Occurrence and Multiplex PCR Detection of Citrus Yellow Vein Clearing Virus in Korea.

Citrus yellow vein clearing virus (CYVCV) is a member of the Alphaflexiviridae family that causes yellow vein clearing symptoms on citrus leaves. A total of 118 leaf samples from nine regions of six provinces in Korea were collected from various citrus species in 2020 and 2021. Viral diagnosis using next-generation sequencing and reverse transcription polymerase chain reaction (RT-PCR) identified four viruses: citrus tristeza virus, citrus leaf blotch virus, citrus vein enation virus, and CYVCV. A CYVCV incidence of 9.3% was observed in six host plants, including calamansi, kumquat, Persian lime, and Eureka lemon. Among the citrus infected by CYVCV, only three samples showed a single infection; the other showed a mixed infection with other viruses. Eureka lemon and Persian lime exhibited yellow vein clearing, leaf distortion, and water-soak symptom underside of the leaves, while the other hosts showed only yellowing symptoms on the leaves. The complete genome sequences were obtained from five CYVCV isolates. Comparison of the isolates reported from the different geographical regions and hosts revealed the high sequence identity (95.2% to 98.8%). Phylogenetic analysis indicated that all the five isolates from Korea were clustered into same clade but were not distinctly apart from isolates from China, Pakistan, India, and Türkiye. To develop an efficient diagnosis system for the four viruses, a simultaneous detection method was constructed using multiplex RT-PCR. Sensitivity evaluation, simplex RT-PCR, and stability testing were conducted to verify the multiplex RT-PCR system developed in this study. This information will be useful for developing effective disease management strategies for citrus growers in Korea.

Engineering of stable infectious cDNA constructs of a fluorescently tagged tomato chlorosis virus.

Tomato chlorosis virus (ToCV) is an emerging pathogen that cause severe yellow leaf disorder syndrome in tomato plants. In this study, we aimed to generate a recombinant ToCV tagged with green fluorescent protein (GFP) to enable real-time monitoring of viral infection in living plants. Transformation of the full-length cDNA construct of ToCV RNA1 into Escherichia coli resulted in instability issues, which were successfully overcome by inserting a plant intron into RNA1. Subsequently, a GFP tag was engineered into a cDNA construct of ToCV RNA2. The resulting recombinant ToCV-GFP could systemically infect Nicotiana benthamiana plants, and GFP expression was observed along the major veins. Utilizing ToCV-GFP, we also showed that ToCV engages in antagonistic relationships with two different tomato-infecting viruses in mixed infections in N. benthamiana. This study demonstrates the potential of ToCV-GFP as a valuable tool for the visual tracking of infection and movement of criniviruses in living plants.

M13KO7 bacteriophage enables Potato Virus Y detection.

IMPORTANCE: In this study, we confirmed the binding of M13KO7 to Potato virus Y (PVY) using enzyme-linked immunosorbent assay. M13KO7 is a "bald" bacteriophage in which no recombinant antibody is displayed. M13KO7 is easy to propagate by using Escherichia coli, making this method more reasonable in economic perspective. Based on this study, we suggest that M13KO7 detection system has applicability as a novel biological tool for the detection of PVY.

First report of konjac mosaic virus in Spuriopimpinella brachycarpa in Korea.

