Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 124
Filter
Add more filters











Publication year range
1.
Plant Cell Environ ; 2024 Oct 01.
Article in English | MEDLINE | ID: mdl-39351842

ABSTRACT

Adaptation to abiotic stress is critical for the survival of perennial tree species. Salinity affects plant growth and productivity by interfering with major biosynthetic processes. Detrimental effects of salinity may vary between different plant tissues and cell types. However, spatial molecular mechanisms controlling plant responses to salinity stress are not yet thoroughly understood in perennial trees. We used laser capture microdissection in clones of Populus tremula x alba to isolate palisade and vascular cells of intermediary leaf from plants exposed to 150 mM NaCl for 10 days, followed by a recovery period. Cell-specific changes in proteins and metabolites were determined. Salinity induced a vascular-specific accumulation of proteins associated with photorespiration, and the accumulation of serine, 3-phosphoglycerate and NH4 + suggesting changes in N metabolism. Accumulation of the GLUTAMINE SYNTHETASE 2 protein, and increased GS1.1 gene expression, indicated that NH4 + produced in photorespiration was assimilated to glutamine, the main amino acid translocated in Populus trees. Further analysis of total soluble proteins in stems and roots showed the accumulation of bark storage proteins induced by the salinity treatments. Collectively, our results suggest that the salt-induced photorespiration in vascular cells mediates N-reallocation in Populus, an essential process for the adaptation of trees to adverse conditions.

2.
Front Plant Sci ; 15: 1346853, 2024.
Article in English | MEDLINE | ID: mdl-38495374

ABSTRACT

The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue 'omics'-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar (Populus tremula× P. alba) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.

3.
Plant Biotechnol J ; 22(6): 1596-1609, 2024 Jun.
Article in English | MEDLINE | ID: mdl-38232002

ABSTRACT

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.


Subject(s)
Gene Expression Regulation, Plant , Plants, Genetically Modified , Populus , Promoter Regions, Genetic , Populus/genetics , Populus/metabolism , Promoter Regions, Genetic/genetics , Plants, Genetically Modified/genetics , Dehydration/genetics , Stress, Physiological/genetics , Organ Specificity/genetics , Plant Leaves/genetics , Plant Leaves/metabolism
4.
Cell Rep ; 42(10): 113208, 2023 10 31.
Article in English | MEDLINE | ID: mdl-37792531

ABSTRACT

Clathrin-mediated vesicular formation and trafficking are responsible for molecular cargo transport and signal transduction among organelles. Our previous study shows that CHLOROPLAST VESICULATION (CV)-containing vesicles (CVVs) are generated from chloroplasts for chloroplast degradation under abiotic stress. Here, we show that CV interacts with the clathrin heavy chain (CHC) and induces vesicle budding toward the cytosol from the chloroplast inner envelope membrane. In the defective mutants of CHC2 and the dynamin-encoding DRP1A, CVV budding and releasing from chloroplast are impeded. The mutations of CHC2 inhibit CV-induced chloroplast degradation and hypersensitivity to water stress. Moreover, CV-CHC2 interaction is impaired by the oxidized GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE (GAPC). GAPC1 overexpression suppresses CV-mediated chloroplast degradation and hypersensitivity to water stress, while CV silencing alleviates the hypersensitivity of the gapc1gapc2 plant to water stress. Together, our work identifies a pathway of clathrin-assisted CVV budding outward from chloroplast, which is involved in chloroplast degradation and stress response.


Subject(s)
Arabidopsis Proteins , Arabidopsis , Humans , Arabidopsis Proteins/genetics , Arabidopsis Proteins/metabolism , Arabidopsis/metabolism , Dehydration/metabolism , Chloroplasts/metabolism , Clathrin/metabolism , Endocytosis/physiology
5.
G3 (Bethesda) ; 14(1)2023 Dec 29.
Article in English | MEDLINE | ID: mdl-37883711

