Research Note: Association of single nucleotide polymorphism of AKT3 with egg production traits in White Muscovy ducks (Cairina moschata).

Prior studies on transcriptomes of hypothalamus and ovary revealed that AKT3 is one of the candidate genes that might affect egg production in White Muscovy ducks. The role of AKT3 in the uterus during reproductive processes cannot be overemphasized. However, functional role of this gene in the tissues and on egg production traits of Muscovy ducks remains unknown. To identify the relationship between AKT3 and egg production traits in ducks, relative expression profile was first examined prior to identifying the variants within AKT3 that may underscore egg production traits [age at first egg (AFE), number of eggs at 300 d (N300D), and number of eggs at 59 wk (N59W)] in 549 ducks. The mRNA expression of AKT3 gene in high producing (HP) ducks was significantly higher than low producing (LP) ducks in the ovary, oviduct, and hypothalamus (P < 0.05 or 0.001). Three variants in AKT3 (C-3631A, C-3766T, and C-3953T) and high linkage block between C-3766T and C-3953T which are significantly (P < 0.05) associated with N300D and N59W were discovered. This study elucidates novel knowledge on the molecular mechanism of AKT3 that might be regulating egg production traits in Muscovy ducks.

Genetic characterization and genome-wide association mapping for stem rust resistance in spring bread wheat.

BACKGROUND: Emerging wheat stem rust races have become a major threat to global wheat production. Finding additional loci responsible for resistance to these races and incorporating them into currently cultivated varieties is the most economic and environmentally sound strategy to combat this problem. Thus, this study was aimed at characterizing the genetic diversity and identifying the genetic loci conferring resistance to the stem rust of wheat. To accomplish this, 245 elite lines introduced from the International Center for Agricultural Research in the Dry Areas (ICARDA) were evaluated under natural stem rust pressure in the field at the Debre Zeit Agricultural Research Center, Ethiopia. The single nucleotide polymorphisms (SNP) marker data was retrieved from a 15 K SNP wheat array. A mixed linear model was used to investigate the association between SNP markers and the best linear unbiased prediction (BLUP) values of the stem rust coefficient of infection (CI). RESULTS: Phenotypic analysis revealed that 46% of the lines had a coefficient of infection (CI) in a range of 0 to 19. Genome-wide average values of 0.38, 0.20, and 0.71 were recorded for Nei's gene diversity, polymorphism information content, and major allele frequency, respectively. A total of 46 marker-trait associations (MTAs) encompassed within eleven quantitative trait loci (QTL) were detected on chromosomes 1B, 3A, 3B, 4A, 4B, and 5A for CI. Two major QTLs with -log10 (p) ≥ 4 (EWYP1B.1 and EWYP1B.2) were discovered on chromosome 1B. CONCLUSIONS: This study identified several novel markers associated with stem rust resistance in wheat with the potential to facilitate durable rust resistance development through marker-assisted selection. It is recommended that the resistant wheat genotypes identified in this study be used in the national wheat breeding programs to improve stem rust resistance.

Nutritional Profile of the Ethiopian Oilseed Crop Noug (Guizotia abyssinica Cass.): Opportunities for Its Improvement as a Source for Human Nutrition.

The aim of this study was to evaluate the potential of noug as a source for human nutrition. Diverse noug genotypes were evaluated for their content and/or composition of total lipids, fatty acids, proteins, and minerals using standard methods. The total lipid content (32.5-45.7%) and the proportion of an essential fatty acid, linoleic acid (72.2-77.8%), were high in noug, compared to other oilseed crops. The proportion of oleic acid, a monounsaturated fatty acid, was low in noug (5.2-9.2%). The breeding objective of increasing the oleic acid level in the highland, where noug is mainly cultivated, was limited, as the content of this acid was low in this environment. The seed protein concentration (25.4-27.5%) and mineral content were mainly affected by the cultivation environment, as the high temperature increased the amount of protein, whereas the soil condition was a major factor in the variation of the mineral content. Thus, noug is a unique crop with a high seed oil content, of which a high proportion is linoleic acid. With the exception of the seed oleic acid content, when grown in low-altitude areas, the genotypic variation contributes less than the cultivation environment to the nutritional attributes of noug. Hence, high-oleic-acid noug for lowland production can be targeted as a breeding goal.