Spuriopimpinella brachycarpa Nakai (Common name, Chamnamul; family Apiaceae) is a plant whose leaves are consumed as a vegetable and used as a folk medicine in Korea (Kim et al., 2020). In February 2020, seven samples of S. brachycarpa leaf showing virus symptoms including yellowing, vein chlorosis, chlorotic lesions, and severe mottling were collected from a greenhouse in Busan, South Korea, to diagnose the potential disease (Fig. S1a, b). The disease incidence rate in the greenhouse was >10% (2,970 m2). To identify the causal virus, we analyzed leaf dip preparation and thin sections of the symptomatic leaves by transmission electron microscopy. Filamentous virus particles and pinwheel structures were observed, indicating the presence of a potyvirus (Fig. S1c, d). To confirm these results, the symptomatic leaf samples were further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using potyvirus universal primers (Table S2) and direct sequencing of the PCR products. All samples were positive for konjac mosaic virus (KoMV). To exclude the possibility of infection by multiple viruses, we performed high-throughput sequencing (HTS) on an Illumina NovaSeq 6000 system (Macrogen Inc., Seoul, South Korea). There were two contigs (9,267 and 2,851 nt) mapping to KoMV sequences. A large contig (9,267 nt; 705,967 mapped reads; mean read coverage of 11,351.4x) showed about 80% identity (93% coverage) with KoMV-F (GenBank accession no. NC_007913) isolated from Amorphophallus konjac in Japan (Nishiguchi et al., 2006). To isolate KoMV from S. brachycarpa, we mechanically inoculated leaf extracts from symptomatic samples onto Chenopodium quinoa as an assay host via three single-lesion passages, followed by propagation in Nicotiana benthamiana. In a bioassay of the KoMV isolate (KoMV-BS), we mechanically inoculated sap from infected N. benthamiana onto 31 indicator plants including Cryptotaenia japonica (Apiaceae), which is similar to S. brachycarpa (Table S3). KoMV-BS systemically induced vein chlorosis and/or leaf mottling in four Nicotiana species and C. japonica, and chlorotic local lesions in upper leaves of C. quinoa; no symptoms were observed in 25 other indicator plants. These results were confirmed by RT-PCR. Next, we obtained the complete genome sequence of KoMV-BS using HTS and 5' and 3' rapid amplification of cDNA ends, with newly designed primers (Table S2). The assembled full-length KoMV-BS genome sequence was 9,392 nt in length, excluding the poly(A) tail, and encoded a polyprotein composed of 3,060 amino acids. The sequence was deposited in GenBank (accession no. OR001914). BLAST analysis showed 84~88% and 90~98% identities at CP nucleotide and amino acid levels, respectively with the reported KoMV isolates, confirming the virus to be an isolate of KoMV (synonym; Japanese hornwort mosaic virus, zantedeschia mosaic virus) (Adams et al., 2005; Nishiguchi et al., 2006). KoMV infection was first reported in A. konjac from Japan (Shimoyama et al. 1992) and has been spread worldwide as one of the major causal agents of viral diseases in calla lily (Liao et al., 2020). To the best of our knowledge, this is the first report of KoMV infection in S. brachycarpa. To date, cucumber mosaic virus and tobacco mosaic virus have been reported to infect S. brachycarpa in Korea (Yoon et al., 2016; 2017). Our findings will be helpful for developing virus-management strategies to prevent yield and quality loss in S. brachycarpa.

Construction of an Agroinfectious Clone of a Korean Isolate of Sweet Potato Symptomless Virus 1 and Comparison of Its Infectivity According to Agrobacterium tumefaciens Strains in Nicotiana benthamiana.

Sweet potato symptomless virus 1 (SPSMV-1) is a single-stranded circular DNA virus, belonging to the genus Mastrevirus (family Geminiviridae) that was first identified on sweet potato plants in South Korea in 2012. Although SPSMV-1 does not induce distinct symptoms in sweet potato plants, its co-infection with different sweet potato viruses is highly prevalent, and thus threatens sweet potato production in South Korea. In this study, the complete genome sequence of a Korean isolate of SPSMV-1 was obtained by Sanger sequencing of polymerase chain reaction (PCR) amplicons from sweet potato plants collected in the field (Suwon). An infectious clone of SPSMV-1 (1.1-mer) was constructed, cloned into the plant expression vector pCAMBIA1303, and agro-inoculated into Nicotiana benthamiana using three Agrobacterium tumefaciens strains (GV3101, LBA4404, and EHA105). Although no visual differences were observed between the mock and infected groups, SPSMV-1 accumulation was detected in the roots, stems, and newly produced leaves through PCR. The A. tumefaciens strain LBA4404 was the most effective at transferring the SPSMV-1 genome to N. benthamiana. We confirmed the viral replication in N. benthamiana samples through strand-specific amplification using virion-sense- and complementary-sense-specific primer sets.

First report of beet western yellows virus in radish in Korea.