ABSTRACT

Perennial grasses are important forage crops and emerging biomass crops and have the potential to be more sustainable grain crops. However, most perennial grass crops are difficult experimental subjects due to their large size, difficult genetics, and/or their recalcitrance to transformation. Thus, a tractable model perennial grass could be used to rapidly make discoveries that can be translated to perennial grass crops. Brachypodium sylvaticum has the potential to serve as such a model because of its small size, rapid generation time, simple genetics, and transformability. Here, we provide a high-quality genome assembly and annotation for B. sylvaticum, an essential resource for a modern model system. In addition, we conducted transcriptomic studies under 4 abiotic stresses (water, heat, salt, and freezing). Our results indicate that crowns are more responsive to freezing than leaves which may help them overwinter. We observed extensive transcriptional responses with varying temporal dynamics to all abiotic stresses, including classic heat-responsive genes. These results can be used to form testable hypotheses about how perennial grasses respond to these stresses. Taken together, these results will allow B. sylvaticum to serve as a truly tractable perennial model system.


Subject(s)
Brachypodium , Humans , Brachypodium/genetics , Genome, Plant , Biomass , Transcriptome , Stress, Physiological/genetics
6.
Front Plant Sci ; 14: 1184020, 2023.
Article in English | MEDLINE | ID: mdl-37346131

ABSTRACT

Soybean is a globally important legume crop which is highly sensitive to drought. The identification of genes of particular relevance for drought responses provides an important basis to improve tolerance to environmental stress. Chloroplast Vesiculation (CV) genes have been characterized in Arabidopsis and rice as proteins participating in a specific chloroplast-degradation vesicular pathway (CVV) during natural or stress-induced leaf senescence. Soybean genome contains two paralogous genes encoding highly similar CV proteins, CV1 and CV2. In this study, we found that expression of CV1 was differentially upregulated by drought stress in soybean contrasting genotypes exhibiting slow-wilting (tolerant) or fast-wilting (sensitive) phenotypes. CV1 reached higher induction levels in fast-wilting plants, suggesting a negative correlation between CV1 gene expression and drought tolerance. In contrast, autophagy (ATG8) and ATI-PS (ATI1) genes were induced to higher levels in slow-wilting plants, supporting a pro-survival role for these genes in soybean drought tolerance responses. The biological function of soybean CVs in chloroplast degradation was confirmed by analyzing the effect of conditional overexpression of CV2-FLAG fusions on the accumulation of specific chloroplast proteins. Functional specificity of CV1 and CV2 genes was assessed by analyzing their specific promoter activities in transgenic Arabidopsis expressing GUS reporter gene driven by CV1 or CV2 promoters. CV1 promoter responded primarily to abiotic stimuli (hyperosmolarity, salinity and oxidative stress), while the promoter of CV2 was predominantly active during natural senescence. Both promoters were highly responsive to auxin but only CV1 responded to other stress-related hormones, such as ABA, salicylic acid and methyl jasmonate. Moreover, the dark-induced expression of CV2, but not of CV1, was strongly inhibited by cytokinin, indicating similarities in the regulation of CV2 to the reported expression of Arabidopsis and rice CV genes. Finally, we report the expression of both CV1 and CV2 genes in roots of soybean and transgenic Arabidopsis, suggesting a role for the encoded proteins in root plastids. Together, the results indicate differential roles for CV1 and CV2 in development and in responses to environmental stress, and point to CV1 as a potential target for gene editing to improve crop performance under stress without compromising natural development.

7.
J Integr Plant Biol ; 65(9): 2157-2174, 2023 Sep.
Article in English | MEDLINE | ID: mdl-37252889

ABSTRACT

Arabidopsis plastid antiporters KEA1 and KEA2 are critical for plastid development, photosynthetic efficiency, and plant development. Here, we show that KEA1 and KEA2 are involved in vacuolar protein trafficking. Genetic analyses found that the kea1 kea2 mutants had short siliques, small seeds, and short seedlings. Molecular and biochemical assays showed that seed storage proteins were missorted out of the cell and the precursor proteins were accumulated in kea1 kea2. Protein storage vacuoles (PSVs) were smaller in kea1 kea2. Further analyses showed that endosomal trafficking in kea1 kea2 was compromised. Vacuolar sorting receptor 1 (VSR1) subcellular localizations, VSR-cargo interactions, and p24 distribution on the endoplasmic reticulum (ER) and Golgi apparatus were affected in kea1 kea2. Moreover, plastid stromule growth was reduced and plastid association with the endomembrane compartments was disrupted in kea1 kea2. Stromule growth was regulated by the cellular pH and K+ homeostasis maintained by KEA1 and KEA2. The organellar pH along the trafficking pathway was altered in kea1 kea2. Overall, KEA1 and KEA2 regulate vacuolar trafficking by controlling the function of plastid stromules via adjusting pH and K+ homeostasis.