Hypothalamic and ovarian transcriptome profiling reveals potential candidate genes in low and high egg production of white Muscovy ducks (Cairina moschata).

In China, the low egg production rate is a major challenge to Muscovy duck farmers. Hypothalamus and ovary play essential role in egg production of birds. However, there are little or no reports from these tissues to identify potential candidate genes responsible for egg production in White Muscovy ducks. A total of 1,537 laying ducks were raised; the egg production traits which include age at first egg (days), number of eggs at 300 d, and number of eggs at 59 wk were recorded. Moreover, 4 lowest (LP) and 4 highest producing (HP) were selected at 59 wk of age, respectively. To understand the mechanism of egg laying regulation, we sequenced the hypothalamus and ovary transcriptome profiles in LP and HP using RNA-Seq. The results showed that the number of eggs at 300 d and number of eggs at 59 wk in the HP were significantly more (P < 0.001) than the LP ducks. In total, 106.98G clean bases were generated from 16 libraries with an average of 6.68G clean bases for each library. Further analysis showed 569 and 2,259 differentially expressed genes (DEGs) were identified in the hypothalamus and ovary between LP and HP, respectively. The KEGG pathway enrichment analysis revealed 114 and 139 pathways in the hypothalamus and ovary, respectively which includes Calcium signaling pathway, ECM-receptor interaction, Focal adhesion, MAPK signaling pathway, Apoptosis and Apelin signaling pathways that are involved in egg production. Based on the GO terms and KEGG pathways results, 10 potential candidate genes (P2RX1, LPAR2, ADORA1, FN1, AKT3, ADCY5, ADCY8, MAP3K8, PXN, and PTTG1) were identified to be responsible for egg production. Further, protein-protein interaction was analyzed to show the relationship between these candidate genes. Therefore, this study provides useful information on transcriptome of hypothalamus and ovary of LP and HP Muscovy ducks.

Evidence of the interplay of genetics and culture in Ethiopia.

The rich linguistic, ethnic and cultural diversity of Ethiopia provides an unprecedented opportunity to understand the level to which cultural factors correlate with-and shape-genetic structure in human populations. Using primarily new genetic variation data covering 1,214 Ethiopians representing 68 different ethnic groups, together with information on individuals' birthplaces, linguistic/religious practices and 31 cultural practices, we disentangle the effects of geographic distance, elevation, and social factors on the genetic structure of Ethiopians today. We provide evidence of associations between social behaviours and genetic differences among present-day peoples. We show that genetic similarity is broadly associated with linguistic affiliation, but also identify pronounced genetic similarity among groups from disparate language classifications that may in part be attributable to recent intermixing. We also illustrate how groups reporting the same culture traits are more genetically similar on average and show evidence of recent intermixing, suggesting that shared cultural traits may promote admixture. In addition to providing insights into the genetic structure and history of Ethiopia, we identify the most important cultural and geographic predictors of genetic differentiation and provide a resource for designing sampling protocols for future genetic studies involving Ethiopians.

New Transcriptome-Based SNP Markers for Noug (Guizotia abyssinica) and Their Conversion to KASP Markers for Population Genetics Analyses.

