilitative measures adopted for the patients and their follow-up have been described in the report. DISCUSSION: Organophosphorus (OP) poisoning may rarely produce features of delayed neurotoxicity, which may gradually appear after acute cholinergic symptoms. This report shows the importance of considering the delayed presentation of possible OPC toxicity in patients with neurological symptoms and a history of OPC exposure.

Biology, distribution, and management of invasive South American tomato leafminer, Tuta absoluta (Meyrick) (Lepidoptera; Gelechiidae), in Asia.

South American tomato leafminer, Tuta absoluta (Meyrick, 1917) (Lepidoptera: Gelechiidae), is native to South America, but is a major invasive and quarantine pest species in Europe, Africa, and Asia. It causes extensive damage of up to 100% yield loss in tomatoes (Solanum lycopersicum) in open and greenhouse conditions. Since its first invasion in Spain in 2006, it has spread rapidly into many countries in the Mediterranean and Western Europe and further invaded Africa and Asia. In Asia, it was first recorded in August 2009 in Turkey and spread to most South and East Asian countries. In this study, we reviewed existing work on the biology and distribution of T. absoluta in Asia, as well as the damage it causes. This review will help to develop efficient management tactics as well as establish quarantine and phytosanitary precautions in uninvaded countries.

Post-Application Field Persistence and Efficacy of Cordyceps javanica against Bemisia tabaci.

Previously, Cordyceps javanica Wf GA17, a causing agent of whitefly epizootics in southern Georgia, demonstrated superior temperature tolerance and higher virulence against the whitefly Bemisia tabaci than commercial strains in the laboratory. The post-application persistence and efficacy of this fungus against B. tabaci were compared with that of the commercially available C. javanica Apopka97 strain over a two-year field study in cotton and vegetable crops. When blastospores of both strains were applied alone, whitefly populations were not effectively suppressed. Thus, JMS stylet oil was added to fungal treatments for enhancing efficacy and persistence. For 0-day samples, all fungal treatments caused similar but significant levels of immature mortality regardless of fungal strain, propagule form (conidia vs. blastospores), and application method (alone or mixed with JMS). In follow-up samplings, Wf GA17 blastospores + JMS achieved higher control levels than other treatments in some trials, but the efficacy did not last long. The JMS oil alone caused significant mortality and suppressed whiteflies. Over 90% of spores lost viability 24 h after treatment in all fungal treatments. Across evaluation times, there was no difference between the two fungal strains (conidia or blastospores, alone or combined with JMS), but conidia persisted better than blastospores for both strains. Overall, the field persistence and efficacy of C. javanica did not last long; therefore, improved delivery methods and formulations are needed for enhancement.

Control efficacy of azadirachtin on the fall armyworm, Spodoptera frugiperda (J. E. Smith) by soil drenching.

The fall armyworm (FAW), Spodoptera frugiperda, is an important agricultural pest species native to the Western Hemisphere and has recently invaded to Africa and Asia. Owing to the development of pesticide resistance and environmental contamination, ecofriendly pesticides are desirable for FAW control. Azadirachtin is a plant-derived natural pesticide with low toxicity to humans and the natural environment. Azadirachtin is primarily applied by foliar spraying; however, this approach lowers the efficacy of controlling target insects owing to photodegradation and might give a harmful effect on nontarget beneficial insects. Thus, we investigated whether applying azadirachtin to soil improves FAW control and its toxicity to corn plants. Soil drainage of azadirachtin exhibited no phytotoxic effects on corn plants but significantly reduced the larval body weight and delayed the developmental period of each larval instar of FAW. Applying 10, 15, and 20 ppm azadirachtin to soil inhibited larval growth by 68%, 76%, and 91%, respectively. Furthermore, the survival rate of FAW gradually decreased when larvae were fed azadirachtin-treated corn leaves. Collectively, this is the first study suggesting the systemic efficacy of azadirachtin by soil drenching against FAW.

Comparison of clinical outcome, cartilage turnover, and inflammatory activity following either intra-articular or a combination of intra-articular with intra-osseous platelet-rich plasma injections in osteoarthritis knee: A randomized, clinical trial.