Subject(s)
Arabidopsis Proteins , Arabidopsis , Arabidopsis/metabolism , Antiporters/genetics , Antiporters/metabolism , Arabidopsis Proteins/genetics , Arabidopsis Proteins/metabolism , Vacuoles/metabolism , Plastids/metabolism , Cations/metabolism , Protein Transport
8.
Bio Protoc ; 13(8): e4660, 2023 Apr 20.
Article in English | MEDLINE | ID: mdl-37113331

ABSTRACT

Plant protoplasts are useful to study both transcriptional regulation and protein subcellular localization in rapid screens. Protoplast transformation can be used in automated platforms for design-build-test cycles of plant promoters, including synthetic promoters. A notable application of protoplasts comes from recent successes in dissecting synthetic promoter activity with poplar mesophyll protoplasts. For this purpose, we constructed plasmids with TurboGFP driven by a synthetic promoter together with TurboRFP constitutively controlled by a 35S promoter, to monitor transformation efficiency, allowing versatile screening of high numbers of cells by monitoring green fluorescent protein expression in transformed protoplasts. Herein, we introduce a protocol for poplar mesophyll protoplast isolation followed by protoplast transformation and image analysis for the selection of valuable synthetic promoters. Graphical overview.

9.
Front Cell Infect Microbiol ; 13: 1101568, 2023.
Article in English | MEDLINE | ID: mdl-36923593

ABSTRACT

Fungal infections have become an increasing threat as a result of growing numbers of susceptible hosts and diminishing effectiveness of antifungal drugs due to multi-drug resistance. This reality underscores the need to develop novel drugs with unique mechanisms of action. We recently identified 5-(N,N-hexamethylene)amiloride (HMA), an inhibitor of human Na+/H+ exchanger isoform 1, as a promising scaffold for antifungal drug development. In this work, we carried out susceptibility testing of 45 6-substituted HMA and amiloride analogs against a panel of pathogenic fungi. A series of 6-(2-benzofuran)amiloride and HMA analogs that showed up to a 16-fold increase in activity against Cryptococcus neoformans were identified. Hits from these series showed broad-spectrum activity against both basidiomycete and ascomycete fungal pathogens, including multidrug-resistant clinical isolates.


Subject(s)
Cryptococcus neoformans , Mycoses , Humans , Amiloride/pharmacology , Antifungal Agents/pharmacology , Fungi , Mycoses/drug therapy , Microbial Sensitivity Tests
10.
Plant Cell Rep ; 42(5): 953-956, 2023 May.
Article in English | MEDLINE | ID: mdl-36840757

ABSTRACT

KEY MESSAGE: T-DNA and CRISPR/Cas9-mediated knockout of polyester synthase-like genes delays flowering time in Arabidopsis thaliana and Medicago sativa (alfalfa). Thus, we here present the first report of edited alfalfa with delayed flowering.


Subject(s)
Arabidopsis , Medicago sativa , Medicago sativa/genetics , CRISPR-Cas Systems/genetics , Flowers/genetics , Arabidopsis/genetics
11.
Plant Sci ; 328: 111581, 2023 03.
Article in English | MEDLINE | ID: mdl-36603799
12.
Plant Genome ; 16(2): e20209, 2023 06.
Article in English | MEDLINE | ID: mdl-35470589