Radish (Raphanus sativus L.) is an important root vegetable widely consumed in kimchi in Korea. In October 2021, radish leaves with virus-like symptoms of mosaic and yellowing were collected in three fields around Naju, Korea (Fig. S1). A pooled sample (n = 24) was screened for causal viruses by high-throughput sequencing (HTS), with detection confirmed by reverse transcription (RT) PCR. Total RNA was extracted from symptomatic leaves using the Plant RNA Prep kit (Biocube System, Korea), and a cDNA library was constructed and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea). De novo transcriptome assembly yielded 63,708 contigs, which were analyzed against the viral reference genome database in GenBank by BLASTn and BLASTx searches. Two large contigs were clearly of viral origin. BLASTn analysis showed that a 9,842-bp contig (4,481,600 mapped reads, mean read coverage 68,758.6×) had 99% identity (99% coverage) with isolate CCLB of turnip mosaic virus (TuMV) from radish in China (KR153038). A second contig of 5,711 bp (7,185 mapped reads, mean read coverage 189.9×) had 97% identity (99% coverage) with isolate SDJN16 of beet western yellows virus (BWYV) from Capsicum annuum in China (MK307779). To confirm the presence of these viruses, total RNA extracted from 24 leaf samples was subjected to RT-PCR using primers specific for TuMV (N60_5'-ACATTGAAAAGCGTAACCA-3' and C30_5'-TCCCATAAGCGAGAATACTAACGA-3', amplicon 356 bp) and BWYV (95F_5'-CGAATCTTGAACACAGCAGAG-3' and 784R_5'-TGTGGG ATCTTGAAGGATAGG-3', amplicon 690 bp) for virus detection. Of the 24 samples, 22 were positive for TuMV and 7 were co-infected with BWYV. Single infection of BWYV was not detected. Infection with TuMV, the predominant virus in radish in Korea, was previously reported (Choi and Choi, 1992; Chung et al., 2015). To determine the complete genomic sequence of the BWYV isolate (BWYV-NJ22) from radish, RT-PCR was conducted using eight overlapping primer pairs designed according to the alignment of previously reported BWYV sequences (Table S2). Terminal sequences of the viral genome were analyzed by 5' and 3' rapid amplification of cDNA ends (RACE; Thermo Fisher Scientific Corp.). The assembled complete genome sequence of BWYV-NJ22 was 5,694 nt long and was deposited in GenBank (accession no. OQ625515). The Sanger sequences shared 96% nt identity with the HTS-derived sequence. BLASTn analysis showed that BWYV-NJ22 had high nucleotide identity (98%) at the complete genome level with a BWYV isolate (OL449448) from C. annuum in Korea. BWYV (genus Polerovirus, family Solemoviridae), is an aphid-borne virus with a host range that includes > 150 plant species and is one of the most important viruses causing yellowing and stunting of vegetable crops (Brunt et al., 1996; Duffus 1973). In Korea, BWYV was first reported to infect paprika, followed by pepper, motherwort, and figwort (Jeon et al., 2021; Kwon et al., 2016; 2018; Park et al., 2018). During fall and winter 2021, 675 radish plants with virus-like symptoms of mosaic, yellowing, and chlorosis were collected from 129 farms in major cultivation areas in Korea and analyzed by RT-PCR using the BWYV detection primers. The incidence of BWYV in radish plants was 4.7%, and all infections were mixed infections with TuMV. To our knowledge, this is the first report of BWYV infecting radish in Korea. The symptoms of single BWYV infection are unclear, as radish is a new host plant of BWYV in Korea. Further research on the pathogenicity and impact of this virus in radish is therefore needed.

Visual tracking of viral infection dynamics reveals the synergistic interactions between cucumber mosaic virus and broad bean wilt virus 2.

Cucumber mosaic virus (CMV) is one of the most prevalent plant viruses in the world, and causes severe damage to various crops. CMV has been studied as a model RNA virus to better understand viral replication, gene functions, evolution, virion structure, and pathogenicity. However, CMV infection and movement dynamics remain unexplored due to the lack of a stable recombinant virus tagged with a reporter gene. In this study, we generated a CMV infectious cDNA construct tagged with a variant of the flavin-binding LOV photoreceptor (iLOV). The iLOV gene was stably maintained in the CMV genome after more than four weeks of three serial passages between plants. Using the iLOV-tagged recombinant CMV, we visualized CMV infection and movement dynamics in living plants in a time course manner. We also examined whether CMV infection dynamics is influenced by co-infection with broad bean wilt virus 2 (BBWV2). Our results revealed that no spatial interference occurred between CMV and BBWV2. Specifically, BBWV2 facilitated the cell-to-cell movement of CMV in the upper young leaves. In addition, the BBWV2 accumulation level increased after co-infection with CMV.