BACKGROUND: The objective of the study was to determine the changes in clinical outcome (pain and knee activity) and assess bone/ cartilage biomarkers and inflammatory activity in persons with osteoarthritis (OA) knee following a single injection of intra-articular platelet-rich plasma (IA-PRP) and combination of intra-articular, intraosseous PRP (IA+IO-PRP). METHODS: This prospective, randomized, single-blind clinical trial was conducted at a tertiary care teaching hospital in India. Ninety-six persons with OA knee with a Kellgren-Lawrence score of 3 were randomized into three groups- Group-I (IA-PRP), Group-II (IA+IO-PRP)], Group-III, [intra-articular normal saline (IA-NS)]. The primary outcome was a visual analog scale (VAS) for pain. The secondary outcomes were the Knee Injury and Osteoarthritis Outcome Score (KOOS), erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), bone/ cartilage turnover biomarkers [C-telopeptide (CTX-II), N-telopeptide (NTX-I), cartilage oligomeric matrix protein (COMP), N-terminal propeptide of collagen type-IIA (PIIANP), and hyaluronic acid (HA)], ultrasonography (USG) findings of the knee joint. The outcome measures were assessed at baseline, 6, and 12 weeks of follow-up. RESULTS: Compared to IA-NS injection, IA-PRP and IA+IO-PRP injections significantly improved VAS-pain and KOOS scores at 6 and 12 weeks. Furthermore, both PRP groups showed a significant reduction in ESR, CRP, and CTX-II at 12 weeks following PRP injections. In addition, at 12 weeks, the IA+IO-PRP group showed a significant reduction (p=0.009) in NTX-I level. Persons in the IA+IO-PRP group reported significant reductions in the synovial-effusion and infra-patellar bursitis. CONCLUSIONS: Significant clinical improvements were noticed following IA-PRP and IA-IO-PRP injections compared to IA-NS injections. Both PRP groups reported a significant reduction in ESR, CRP, and CTX-II levels at 12 weeks. Persons in the IA+IO-PRP group reported significant changes in u-NTX-I level and knee-USG findings.

Platelet-rich Plasma in the Treatment of Recurrent Flexor Tenosynovitis of Wrist Complicated with Carpal Tunnel Syndrome in a Patient with Type 2 Diabetes Mellitus: A Case Report.

Introduction: Hand disorders are common manifestations in persons with diabetes mellitus. Flexor tenosynovitis (FTS) of the wrist is a relatively less common occurrence when compared with FTS of the finger. In the presence of uncontrolled diabetes, recurrence is not uncommon, and management may become difficult. There is no mention in the literature about the management of FTS in the wrist, especially in recurrent cases. Case Presentation: A 38-year-old lady presented with pain and swelling over the volar aspect of the wrist associated with weakness of the grasp. In addition, she reported tingling and a current-like sensation in the radial three and a half digits. Routine laboratory investigations and plain radiographs of the wrist and hand revealed no abnormalities. An ultrasound (USG) scan of the carpal tunnel showed thickening of the flexor tendons, surrounding hypo- to anechoic areas with enhanced color Doppler signal. In addition, there was associated thickening of the median nerve compared to the healthy side. She reported recurrence of the symptoms despite several trials of conservative management and one injection of local corticosteroid. We planned a single injection of platelet-rich plasma (PRP) under direct USG visualization in an in-plane and short-axis view. There was a significant improvement in both pain and function scores up to a 3-month follow-up. Conclusion: FTS of the wrist is a less commonly reported entity that can be missed with clinical examination only. A USG scan can help in the detection of this condition whenever the diagnosis is uncertain. In patients with uncontrolled diabetes, PRP injection appears to be a safe and appropriate treatment option that can improve pain and function scores in the moderate term.

Isolated neurocysticercosis of the spine presenting with low back pain and cauda equina syndrome: a case report.