ABSTRACT

Cross bred species such as switchgrass may benefit from advantageous breeding strategies requiring inbred lines. Doubled haploid production methods offer several ways that these lines can be produced that often involve uniparental genome elimination as the rate limiting step. We have used a centromere-mediated genome elimination strategy in which modified CENH3 is expressed to induce the process. Transgenic tetraploid switchgrass lines coexpressed Cas9, a poly-cistronic tRNA-gRNA tandem array containing eight guide RNAs that target two CENH3 genes, and different chimeric versions of CENH3 with alterations to the N-terminal tail region. Genotyping of CENH3 genes in transgenics identified edits including frameshift mutations and deletions in one or both copies of the two CENH3 genes. Flow cytometry of T1 seedlings identified two T0 lines that produced five haploid individuals representing an induction rate of 0.5% and 1.4%. Eight different T0 lines produced aneuploids at rates ranging from 2.1 to 14.6%. A sample of aneuploid lines were sequenced at low coverage and aligned to the reference genome, revealing missing chromosomes and chromosome arms.


Subject(s)
Panicum , Haploidy , Histones/genetics , Plant Breeding , Aneuploidy
13.
Plant Cell Physiol ; 63(12): 2008-2026, 2023 Jan 30.
Article in English | MEDLINE | ID: mdl-36161338

ABSTRACT

Changes in climate conditions can negatively affect the productivity of crop plants. They can induce chloroplast degradation (senescence), which leads to decreased source capacity, as well as decreased whole-plant carbon/nitrogen assimilation and allocation. The importance, contribution and mechanisms of action regulating source-tissue capacity under stress conditions in tomato (Solanum lycopersicum) are not well understood. We hypothesized that delaying chloroplast degradation by altering the activity of the tomato chloroplast vesiculation (CV) under stress would lead to more efficient use of carbon and nitrogen and to higher yields. Tomato CV is upregulated under stress conditions. Specific induction of CV in leaves at the fruit development stage resulted in stress-induced senescence and negatively affected fruit yield, without any positive effects on fruit quality. Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated protein 9 (CRISPR/CAS9) knockout CV plants, generated using a near-isogenic tomato line with enhanced sink capacity, exhibited stress tolerance at both the vegetative and the reproductive stages, leading to enhanced fruit quantity, quality and harvest index. Detailed metabolic and transcriptomic network analysis of sink tissue revealed that the l-glutamine and l-arginine biosynthesis pathways are associated with stress-response conditions and also identified putative novel genes involved in tomato fruit quality under stress. Our results are the first to demonstrate the feasibility of delayed stress-induced senescence as a stress-tolerance trait in a fleshy fruit crop, to highlight the involvement of the CV pathway in the regulation of source strength under stress and to identify genes and metabolic pathways involved in increased tomato sink capacity under stress conditions.


Subject(s)
Solanum lycopersicum , Solanum lycopersicum/genetics , Fruit/metabolism , Chloroplasts/metabolism , Carbon/metabolism , Nitrogen/metabolism
14.
Front Plant Sci ; 13: 1011939, 2022.
Article in English | MEDLINE | ID: mdl-36330242

ABSTRACT

Abiotic stresses can cause significant damage to plants. For sustainable bioenergy crop production, it is critical to generate resistant crops to such stress. Engineering promoters to control the precise expression of stress resistance genes is a very effective way to address the problem. Here we developed stably transformed Populus tremula × Populus alba hybrid poplar (INRA 717-1B4) containing one-of-six synthetic drought stress-inducible promoters (SDs; SD9-1, SD9-2, SD9-3, SD13-1, SD18-1, and SD18-3) identified previously by transient transformation assays. We screened green fluorescent protein (GFP) induction in poplar under osmotic stress conditions. Of six transgenic lines containing synthetic promoter, three lines (SD18-1, 9-2, and 9-3) had significant GFP expression in both salt and osmotic stress treatments. Each synthetic promoter employed heptamerized repeats of specific and short cis-regulatory elements (7 repeats of 7-8 bases). To verify whether the repeats of longer sequences can improve osmotic stress responsiveness, a transgenic poplar containing the synthetic promoter of the heptamerized entire SD9 motif (20 bases, containing all partial SD9 motifs) was generated and measured for GFP induction under osmotic stress. The heptamerized entire SD9 motif did not result in higher GFP expression than the shorter promoters consisting of heptamerized SD9-1, 9-2, and 9-3 (partial SD9) motifs. This result indicates that shorter synthetic promoters (~50 bp) can be used for versatile control of gene expression in transgenic poplar. These synthetic promoters will be useful tools to engineer stress-resilient bioenergy tree crops in the future.