First report of citrus leaf blotch virus infecting Viburnum lentago in South Korea.

Viburnum lentago (family Adoxaceae) is a perennial plant species native to northeastern United States and southern Canada. Globally, V. lentago is a popular garden plant due to its abundant flowers and beautiful autumnal color. V. lentago is also commercially cultivated for medicinal purposes because its roots and fruits can be used in herbal preparations (Jiao et al. 2021). In June 2022, virus-like symptoms of vein chlorosis and yellowing were observed in the leaves of many V. lentago trees planted in a public park in Wonju, South Korea. Leaf samples were collected from five symptomatic V. lentago trees. To identify the causal agent(s) of the virus-like symptoms, total RNA was isolated from one sample using PureLink® RNA Mini Kit (Invitrogen, USA) and subjected to library construction using Illumina TruSeq RNA Sample Preparation Kit v2 (Illumina, Inc., USA). RNA-Seq was performed using an Illumina NovaSeq 6000 system (Macrogen, Korea). De novo assembly of 118,878,556 quality-filtered reads was performed using the Trinity pipeline (Kwon et al. 2018), yielding 296,109 contigs. BLASTn and BLASTx analyses of the contigs against the GenBank viral reference database identified only one large contig (8,816 nt) containing a 26-nt poly(A) tail of viral origin. This contig had a maximum nucleotide identity of 85.53 % (with 99 % coverage) with isolate HZ (accession No. MH427034) of citrus leaf blotch virus (CLBV; genus Citrivirus, family Betaflexiviridae), suggesting that the collected sample was infected with CLBV. All collected V. lentago samples were tested using RT-PCR with CLBV-specific primers (CLBV-Det-Fw 5'-AACGAGGCCAATTCTGCTAT-3' and CLBV-Det-Rv 5'-GACTGCTTGACTAACAC-CCA-3'). All samples were positive for CLBV. For biological indexing, sap from the symptomatic V. lentago leaves was mechanically inoculated to indicator plants, including Nicotiana benthamiana, N. occidentalis, N. tabacum, Datura stramonium, Chenopodium quinoa, Vigna unguiculata, and V. lentago. Three months later, only V. lentago developed the same vein chlorosis symptoms observed in the collected samples, and no other tested plants exhibited obvious symptoms. Further, only V. lentago sample tested positive for CLBV using RT-PCR analysis. To determine the complete genome sequence of the CLBV V. lentago isolate, the contig sequence was confirmed by de novo sequencing of the RT-PCR products amplified using CLBV-specific primers. The 5' terminal sequence of the contig was determined using the 5' rapid amplification of cDNA ends method (Seo et al. 2015). The full-length sequence of CLBV isolated from V. lentago was 8,795 nt in length (excluding poly(A) tail), and deposited in GenBank under the accession number OP751940. Although numerous isolates of CLBV have been identified in various plant species, including citrus, kiwi, and lemon plants (Cao et al. 2017), the V. lentago isolate is likely a distinct variant because its CP gene has a maximum nucleotide identity of 85.53 % with that of a kiwi isolate (MH339916). With little information available on viral diseases infecting V. lentago, this is the first identified and completely sequenced CLBV infecting V. lentago. Significantly, V. lentago plants infected with CLBV did not flower throughout the summer period, reducing their value as an ornamental plant. Furthermore, V. lentago might have acted as an intermediate host to transfer CLBV to other crops such as citrus. To the best of our knowledge, this is the first report of CLBV infecting V. lentago in South Korea and the world.

First report of perilla mosaic emaravirus infecting Perilla frutescens in South Korea.