INTRODUCTION: Cysticercosis, caused by Cysticercus cellulosae, is one of the common parasitic diseases that can affect the central nervous system (neurocysticercosis, NCC). Isolated involvement of cysticercosis of the spine, without the involvement of the brain, has been very rarely reported. CASE PRESENTATION: This report presented a case, who was presenting with low back pain with radiation and cauda equina syndrome (CES). On MRI, the patient was found to have a subarachnoid cystic lesion at the level of lumbosacral vertebrae. Under neurosurgery, the patient underwent L5/S1 laminectomy, decompression, and excision of the cyst. On histopathological examination, the patient was diagnosed of having Cysticercosis. Immediately after surgery, the patient had neurological deterioration. However, at the end of 1 year, the patient had significant improvement both neurologically and functionally. DISCUSSION: Spinal NCC should be considered in the differential diagnosis for a patient, who presents with a cystic lesion in the spinal subarachnoid space. Surgical exploration and excision of the cysts should be conducted not only to establish the diagnosis but also to decompress the cord and peripheral nerves.

Tamoxifen in Mastalgia: A Meta-Analysis.

OBJECTIVES: Tamoxifen is prescribed for chronic mastalgia at a dosage of one 10- or 20-mg tablet for 3-6 months. A topical preparation of this drug has recently been approved. The aim of this study was to meta-analyze the effectiveness of tamoxifen and its different regimens for the treatment of mastalgia. We also sought to summarize the side effects and the follow-up results of these treatments. DATA SOURCES: We searched the databases of PubMed/ MEDLINE, Central, Embase, and EBSCO from August 2021 to September 2021. STUDY SELECTION: Articles on the effects of tamoxifen in mastalgia were searched, and randomized controlled trials were retrieved for inclusion in this study. PRISMA guidelines were followed, and we selected 9 articles for the meta-analysis. DATA EXTRACTION AND SYNTHESIS: A proforma was prepared for data collection. RevMan 5.4 software was used for methodological quality assessment, statistical analysis, and preparation of forest plots. Oral tamoxifen performed better than placebo (risk ratio [RR] 2.04; 95% CI 1.49-2.78, P < 0.001). No significant difference in efficacy was seen between the 10- and 20-mg dosages (RR 1.08; 95% CI 0.97-1.21, P = 0.18) when used for 3 months. CONCLUSION: Oral tamoxifen is helpful in long-standing mastalgia. It is safe and effective at an oral dose of 10 mg.

Platelet-rich plasma injection in the treatment of patellar tendinopathy: a systematic review and meta-analysis.

PURPOSE: The objective of the study was to assess the efficacy of autologous platelet-rich plasma (PRP) injections in the treatment of patellar tendinopathy. METHODS: The PubMed, MEDLINE, EMBASE, CINAHL, and Cochrane Central Register of Controlled Trials databases were searched for clinical trials which compared PRP injection with other 'active treatment' interventions ('Non-PRP' injection and 'No-injection' treatments) or 'No-active treatment' interventions. Randomized and non-randomized clinical trials that had been published up to 15 November 2021, were included in the meta-analysis. The primary outcome, pain relief, was measured on a 'visual analog scale.' Secondary outcomes were knee functional activities and quality of life (QoL). The PRISMA guidelines were followed throughout the study. RESULTS: Eight comparative studies were identified for inclusion in the meta-analysis. Assessment of these studies revealed that there were no significant differences in pain relief, functional outcomes, and QoL in the short, medium, and long term between PRP injection and Non-PRP injection interventions. Similarly, comparison of PRP injection to the No-active treatment intervention showed no differences in short- and medium-term pain relief. However, when PRP injection was compared to the No-injection treatment intervention extracorporeal shock wave therapy (ECWT), the former was found to be more effective in terms of pain relief in the medium term (mean difference [MD] - 1.50; 95% confidence interval [CI] - 2.72 to - 0.28) and long term (MD - 1.70; 95% CI, - 2.90 to - 0.50) and functional outcomes in the medium term (MD 13.0; 95% CI 3.01-22.99) and long term (MD 13.70; 95% CI 4.62-22.78). CONCLUSIONS: In terms of pain relief and functional outcomes, the PRP injection did not provide significantly greater clinical benefit than Non-PRP injections in the treatment of patellar tendinopathy. However, in comparison with ESWT, there was a significant benefit in favor of PRP injection.