15.
Front Plant Sci ; 13: 1009956, 2022.
Article in English | MEDLINE | ID: mdl-36426148

ABSTRACT

Soil biosolarization (SBS) is an alternative technique for soil pest control to standard techniques such as soil fumigation and soil solarization (SS). By using both solar heating and fermentation of organic amendments, faster and more effective control of soilborne pathogens can be achieved. A circular economy may be created by using the residues of a given crop as organic amendments to biosolarize fields that produce that crop, which is termed circular soil biosolarization (CSBS). In this study, CSBS was employed by biosolarizing soil with amended tomato pomace (TP) residues and examining its impact on tomato cropping under conditions of abiotic stresses, specifically high salinity and nitrogen deficiency. The results showed that in the absence of abiotic stress, CSBS can benefit plant physiological performance, growth and yield relative to SS. Moreover, CSBS significantly mitigated the impacts of abiotic stress conditions. The results also showed that CSBS impacted the soil microbiome and plant metabolome. Mycoplana and Kaistobacter genera were found to be positively correlated with benefits to tomato plants health under abiotic stress conditions. Conversely, the relative abundance of the orders RB41, MND1, and the family Ellin6075 and were negatively correlated with tomato plants health. Moreover, several metabolites were significantly affected in plants grown in SS- and CSBS-treated soils under abiotic stress conditions. The metabolite xylonic acid isomer was found to be significantly negatively correlated with tomato plants health performance across all treatments. These findings improve understanding of the interactions between CSBS, soil ecology, and crop physiology under abiotic stress conditions.

16.
Trends Biotechnol ; 40(12): 1454-1468, 2022 12.
Article in English | MEDLINE | ID: mdl-36241578

ABSTRACT

Plant-based biosynthesis of fuels, chemicals, and materials promotes environmental sustainability, which includes decreases in greenhouse gas emissions, water pollution, and loss of biodiversity. Advances in plant synthetic biology (synbio) should improve precision and efficacy of genetic engineering for sustainability. Applicable synbio innovations include genome editing, gene circuit design, synthetic promoter development, gene stacking technologies, and the design of environmental sensors. Moreover, recent advancements in developing spatially resolved and single-cell omics contribute to the discovery and characterization of cell-type-specific mechanisms and spatiotemporal gene regulations in distinct plant tissues for the expression of cell- and tissue-specific genes, resulting in improved bioproduction. This review highlights recent plant synbio progress and new single-cell molecular profiling towards sustainable biofuel and biomaterial production.


Subject(s)
Biofuels , Synthetic Biology , Plants/genetics , Genetic Engineering , Biomass
17.
Plant Biotechnol J ; 20(11): 2135-2148, 2022 11.
Article in English | MEDLINE | ID: mdl-35869808

ABSTRACT

Improving biological nitrogen fixation (BNF) in cereal crops is a long-sought objective; however, no successful modification of cereal crops showing increased BNF has been reported. Here, we described a novel approach in which rice plants were modified to increase the production of compounds that stimulated biofilm formation in soil diazotrophic bacteria, promoted bacterial colonization of plant tissues and improved BNF with increased grain yield at limiting soil nitrogen contents. We first used a chemical screening to identify plant-produced compounds that induced biofilm formation in nitrogen-fixing bacteria and demonstrated that apigenin and other flavones induced BNF. We then used CRISPR-based gene editing targeting apigenin breakdown in rice, increasing plant apigenin contents and apigenin root exudation. When grown at limiting soil nitrogen conditions, modified rice plants displayed increased grain yield. Biofilm production also modified the root microbiome structure, favouring the enrichment of diazotrophic bacteria recruitment. Our results support the manipulation of the flavone biosynthetic pathway as a feasible strategy for the induction of biological nitrogen fixation in cereals and a reduction in the use of inorganic nitrogen fertilizers.