Perilla mosaic virus (PerMV; the genus Emaravirus in the family Fimoviridae) has a multiple, negative-sense, single-stranded RNA genome (ICTV, 2018). PerMV has been reported in Japan, where it was transmitted by an eriophyid mite species (Acari: Eriophyidae) to Perilla frutescens (L.) Britton var. crispa (Kubota et al., 2020). In September 2021, typical symptoms of the virus including yellow flecks, mosaic symptoms, and malformation were observed in leaves of P. frutescens in a cultivated field in Iseo-myeon, Wanju, South Korea (Suppl. Fig. 1). Visual estimates indicated that symptom incidence reached 70%, and the top leaves of perilla plants exhibited more severe symptoms and leaf distortion. To identify the virus species accurately, total RNA was extracted from five symptomatic perilla leaves collected using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) then cDNAs were amplified by reverse-transcription polymerase chain reaction (RT-PCR) using two pairs of primers to PerMV specific primer set designed to amplify 412- and 491-bp cDNAs of the nucleocapsid protein gene RNA 3 and movement protein gene RNA 4, respectively (Suppl. Table). Single-infection of PerMV in symptomatic Korean perilla plants was confirmed by high-throughput sequence (HTS) analysis and de novo transcriptome assembly using the Illumina HiSeq 4000 platform (Macrogen Inc., Seoul, Korea). The assembled sequences were aligned with viral reference genomes through searches performed using the BLASTn tool. Seven contigs (597-7,213 bp) revealed 92.09-97.37% nucleotide homology with RNAs of the isolate PerMV_Kochi_Nankoku_2011 (accession numbers LC496090 to LC496099) in the GenBank database. Other viruses including turnip mosaic virus and cucumber green mottle mosaic virus were not identified by HTS analysis (Cho et al., 2021; Park et al., 2020; Song et al., 2022). Seven RNA genomes of PerMV were confirmed by RT-PCR using specific primer sets designed to amplify part of each genome (Suppl. Table 1 and Fig. 2). The complete nucleotide sequences of PerMV (named IS isolate) RNA 1-7 were determined to be 7,177, 2,089, 1,094, 1,302, 1,079, 1,098, and 995 bp in length, respectively; these were deposited in GenBank (LC721296-LC721303). Sap from a symptomatic leaf sample confirmed for single infection was inoculated mechanically onto the leaves of 10 healthy P. frutescens seedlings, which developed the same PerMV symptoms within 3 weeks. These results indicate that PerMV is the causal agent of viral disease in Korean perilla plants cultivated in South Korea. To our knowledge, this is the first report of a perilla mosaic emaravirus infecting to Korean perilla, P. frutescens in South Korea.

First report of Tulip Virus X infecting tulip (Tulipa gesneriana) in Korea.

Tulip virus X (tulip virus X, TVX) is a member of the genus Potexvirus (family Alphaflexiviridae) and is a positive single-stranded RNA virus. TVX was described first in Scotland (Mowat 1982), followed by several countries (Yamaji et al. 2001; Tzanetakis et al. 2005; Ward et al. 2008; Dees et al. 2011; Sochacki and Komorowska 2012; Wylie et al. 2019). In April 2021, 86 whole tulip plants showing viral symptoms in leaves (mosaic, yellowing, and malformation) and flowers (color breaking) were collected in Chilgok, Chuncheon, Goseong, Yecheon and Yesan, Korea. Furthermore, high-throughput sequencing was performed to identify viruses that infect tulips in Korea. Total RNA was extracted from pooled the leaves and petals using a Maxwell® 16 LEV Plant RNA Kit (Promega, Madison, USA). We constructed a single library using the TruSeq Stranded Total RNA LT Sample Prep Kit for Plant (Illumina, San Diego, USA). The library was 100 bp paired-end sequenced using Illumina's NovaSeq 6000 (Macrogen, Seoul, Korea) and was assembled de novo using Trinity software version trinityrnaseq_r20140717, with default parameters. The contigs were annotated as in previous study (Lee et al. 2020), revealing a single contig each related to TVX, lily symptomless virus (LSV), and tulip breaking virus (TBV) was generated from 648 million total reads. The TVX-related contig (GenBank ON205948) consisting of 6,076 bp showed 99.52% nucleotide identity (6027/6056 bp) with TVX-J (GenBank AB066288). We conducted an RT-PCR assay to validate the presence of viruses with specific primers as TVX-F5093/R5624 (5'-CTATCCGGACTCATTCTACTTC/GTGCGTTCCAGATAAGCTTG-3'), LSV-F7013/R7338 (5'-CTTGGTCGACAGGGACATAAC/GATTGGAATTGTGCTTTTCAGC-3'), and TBV-F7515/R8116 (5'-GTGTGTCATGGATGATTGTTG/CAACTGATTTGCTACCGCTAG-3'). Consequently, TVX were detected in 13 of 86 samples. Moreover, LSV and TBV were detected in 15 and 26 samples, respectively. However, the yellowing and mosaic observed in the TVX infected samples were not observed in the LSV and TBV infected samples. Subsequently, two TVX amplicons were selected, cloned and sequenced. The obtained sequences were 532 bp and were named YS24 and YS38 (GenBank LC664027 and LC664028), respectively. The Korean isolates showed 98.68% (525/532 bp) and 99.62% (530/532 bp) identity with Australian isolate (GenBank MH886522) in BLASTn analysis. To bioassay for TVX, the infected tulip leaf tissue from which YS24 was obtained was used to sap-inoculate, in triplicates, 15 species of indicator plants (Nicotiana benthamiana, N. clevelandii, N. debneyi, N. glutinosa, N. rustica, N. tabacum, Datura stramonium, Glycine max, Phaseolus vulgaris, Chenopodium amaranticolor, C. quinoa, Cucumis sativus, Cu. melo, Gomphrena globosa, and Tetragonia tetragonioides). After 14 days of inoculation, we observed distinct chlorotic spots on inoculated and upper leaves of C. quinoa, but no symptoms were observed in other indicator plants. In RT-PCR assay using TVX-specific primers, only C. quinoa showed a positive reaction. In previous studies, C. amaranticolor, C. quinoa, G. globosa, and N. benthamiana were known as the experimental host of TVX (Dees et al. 2011; Tzanetakis et al. 2005), but only C. quinoa was confirmed to be susceptible to the Korean isolate. Furthermore, transmission electron microscopy revealed typical flexuous rod-shaped viral particles in the inoculated C. quinoa. To our knowledge, this is the first report of TVX infecting tulips in Korea.