Neuropathic Pain in Hospitalized Patients With COVID-19: A Prospective Case Series.

Objective: To report the demographic and clinical characteristics of 8 patients hospitalized with COVID-19 and presenting with neuropathic pain (NeuP). Design: A prospective case series with 1-month follow-up. Settings: COVID-19-dedicated wards of a tertiary care center. Participants: We included 8 consecutive cases of laboratory-confirmed cases of COVID-19 (by reverse transcription polymerase chain reaction) who presented with NeuP during the course of their acute hospitalization (N=8). Interventions: Not applicable. Main Outcome Measures: A verbal rating scale was used to assess NeuP severity at presentation and at 1-month follow-up. The Douleur Neuropathique 4 questionnaire was used to diagnose NeuP at presentation. Results: Most patients were diagnosed as moderate to severe COVID-19 (6/8) and presented with mild to moderate NeuP (6/8). A substantial proportion of patients (4/8) displayed persistence of mild pain symptoms at 1-month follow-up. Furthermore, participants displayed a favorable response to gabapentinoids with or without antidepressants. Conclusion: NeuP is a less commonly encountered symptom of COVID-19, but its early diagnosis and prompt management are of utmost importance. More studies including a larger cohort and longer follow-up are recommended for better understanding of COVID-19-associated NeuP.

A Case of Chronic Deep Infrapatellar Bursitis Complicated by Patellar Tendinopathy and its Evaluation With Musculoskeletal Ultrasound.

Knee pain is a very common complaint in routine physiatry and orthopedic practice. While bursitis is a well-known and common cause of knee pain, deep infrapatellar bursa (DIPB) involvement is relatively less common. Inflammation of DIPB occurs commonly due to either direct trauma or overuse, but other rare causes have also been reported in the literature including infection, juvenile idiopathic arthritis, gout, and juvenile ankylosing spondylitis. We report a case of chronic inflammation of DIPB caused by direct trauma and associated with patellar tendinopathy. Additionally, we describe the characteristic findings on musculoskeletal ultrasonography (MSK-USG). For ultrasound evaluation, the patient should lie supine with the knee slightly flexed. Deep infrapatellar bursitis can be seen as an anechoic fluid-filled structure immediately posterior to the distal patellar tendon and anterior to the tibial tuberosity. While MRI can confirm the diagnosis of bursitis, MSK-USG can be quick, highly sensitive, and is able to confirm the diagnosis as well as to detect dynamic changes in the patellar tendon and adjacent structures. USG can also help in the treatment by guiding corticosteroid injection into the bursa. Activity modification and eccentric exercises play an important role in the rehabilitation program in these cases.

Respiratory rehabilitation in patients recovering from severe acute respiratory syndrome: A systematic review and meta-analysis.

BACKGROUND: With an increase in published reports on respiratory rehabilitation (RR) in severe acute respiratory syndrome (SARS), there is a need for a meta-analysis and systematic review to measure the effects of the RR in SARS. OBJECTIVE: Objective of the review was to evaluate the efficacy and safety of RR in patients recovering from SARS. METHODS: PubMed/ MEDLINE, CENTRAL, EMBASE, and Clinical Trial Registries were systematically searched (between January 1, 2003, to July 31, 2021) to identify all patients who received RR, at least for six days, following SARS. The primary outcome was exercise capacity [6-meter walking distance (6-MWD)], and secondary outcomes were change in pulmonary function test (PFT) parameters, activities in daily livings (ADLs), and quality of life (QoL). Meta-analysis was performed by using RevMan 5.4. RESULTS: Twenty-one observational studies, including eight comparative studies, were included. Eight comparative studies participated in quantitative meta-analysis. The intervention group, who received RR, improved significantly in exercise capacity (6-MWD) [mean difference (MD):45.79, (95% CI:31.66-59.92)] and PFT parameters, especially in forced vital capacity (FVC%) [MD:4.38, (95% CI:0.15-8.60)], and diffusion lung capacity for carbon monoxide (DLCO%) [MD:11.78, (95% CI:5.10-18.46)]. The intervention group failed to demonstrate significant improvement in ADLs and QoL outcomes. No significant adverse events were reported during the intervention. CONCLUSION: Respiratory rehabilitation can improve exercise capacity and PFT parameters in patients recovering from SARS infection. The RR does not cause serious adverse events. Clinical trials to determine the best RR program (in terms of initiation, duration, and components) in SARS and its treatment efficacy, both in the short and long- term are needed.