The development and use of genomic resources are essential for understanding the population genetics of crops for their efficient conservation and enhancement. Noug (Guizotia abyssinica) is an economically important oilseed crop in Ethiopia and India. The present study sought to develop new DNA markers for this crop. Transcriptome sequencing was conducted on two genotypes and 628 transcript sequences containing 959 single nucleotide polymorphisms (SNPs) were developed. A competitive allele-specific PCR (KASP) assay was developed for the SNPs and used for genotyping of 24 accessions. A total of 554 loci were successfully genotyped across the accessions, and 202 polymorphic loci were used for population genetics analyses. Polymorphism information content (PIC) of the loci varied from 0.01 to 0.37 with a mean of 0.24, and about 49% of the loci showed significant deviation from the Hardy-Weinberg equilibrium. The mean expected heterozygosity was 0.27 suggesting moderately high genetic variation within accessions. Low but significant differentiation existed among accessions (FST = 0.045, p < 0.0001). Landrace populations from isolated areas may have useful mutations and should be conserved and used in breeding this crop. The genomic resources developed in this study were shown to be useful for population genetics research and can also be used in, e.g., association genetics.

gga-mir-133a-3p Regulates Myoblasts Proliferation and Differentiation by Targeting PRRX1.

Non-coding RNAs play a regulatory role in the growth and development of skeletal muscle. Our previous study suggested that gga-mir-133a-3p was a potential candidate for regulating myoblast proliferation and differentiation in skeletal muscle. The purpose of our study was to reveal the regulatory mechanism of gga-mir-133a-3p in the proliferation and differentiation of chicken myoblasts. Through the detection of cell proliferation activity, cell cycle progression and EdU, we found that gga-mir-133a-3p can significantly inhibit the proliferation of myoblasts. In the process of myogenic differentiation, gga-mir-133a-3p is up-regulated, while gga-mir-133a-3p can significantly promote the up-regulation of differentiation-related muscle-derived factors, indicating that gga-mir-133a-3p can promote the differentiation of myoblasts. Validation at the transcriptional level and protein level proved that gga-mir-133a-3p can inhibit the expression of PRRX1, and the dual-luciferase assay also showed their direct targeting relationship. Correspondingly, PRRX1 can significantly promote myoblast proliferation and inhibit myoblast differentiation. In our study, we confirmed that gga-mir-133a-3p participates in the regulation of proliferation and differentiation of myoblasts by targeting PRRX1.

Genetic diversity analysis of cultivated Korarima [Aframomum corrorima (Braun) P.C.M. Jansen] populations from southwestern Ethiopia using inter simple sequence repeats (ISSR) marker.

BACKGROUND: Korarima (Aframomum corrorima) is a perennial and aromatic herb native and widely distributed in southwestern Ethiopia. It is known for its fine flavor as a spice in various Ethiopian traditional dishes. Few molecular studies have been performed on this species so far. In the present paper, the ISSR technique was employed to study the genetic diversity in populations of cultivated A. corrorima. RESULTS: Seven ISSR primers produced a total of 86 clearly scorable DNA bands. High levels of genetic diversity were detected in cultivated A. corrorima (percentage of polymorphic bands = 97.67%, gene diversity = 0.35, Shannon's information index = 0.52). Analysis of molecular variance (AMOVA) showed that 27.47% of the variation is attributed to the variation among populations and 72.53% to the variation within populations. The Fst (0.28) value showed a significant (p < 0.0001) genetic differentiation among populations. This was supported by the high coefficient of gene differentiation (Gst = 0.32) and low estimated gene flow (Nm = 1.08). A neighbor-joining dendrogram showed that the thirteen cultivated populations were separated into three clusters, which was in good accordance with the results provided by the two dimensional and three dimensional coordinate analyses. However, the clusters did not reveal clear pattern of populations clustering according to their geographic origin. This could be due to human mediated transfer of genetic material among different localities. CONCLUSION: The genetic diversity in populations of A. corrorima from the southwestern part of Ethiopia was relatively high. This finding should be taken into account when conservation actions, management policies for the species and site identification for in situ and ex situ conservation strategies are developed. Mizan Teferi II population displayed the highest genetic diversity; this population should be considered as the key site in designing conservation strategies for this crop. In addition, Jimma I and Jimma II populations with lowest genetic diversity, should also be considered due to the putative risk of extinction that they face because of the low genetic diversity.