Incidence and Molecular Identification of Begomoviruses Infecting Tomato and Pepper in Myanmar.

In Myanmar, yellow mosaic and leaf curl diseases caused by whitefly-transmitted begomoviruses are serious problems for vegetables such as tomatoes and peppers. To investigate the incidence of begomoviruses in Myanmar between 2017 and 2019, a field survey of tomato and pepper plants with virus-like symptoms was conducted in the Naypyitaw, Tatkon, and Mohnyin areas of Myanmar. Among the 59 samples subjected to begomovirus detection using polymerase chain reaction, 59.3% were infected with begomoviruses. Complete genome sequences using rolling circle amplification identified five begomovirus species: tomato yellow leaf curl Thailand virus (TYLCTHV), tomato yellow leaf curl Kanchanaburi virus (TYLCKaV), tobacco leaf curl Yunnan virus (TbLCYnV), chili leaf curl Pakistan virus (ChiLCV/PK), and tobacco curly shoot Myanmar virus (TbCSV-[Myanmar]). Excluding the previously reported TYLCTHV, three begomoviruses (ChiLCV/PK, TYLCKaV, and TbLCYnV) were identified in Myanmar for the first time. Based on the 91% demarcation threshold of begomovirus species, TbCSV-[Myanmar] was identified as a new species in this study. Among these, ChiLCV/PK and TbCSV-[Myanmar] were the most predominant in tomato and pepper fields in Myanmar. Identification of begomovirus species may be helpful for predicting the origin of viruses and preventing their spread.

First report of Ranunculus mild mosaic virus in Ranunculus asiaticus in Korea.