Subject(s)
Nitrogen Fixation , Oryza , Nitrogen Fixation/genetics , Oryza/metabolism , Soil , Gene Editing , Apigenin/metabolism , Fertilizers , Crops, Agricultural , Bacteria/genetics , Nitrogen/metabolism , Edible Grain/metabolism , Biofilms
18.
New Phytol ; 236(1): 165-181, 2022 10.
Article in English | MEDLINE | ID: mdl-35739643

ABSTRACT

In acidic soils, aluminum (Al) toxicity is the main factor inhibiting plant root development and reducing crops yield. STOP1 (SENSITIVE TO PROTON RHIZOTOXICITY 1) was a critical factor in detoxifying Al stress. Under Al stress, STOP1 expression was not induced, although STOP1 protein accumulated, even in the presence of RAE1 (STOP1 DEGRADATION E3-LIGASE). How the Al stress triggers and stabilises the accumulation of STOP1 is still unknown. Here, we characterised SlSTOP1-interacting zinc finger protein (SlSZP1) using a yeast-two-hybrid screening, and generated slstop1, slszp1 and slstop1/slszp1 knockout mutants using clustered regularly interspaced short palindromic repeats (CRISPR) in tomato. SlSZP1 is induced by Al stress but it is not regulated by SlSTOP1. The slstop1, slszp1 and slstop1/slszp1 knockout mutants exhibited hypersensitivity to Al stress. The expression of SlSTOP1-targeted genes, such as SlRAE1 and SlASR2 (ALUMINUM SENSITIVE), was inhibited in both slstop1 and slszp1 mutants, but not directly regulated by SlSZP1. Furthermore, the degradation of SlSTOP1 by SlRAE1 was prevented by SlSZP1. Al stress increased the accumulation of SlSTOP1 in wild-type (WT) but not in slszp1 mutants. The overexpression of either SlSTOP1 or SlSZP1 did not enhance plant Al resistance. Altogether, our results show that SlSZP1 is an important factor for protecting SlSTOP1 from SlRAE1-mediated degradation.


Subject(s)
Arabidopsis Proteins , Arabidopsis , Aluminum/metabolism , Aluminum/toxicity , Arabidopsis/genetics , Arabidopsis Proteins/metabolism , Gene Expression Regulation, Plant , Plant Roots/metabolism , Transcription Factors/metabolism , Zinc Fingers
19.
Food Chem (Oxf) ; 4: 100075, 2022 Jul 30.
Article in English | MEDLINE | ID: mdl-35415701

ABSTRACT

Plums are rich in flavonoids, key contributors to fruit coloration and putative health benefits. We studied the impact of changes in ethylene and sugars in flavonoid metabolism-related pathways of the climacteric Santa Rosa and its non-climacteric mutant Sweet Miriam, throughout the postharvest period. Fruits were harvested at optimal maturity, subjected to ethylene treatments, and evaluated during storage. We examined transcript profiles of structural and regulatory genes of flavonoid-related pathways and their associated metabolites in skin and flesh, integrated with multivariate analyses of ethylene and sugar metabolism. Ethylene treatments were positively correlated with anthocyanin and negatively correlated with flavonol and flavan-3-ol metabolism. Sucrose and galactose were positively associated with anthocyanin concentration, while sorbitol, fructose, glucose and minor sugars were correlated with flavonol and flavan-3-ol metabolism. Our results support the notion that ethylene is playing key roles in shifting plum fruit flavonoid profiles, which are also associated with changes in fruit sugars.

20.
Plant Cell Rep ; 41(2): 493-495, 2022 Feb.
Article in English | MEDLINE | ID: mdl-34994854

ABSTRACT

KEYMESSAGE: We present the first report on base editing in alfalfa. Specifically, we showed edited alfalfa with tolerance to both sulfonylurea- and imidazolinone-type herbicides.


Subject(s)
Gene Editing/methods , Herbicides/pharmacology , Medicago sativa/drug effects , Medicago sativa/genetics , Herbicide Resistance/genetics , Herbicides/chemistry , Plants, Genetically Modified , Sulfonylurea Compounds/pharmacology
SELECTION OF CITATIONS
SEARCH DETAIL