An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB) in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1.

The human FMO2 (flavin-containing monooxygenase 2) gene has been shown to be involved in innate immunity against microbial infections, including tuberculosis (TB), via the modulation of oxidative stress levels. It has also been found to possess a curious loss-of-function mutation (FMO2*1/FMO2*2) that demonstrates a distinctive differentiation in expression, function and ethno-geographic distribution. However, despite evidences of ethnic-specific genetic associations in the inflammatory profile of TB, no studies were done to investigate whether these patterns of variations correlate with evidences for the involvement of FMO2 in antimicrobial immune responses and ethnic differences in the distribution of FMO2 polymorphisms except for some pharmacogenetic data that suggest a potentially deleterious role for the functional variant (FMO2*1). This genetic epidemiological study was designed to investigate whether there is an association between FMO2 polymorphisms and TB, an ancient malady that remains a modern global health concern, in a sub-Saharan Africa setting where there is not only a relatively high co-prevalence of the disease and the ancestral FMO2*1 variant but also where both Mycobcaterium and Homo sapiens are considered to have originated and co-evolved. Blood samples and TB related clinical data were collected from ascertained TB cases and unrelated household controls (n = 292) from 3 different ethnic groups in Ethiopia. Latent Mtb infection was determined using Quantiferon to develop reliable TB progression phenotypes. We sequenced exonic regions of FMO2.We identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A), p = 3.15E-07, OR = 4.644 and chr1:171165749(T), p = 3.32E-06, OR = 6.825] while multiple SNPs (22) showed nominal signals. The pattern of association suggested a protective effect of FMO2 against both active and latent TB with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC") explaining the overall association (haplotype-specific-p = 0.000103). Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496) but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations.

Genetic structure and relationships within and between cultivated and wild korarima [Aframomum corrorima (Braun) P.C.M. Jansen] in Ethiopia as revealed by simple sequence repeat (SSR) markers.

BACKGROUND: Korarima [Aframomum corrorima (Braun) P.C.M. Jansen] is a spice crop native to Ethiopia. Understanding the extent and partitioning of diversity within and among crop landraces and their wild relatives is among the first steps in conserving and measuring their genetic potential. The present study is aimed at characterizing the population genetic structure and relationships between cultivated and wild korarima in the southwestern part of Ethiopia. RESULTS: We analyzed a total of 195 individuals representing seven wild and fourteen cultivated populations. Eleven polymorphic simple sequence repeat (SSR) markers were used. We observed a total of 53 alleles across the eleven loci and individuals. In total, 32 alleles were detected in the cultivated populations, whereas 49 alleles were detected in the wild populations. We found higher genetic diversity in wild populations than in the cultivated counterpart. This result implies the potential of wild korarima as a possible source for novel alleles contributing to the improvement of cultivated korarima. Analysis of molecular variance (AMOVA) showed significant but low differentiation between cultivated and wild korarima populations. Similarly, neighbour-joining and STRUCTURE analyses did not group cultivated and wild populations into two distinct clusters. The lack of clear differentiation between cultivated and wild populations could be explained by historical and contemporary gene flow between the two gene pools. CONCLUSION: The 11 SSR loci developed in this study could be employed to examine genetic diversity and population structure of korarima in other countries as well as other Aframomum species. From the five administrative zones considered in this study, the Bench-Magi and Sheka zone showed populations with high genetic diversity, and these populations could be used as a potential starting point for in-situ and ex-situ germplasm conservation and korarima improvement through breeding programs after proper agronomic evaluation.

Mitochondrial and nuclear DNA reveals reticulate evolution in hares (Lepus spp., Lagomorpha, Mammalia) from Ethiopia.