Ranunculus (Ranunculus asiaticus L.) is a popular ornamental plant mainly cultivated for cut flowers and flowering potted plants. In January 2021, a leaf sample of R. asiaticus that showed virus-like symptoms including mosaic, yellowing and malformation on leaves was collected from a greenhouse in Jangheung, South Korea for disease diagnosis (Fig. S1). Disease incidence was greater than 30% in the greenhouse (~1,000 m2). Transmission electron microscopy (TEM) of symptomatic leaves identified potyvirus-like filamentous virus particles of about 800 nm. To confirm the TEM results, a symptomatic leaf sample was further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using species-specific detection primers for six potyviruses that infect R. asiaticus (Sacco et al., 2018). The sample was positive only for ranunculus mild mosaic virus (RanMMV). Additional analysis of nine symptomatic R. asiaticus plants from the infected greenhouse found that all samples were positive for RanMMV. To exclude the presence of the other viruses, next generation sequencing (NGS) was carried out. Total RNA was extracted from symptomatic leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and a transcriptome library was generated using the TruSeq Stranded Total RNA LT Sample Prep kit (Illumina, San Diego, CA) acccording to the recommended protocol. NGS was performed using an Illumina NovaSeq 6000 system (Macrogen Inc., Korea). A total of 75.58 million reads were obtained, and the reads were de novo assembled to contigs using Trinity software (Grabherr et al., 2011). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database identified the assembled large contig of 9,539 nt (5,321 mapped reads, mean read coverage of 84.2 times) as RanMMV. This sequence shared 98% nt identity (99% coverage) with the RanMMV NL isolate (acc. no. LC604020) isolated from an anemone plant (A. blanda cv. Charmer) from Netherlands. To obtain the complete genome sequence, the termini sequences were determined by 5' and 3' rapid amplification of cDNA ends (RACE) methods as reported recently (Imamura et al., 2021). The assembled full-length genome sequence of RanMMV-JH is 9,574 nt in length, excluding the poly(A) tail, and encoding a polyprotein of 3,074aa. The sequence was deposited in GenBank under the accession no. OL742438. RanMMV is transmitted by aphids in a nonpersistent manner and has very narrow host range. RanMMV, one of causative agents of ranunculus mosaic disease, has been problematic in ranunculus production area of Japan (Hayahi et al., 2018; Kamikawa et al., 2022). Recently, some perennial weeds from the Ranunculaceae family (e.g. R. japonicus, R. silerifolius and R. tachiroei) are known to may act as a virus reservoir (Kamikawa et al., 2022). As R. asiaticus is cultivated by vegetative propagation, there is need to develop certification system for producing virus-free R. asiaticus. To our knowledge, this is the first report of RanMMV infection in R. asiaticus in Korea.

First report of strawberry polerovirus 1 in strawberry in Nepal.

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

A multiplex RT-PCR assay for detection of emergent pepper Tsw resistance-breaking variants of tomato spotted wilt virus in South Korea.

Tomato spotted wilt virus (TSWV) is a highly destructive virus for pepper. Introgression of the resistance gene Tsw in pepper is used to manage TSWV worldwide; however, the occurrence of Tsw resistance-breaking (RB) variants threatens the pepper industry. Here, we developed a multiplex reverse-transcription PCR assay for detection of recently emerged Tsw RB variants in South Korea with high specificity and sensitivity.

Tomato Yellow Leaf Curl Virus Infection in a Monocotyledonous Weed (Eleusine indica).

Tomato yellow leaf curl virus (TYLCV) is one of the most important plant viruses belonging to the genus Begomovirus of the family Geminiviridae. To identify natural weed hosts that could act as reservoirs of TYLCV, 100 samples were collected at a TYLCV-affected tomato farm in Iksan from 2013 to 2014. The sample weeds were identified as belonging to 40 species from 18 families. TYLCV was detected in 57 samples belonging to 28 species through polymerase chain reaction using root samples including five species (Eleusine indica, Digitaria ciliaris, Echinochloa crus-galli, Panicum dichotomiflorum, and Setaria faberi) from the family Poaceae. Whitefly Bemisia tabaci-mediated TYLCV transmission from TYLCV-infected E. indica plants to healthy tomatoes was confirmed, and inoculated tomatoes showed typical symptoms, such as leaf curling and yellowing. In addition, TYLCV was detected in leaf and root samples of E. indica plants inoculated by both whitefly-mediated transmission using TYLCV-viruliferous whitefly and agro-inoculation using a TYLCV infectious clone. The majority of mastreviruses infect monocotyledonous plants, but there have also been reports of mastreviruses that can infect dicotyledonous plants, such as the chickpea chlorotic dwarf virus. No exception was reported among begomoviruses known as infecting dicots only. This is the first report of TYLCV as a member of the genus Begomovirus infecting monocotyledonous plants.

Identification of a Novel Geminivirus in Fraxinus rhynchophylla in Korea.