Single intra-articular injection with or without intra-osseous injections of platelet-rich plasma in the treatment of osteoarthritis knee: A single-blind, randomized clinical trial.

BACKGROUND: Subchondral bony structure damage plays an essential role in the pathogenesis of osteoarthritis (OA) knee. An intra-articular injection cannot reach the damaged subchondral bony structure and treat its pathologies effectively. The objective of the study was to compare the clinical effects of single intra-articular injection with or without intra-osseous injections of PRP in the treatment of osteoarthritis (OA) knee. METHODS: This was a single-blind, parallel-group, randomized clinical trial. Fifty patients, with OA knee (K&L grade III), with ages between 50 and 65 years, were randomly allocated into 'intra-osseous, intra-articular PRP' ('IO+IA-PRP') (n = 25) or 'intra-articular PRP' group ('IA-PRP') (n = 25). Patients in the 'IO+IA-PRP' group received 18 ml PRP injection, and the 'IA-PRP' group received 8 ml PRP injection. Intra-osseous injections were given at the tibial plateau (5 ml) and femoral condyle (5 ml), along with intra-articular knee injection (8 ml), under fluoroscopic guidance. Outcomes were measured using VAS-pain, the knee injury and osteoarthritis outcome score (KOOS), and the treatment satisfaction scale. All patients (n = 50) were followed up till six months. RESULTS: The mean age was 57.12(4.27) years and 57.00(4.96) years in the 'IO+IA-PRP' and 'IA-PRP' groups. Both groups showed significant improvement in pain relief (VAS pain) and KOOS parameters: pain, symptoms, ADL function, sport and recreation function, and quality of life. Compared to the 'IA-PRP' group, the 'IO+IA-PRP' group showed a greater reduction of VAS pain at six months. However, no significant difference was obtained in VAS pain-relief between these two groups (p = 0.422) at six months. Similarly, at 6 months, in inter-group comparison, except 'sport and recreation function' (p < 0.05), no significant differences were obtained in mean-scores of KOOS parameters: pain (p = 0.514); symptom (p = 0.148), ADL-function (p = 0.991), QoL-(p = 0.376). Patients in the 'IO+IA-PRP' group complained of significant 'injection-associated' adverse events and consumed a greater number of Acetaphenomen. CONCLUSIONS: Both groups showed significant improvement following the intervention. Intra-osseous PRP injections did not provide any additional benefit over intra-articular PRP injection until six months regarding pain relief and functional improvement.

Musculoskeletal and Neurological Pain Symptoms Among Hospitalized COVID-19 Patients.

OBJECTIVE: As the coronavirus disease 2019 pandemic continues to grow, its clinical manifestations are still emerging and are being widely investigated. However, the pain symptoms, including neurological and musculoskeletal pain symptoms, are still poorly understood. DESIGN: In this cross-sectional study, we investigated the prevalence of musculoskeletal and neurological pain symptoms among hospitalized coronavirus disease 2019 patients. Furthermore, the association of clinical and demographic factors with the prevalence of pain symptoms was also investigated. RESULT: We included 182 hospitalized coronavirus disease 2019 patients with a mean age of 48.86 ± 13.98 yrs. Pain symptoms were reported by 61.54% patients (n = 112). Most common symptoms reported were generalized myalgia (n = 60, 32.96%), headache (n = 50, 27.47%), and low back pain (n = 41, 22.53%). Interestingly, neuropathic pain was present in 14 participants (7.69%). Logistic regression analysis revealed an association of pain symptoms with coronavirus disease 2019 severity, male sex, higher body mass index, and a history of addiction. CONCLUSIONS: Pain symptoms are common manifestation of coronavirus disease 2019. Generalized myalgia, headache, and low back pain are the three most common new-onset pain symptoms in hospitalized coronavirus disease 2019 patients. Further investigation of pain symptoms and their predictive factors are recommended, which may guide healthcare workers and policymakers to plan in this direction. TO CLAIM CME CREDITS: Complete the self-assessment activity and evaluation online at http://www.physiatry.org/JournalCME. CME OBJECTIVES: Upon completion of this article, the reader should be able to: (1) Understand common musculoskeletal and neurological pain symptoms among hospitalized COVID-19 patients; (2) Understand the basic etiopathogenesis of COVID-19 associated pain; and (3) Identify factors associated with presence of COVID-19 pain symptoms. LEVEL: Advanced. ACCREDITATION: The Association of Academic Physiatrists is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians.The Association of Academic Physiatrists designates this Journal-based CME activity for a maximum of 1.0 AMA PRA Category 1 Credit(s)™. Physicians should only claim credit commensurate with the extent of their participation in the activity.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Arizona and Southern Desert Regions of California.