For hares (Lepus spp., Leporidae, Lagomorpha, Mammalia) from Ethiopia no conclusive molecular phylogenetic data are available. To provide a first molecular phylogenetic model for the Abyssinian Hare (Lepus habessinicus), the Ethiopian Hare (L. fagani), and the Ethiopian Highland Hare (L. starcki) and their evolutionary relationships to hares from Africa, Eurasia, and North America, we phylogenetically analysed mitochondrial ATPase subunit 6 (ATP6; n = 153 / 416bp) and nuclear transferrin (TF; n = 155 / 434bp) sequences of phenotypically determined individuals. For the hares from Ethiopia, genotype composition at twelve microsatellite loci (n = 107) was used to explore both interspecific gene pool separation and levels of current hybridization, as has been observed in some other Lepus species. For phylogenetic analyses ATP6 and TF sequences of Lepus species from South and North Africa (L. capensis, L. saxatilis), the Anatolian peninsula and Europe (L. europaeus, L. timidus) were also produced and additional TF sequences of 18 Lepus species retrieved from GenBank were included as well. Median joining networks, neighbour joining, maximum likelihood analyses, as well as Bayesian inference resulted in similar models of evolution of the three species from Ethiopia for the ATP6 and TF sequences, respectively. The Ethiopian species are, however, not monophyletic, with signatures of contemporary uni- and bidirectional mitochondrial introgression and/ or shared ancestral polymorphism. Lepus habessinicus carries mtDNA distinct from South African L. capensis and North African L. capensis sensu lato; that finding is not in line with earlier suggestions of its conspecificity with L. capensis. Lepus starcki has mtDNA distinct from L. capensis and L. europaeus, which is not in line with earlier suggestions to include it either in L. capensis or L. europaeus. Lepus fagani shares mitochondrial haplotypes with the other two species from Ethiopia, despite its distinct phenotypic and microsatellite differences; moreover, it is not represented by a species-specific mitochondrial haplogroup, suggesting considerable mitochondrial capture by the other species from Ethiopia or species from other parts of Africa. Both mitochondrial and nuclear sequences indicate close phylogenetic relationships among all three Lepus species from Ethiopia, with L. fagani being surprisingly tightly connected to L. habessinicus. TF sequences suggest close evolutionary relationships between the three Ethiopian species and Cape hares from South and North Africa; they further suggest that hares from Ethiopia hold a position ancestral to many Eurasian and North American species.

Let-7b Regulates Myoblast Proliferation by Inhibiting IGF2BP3 Expression in Dwarf and Normal Chicken.

The sex-linked dwarf chicken is caused by the mutation of growth hormone receptor (GHR) gene and characterized by shorter shanks, lower body weight, smaller muscle fiber diameter and fewer muscle fiber number. However, the precise regulatory pathways that lead to the inhibition of skeletal muscle growth in dwarf chickens still remain unclear. Here we found a let-7b mediated pathway might play important role in the regulation of dwarf chicken skeletal muscle growth. Let-7b has higher expression in the skeletal muscle of dwarf chicken than in normal chicken, and the expression of insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3), which is a translational activator of IGF2, showed opposite expression trend to let-7b. In vitro cellular assays validated that let-7b directly inhibits IGF2BP3 expression through binding to its 3'UTR region, and the protein level but not mRNA level of IGF2 would be reduced in let-7b overexpressed chicken myoblast. Let-7b can inhibit cell proliferation and induce cell cycle arrest in chicken myoblast through let-7b-IGF2BP3-IGF2 signaling pathway. Additionally, let-7b can also regulate skeletal muscle growth through let-7b-GHR-GHR downstream genes pathway, but this pathway is non-existent in dwarf chicken because of the deletion mutation of GHR 3'UTR. Notably, as the loss binding site of GHR for let-7b, let-7b has enhanced its binding and inhibition on IGF2BP3 in dwarf myoblast, suggesting that the miRNA can balance its inhibiting effect through dynamic regulate its binding to target genes. Collectively, these results not only indicate that let-7b can inhibit skeletal muscle growth through let-7b-IGF2BP3-IGF2 signaling pathway, but also show that let-7b regulates myoblast proliferation by inhibiting IGF2BP3 expression in dwarf and normal chickens.

Contrasting exome constancy and regulatory region variation in the gene encoding CYP3A4: an examination of the extent and potential implications.

OBJECTIVE: CYP3A4 expression varies up to 100-fold among individuals, and, to date, genetic causes remain elusive. As a major drug-metabolizing enzyme, elucidation of such genetic causes would increase the potential for introducing personalized dose adjustment of therapies involving CYP3A4 drug substrates. The foetal CYP3A isoform, CYP3A7, is reported to be expressed in ∼10% of European adults and may thus contribute towards the metabolism of endogenous substances and CYP3A drug substrates. However, little is known about the distribution of the variant expressed in the adult. METHODS: We resequenced the exons, flanking introns, regulatory elements and 3'UTR of CYP3A4 in five Ethiopian populations and incorporated data from the 1000 Genomes Project. Using bioinformatic analysis, we assessed likely consequences of observed CYP3A4 genomic variation. We also conducted the first extensive geographic survey of alleles associated with adult expression of CYP3A7 - that is, CYP3A7*1B and CYP3A7*1C. RESULTS AND CONCLUSION: Ethiopia contained 60 CYP3A4 variants (26 novel) and more variants (>1%) than all non-African populations combined. No nonsynonymous mutation was found in the homozygous form or at more than 2.8% in any population. Seventy-nine per cent of haplotypes contained 3'UTR and/or regulatory region variation with striking pairwise population differentiation, highlighting the potential for interethnic variation in CYP3A4 expression. Conversely, coding region variation showed that significant interethnic variation is unlikely at the protein level. CYP3A7*1C was found at up to 17.5% in North African populations and in significant linkage disequilibrium with CYP3A5*3, indicating that adult expression of the foetal isoform is likely to be accompanied by reduced or null expression of CYP3A5.

Evidence for a Common Origin of Blacksmiths and Cultivators in the Ethiopian Ari within the Last 4500 Years: Lessons for Clustering-Based Inference.

The Ari peoples of Ethiopia are comprised of different occupational groups that can be distinguished genetically, with Ari Cultivators and the socially marginalised Ari Blacksmiths recently shown to have a similar level of genetic differentiation between them (FST ≈ 0.023 - 0.04) as that observed among multiple ethnic groups sampled throughout Ethiopia. Anthropologists have proposed two competing theories to explain the origins of the Ari Blacksmiths as (i) remnants of a population that inhabited Ethiopia prior to the arrival of agriculturists (e.g. Cultivators), or (ii) relatively recently related to the Cultivators but presently marginalized in the community due to their trade. Two recent studies by different groups analysed genome-wide DNA from samples of Ari Blacksmiths and Cultivators and suggested that genetic patterns between the two groups were more consistent with model (i) and subsequent assimilation of the indigenous peoples into the expanding agriculturalist community. We analysed the same samples using approaches designed to attenuate signals of genetic differentiation that are attributable to allelic drift within a population. By doing so, we provide evidence that the genetic differences between Ari Blacksmiths and Cultivators can be entirely explained by bottleneck effects consistent with hypothesis (ii). This finding serves as both a cautionary tale about interpreting results from unsupervised clustering algorithms, and suggests that social constructions are contributing directly to genetic differentiation over a relatively short time period among previously genetically similar groups.

Patterns of domestication in the Ethiopian oil-seed crop noug (Guizotia abyssinica).