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

Can platelet-rich plasma injections provide better pain relief and functional outcomes in persons with common shoulder diseases: a meta-analysis of randomized controlled trials.

BACKGROUND: To evaluate the efficacy of autologous platelet-rich plasma (PRP) injections in the treatment of common shoulder diseases. METHODS: The PubMed, Medline, and Central databases and trial registries were searched from their inception to October 2020 for randomized controlled trials of autologous PRP injections for shoulder diseases versus placebo or any control intervention. Preferred reporting items for systematic reviews and meta-analyses (PRISMA) guidelines were followed in the selection, analysis, and reporting of findings. The primary outcome was pain intensity (visual analog scale), and secondary outcomes were changes in function and quality of life (QoL). RESULTS: A total of 17 randomized controlled trials of PRP versus control were analyzed. From 8-12 weeks to ≥1 year, PRP injections were associated with better pain relief and functional outcomes than control interventions. PRP injections were also associated with greater QoL, with an effect size of 2.61 (95% confidence interval, 2.01-14.17) at medium-term follow-up. Compared with placebo and corticosteroid injections, PRP injections provided better pain relief and functional improvement. In subgroup analyses, trials in which PRP was prepared by the double centrifugation technique, the platelet concentration in the PRP was enriched ≥5 times, leucocyte-rich PRP was used, or an activating agent was used before application reported the most effective pain relief at 6-7 months. CONCLUSIONS: PRP injections could provide better pain relief and functional outcomes than other treatments for persons presenting with common shoulder diseases. PRP injections have a greater capacity to improve shoulder-related QoL than other interventions.

Type 2 diabetes mellitus, physical activity, and neuromusculoskeletal complications.

Objectives: The objectives of the study were to investigate the neuromusculoskeletal complications of Type 2 diabetes mellitus (T2DM) and their associated factors, including the level of physical activity (PA) and clinicodemographic characteristics. Materials and Methods: In this cross-sectional analysis, we included 370 participants diagnosed with T2DM for no <1 year who satisfied the inclusion and exclusion criteria. Demographic and clinical characteristics were noted and a thorough clinical examination was performed on all the participants. International PA Questionnaire-Short Form was used to evaluate the level of PA of the participants. The continuous data is presented as mean ± SD and the categorical data is presented as the number of participants (n) and percentage (%). A logistic regression model was used to investigate the predictors for the prevalence of the complications. Results: The mean duration of T2DM was 7.32 ± 5.53 years and the mean hemoglobin A1C (HbA1c) level (%) was 8.16±1.67. A majority of the participants were having uncontrolled diabetes with an HbA1c level ≥7.5% (n = 190; 51.35%). The level of PA was low in a substantial proportion of the participants (n = 276; 74.59%). A total of 162 (43.78%) participants were diagnosed with neuromusculoskeletal complications. Low back pain was the most common complication and degenerative disk disease was the most common diagnosis overall. Longer duration of diabetes, poor glycemic control, and low PA were associated with the prevalence of neuromusculoskeletal complications (P < 0.05). Conclusion: Neuromusculoskeletal complications of T2DM are common and can result in significant disability in this population. Low PA is very common among T2DM patients and an important contributor to the development of complications. Health-care providers should consider PA an integral component of the management protocol for T2DM patients.