Noug (Guizotia abyssinica) is a semidomesticated oil-seed crop, which is primarily cultivated in Ethiopia. Unlike its closest crop relative, sunflower, noug has small seeds, small flowering heads, many branches, many flowering heads, and indeterminate flowering, and it shatters in the field. Here, we conducted common garden studies and microsatellite analyses of genetic variation to test whether high levels of crop-wild gene flow and/or unfavorable phenotypic correlations have hindered noug domestication. With the exception of one population, analyses of microsatellite variation failed to detect substantial recent admixture between noug and its wild progenitor. Likewise, only very weak correlations were found between seed mass and the number or size of flowering heads. Thus, noug's 'atypical' domestication syndrome does not seem to be a consequence of recent introgression or unfavorable phenotypic correlations. Nonetheless, our data do reveal evidence of local adaptation of noug cultivars to different precipitation regimes, as well as high levels of phenotypic plasticity, which may permit reasonable yields under diverse environmental conditions. Why noug has not been fully domesticated remains a mystery, but perhaps early farmers selected for resilience to episodic drought or untended environments rather than larger seeds. Domestication may also have been slowed by noug's outcrossing mating system.

Diversity of lactase persistence in African milk drinkers.

The genetic trait of lactase persistence is attributable to allelic variants in an enhancer region upstream of the lactase gene, LCT. To date, five different functional alleles, -13910*T, -13907*G, -13915*G, -14009*G and -14010*C, have been identified. The co-occurrence of several of these alleles in Ethiopian lactose digesters leads to a pattern of sequence diversity characteristic of a 'soft selective sweep'. Here we hypothesise that throughout Africa, where multiple functional alleles co-exist, the enhancer diversity will be greater in groups who are traditional milk drinkers than in non-milk drinkers, as the result of this sort of parallel selection. Samples from 23 distinct groups from 10 different countries were examined. Each group was classified 'Yes 'or 'No' for milk-drinking, and ethnicity, language spoken and geographic location were recorded. Predicted lactase persistence frequency and enhancer diversity were, as hypothesised, higher in the milk drinkers than the non-milk-drinkers, but this was almost entirely accounted for by the Afro-Asiatic language speaking peoples of east Africa. The other groups, including the 'Nilo-Saharan language speaking' milk-drinkers, show lower frequencies of LP and lower diversity, and there was a north-east to south-west decline in overall diversity. Amongst the Afro-Asiatic (Cushitic) language speaking Oromo, however, the geographic cline was not evident and the southern pastoralist Borana showed much higher LP frequency and enhancer diversity than the other groups. Together these results reflect the effects of parallel selection, the stochastic processes of the occurrence and spread of the mutations, and time depth of milk drinking tradition.

Ethiopian population dermatoglyphic study reveals linguistic stratification of diversity.

The manifestation of ethnic, blood type, & gender-wise population variations regarding Dermatoglyphic manifestations are of interest to assess intra-group diversity and differentiation. The present study reports on the analysis of qualitaive and quantitative finger Dermatoglyphic traits of 382 individuals cross-sectionally sampled from an administrative region of Ethiopia, consisting of five ethnic cohorts from the Afro-Asiatic & Nilo-Saharan affiliations. These Dermatoglyphic parameters were then applied in the assessment of diversity & differentiation, including Heterozygosity, Fixation, Panmixia, Wahlund's variance, Nei's measure of genetic diversity, and thumb & finger pattern genotypes, which were inturn used in homology inferences as summarized by a Neighbour-Joining tree constructed from Nei's standard genetic distance. Results revealed significant correlation between Dermatoglyphics & population parameters that were further found to be in concordance with the historical accounts of the ethnic groups. Such inductions as the ancient north-eastern presence and subsequent admixure events of the Oromos (PII= 15.01), the high diversity of the Amharas (H= 0.1978, F= 0.6453, and P= 0.4144), and the Nilo-Saharan origin of the Berta group (PII= 10.66) are evidences to this. The study has further tested the possibility of applying Dermatoglyphics in population genetic & anthropologic research, highlighting on the prospect of developing a method to trace back population origins & ancient movement patterns. Additionally, linguistic clustering was deemed significant for the Ethiopian population, coinciding with recent genome wide studies that have ascertained that linguistic clustering as to being more crucial than the geographical patterning in the Ethiopian context. Finally, Dermatoglyphic markers have been proven to be endowed with a strong potential as non-invasive preliminary tools applicable prior to genetic studies to analyze ethnically sub-divided populations and also to reveal the stratification mechanism in play.

Tracing the route of modern humans out of Africa by using 225 human genome sequences from Ethiopians and Egyptians.

The predominantly African origin of all modern human populations is well established, but the route taken out of Africa is still unclear. Two alternative routes, via Egypt and Sinai or across the Bab el Mandeb strait into Arabia, have traditionally been proposed as feasible gateways in light of geographic, paleoclimatic, archaeological, and genetic evidence. Distinguishing among these alternatives has been difficult. We generated 225 whole-genome sequences (225 at 8× depth, of which 8 were increased to 30×; Illumina HiSeq 2000) from six modern Northeast African populations (100 Egyptians and five Ethiopian populations each represented by 25 individuals). West Eurasian components were masked out, and the remaining African haplotypes were compared with a panel of sub-Saharan African and non-African genomes. We showed that masked Northeast African haplotypes overall were more similar to non-African haplotypes and more frequently present outside Africa than were any sets of haplotypes derived from a West African population. Furthermore, the masked Egyptian haplotypes showed these properties more markedly than the masked Ethiopian haplotypes, pointing to Egypt as the more likely gateway in the exodus to the rest of the world. Using five Ethiopian and three Egyptian high-coverage masked genomes and the multiple sequentially Markovian coalescent (MSMC) approach, we estimated the genetic split times of Egyptians and Ethiopians from non-African populations at 55,000 and 65,000 years ago, respectively, whereas that of West Africans was estimated to be 75,000 years ago. Both the haplotype and MSMC analyses thus suggest a predominant northern route out of Africa via Egypt.

The African Genome Variation Project shapes medical genetics in Africa.

Given the importance of Africa to studies of human origins and disease susceptibility, detailed characterization of African genetic diversity is needed. The African Genome Variation Project provides a resource with which to design, implement and interpret genomic studies in sub-Saharan Africa and worldwide. The African Genome Variation Project represents dense genotypes from 1,481 individuals and whole-genome sequences from 320 individuals across sub-Saharan Africa. Using this resource, we find novel evidence of complex, regionally distinct hunter-gatherer and Eurasian admixture across sub-Saharan Africa. We identify new loci under selection, including loci related to malaria susceptibility and hypertension. We show that modern imputation panels (sets of reference genotypes from which unobserved or missing genotypes in study sets can be inferred) can identify association signals at highly differentiated loci across populations in sub-Saharan Africa. Using whole-genome sequencing, we demonstrate further improvements in imputation accuracy, strengthening the case for large-scale sequencing efforts of diverse African haplotypes. Finally, we present an efficient genotype array design capturing common genetic variation in Africa.

Molecular genetics research in sub-Saharan Africa: how can the international community help?

BACKGROUND: Opportunities provided by rapidly increasing access to educational resources, clinical and epidemiological data, DNA collections, cheaper technology and financial investment, suggest that researchers in sub-Saharan Africa outside South Africa (SSAOSA) could now join the genomics revolution on equal terms with those in the West. FINDINGS: Current evidence, however, suggests that, in some cases, various factors may be compromising this development. One interpretation is that urgent practical problems, which may compromise motivation, aspiration and ambition, are blocking opportunity. CONCLUSIONS: Those wishing to help should support the SSAOSA scientists both at the level of extending collaboration networks and in stimulating academic leadership at national and institutional levels to ensure adequate resources are allocated. Members of organisations representing the international community of human geneticists, such as HUGO, have a significant responsibility in supporting such activities.