Fraxinus rhynchophylla, common name ash, belongs to the family Oleaceae and is found in China, Korea, North America, the Indian subcontinent, and eastern Russia. It has been used as a traditional herbal medicine in Korea and various parts of the world due to its chemical constituents. During a field survey in March 2019, mild vein thickening (almost negligible) was observed in a few ash trees. High-throughput sequencing of libraries of total DNA from ash trees, rolling-circle amplification (RCA), and polymerase chain reaction (PCR) allowed the identification of a Fraxinus symptomless virus. This virus has five confirmed open reading frames along with a possible sixth open reading frame that encodes the movement protein and is almost 2.7 kb in size, with a nonanucleotide and stem loop structure identical to begomoviruses. In terms of its size and structure, this virus strongly resembles begomoviruses, but does not show any significant sequence identity with them. To confirm movement of the virus within the trees, different parts of infected trees were examined, and viral movement was successfully observed. No satellite molecules or DNA B were identified. Two-step PCR confirmed the virion and complementary strands during replication in both freshly collected infected samples of ash tree and Nicotiana benthamiana samples agro-inoculated with infectious clones. This taxon is so distantly grouped from other known geminiviruses that it likely represents a new geminivirus genus.

First report of Colombian datura virus in Brugmansia suaveolens in Korea.

Brugmansia suaveolens, known as angel's trumpet, is a perennial ornamental shrub in the Solanaceae with large fragrant flowers. In June 2018, a leaf sample of B. suaveolens that showed virus-like symptoms including chlorotic spots, yellowing and mottle on leaves was collected from a greenhouse in Seongnam, South Korea for disease diagnosis (Supplementary Figure S1a, b). Disease incidence in the greenhouse was greater than 80% for about 2,000 B. suaveolens plants. To identify a causal virus, transmission electron microscopy (TEM) was used to analyze symptomatic leaf samples using leaf dips and thin section methods. Filamentous virus particles and pinwheel structures were observed, indicating the presence of a potyvirus (Supplementary Figure S1c, d). To confirm the TEM results, a symptomatic leaf sample was further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using species-specific detection primers for three potyviruses that infect Brugmansia spp.: Colombian datura virus (CDV), Brugmansia mosaic virus (BruMV), and Brugmansia suaveolens mottle virus (BsMoV) (Lucinda et al, 2008; Park et al., 2014; Verma et al., 2014). The sample was positive only for CDV. CDV is transmitted by aphids in a nonpersistent manner and mechanical inoculation and can infect plants in the Solanaceae family including tomato and tobacco (Kahn and Bartels 1968; Schubert et al. 2006; Verhoeven et al. 1996) and has been designated a quarantine virus in Korea. Additional analysis of 13 symptomatic B. suaveolens plants from the infected greenhouse found that all samples except one were infected with CDV. To isolate CDV from B. suaveolens, leaf extracts from symptomatic samples were mechanically inoculated on an assay host, Nicotiana tabacum cv. BY via three single-lesion passages followed by propagation in N. benthamiana. For the bioassay of the CDV isolate (CDV-AT-Kr), sap from infected N. benthamiana was mechanically inoculated on 31 indicator plants, including B. suaveolens (Supplementary Table S2). CDV-AT-Kr induced chlorotic local lesions, necrotic local lesions, mottle, and/or mosaic systemically in 10 Nicotiana spp., and mottle and yellowing in tomato. On inoculated B. suaveolens, te mild mottle symptom was reproduced. No symptoms were observed in pepper or Datura stramonium. These results were confirmed by RT-PCR. To characterize CDV-AT-Kr genetically, the complete genome sequence of CDV-AT-Kr was obtained by RT-PCR using specific primers (Supplementary Table S3) and deposited in GenBank (accession no. MW075268). The CDV-AT-Kr RNA consists of 9,620 nt, encoding a polyprotein of 3,076 aa. BLASTn analysis showed that CDV-AT had maximum nucleotide identities of 98.9% at the complete genome level with a CDV isolate (accession no. JQ801448) from N. tabacum in the UK. To our knowledge, this is the first report of CDV infection in B. suaveolens in Korea and the second report in the world of the complete genome sequence. As B. suaveolens is cultivated by vegetative propagation, production and maintenance of virus-free, healthy B. suaveolens is needed. In addition, as new CDV hosts have been repeatedly reported (Pacifico et al., 2016; Salamon et al., 2015; Tomitaka et al., 2014; Verma et al., 2014), we are monitoring nationwide occurrence to prevent the spread of the virus to other crops.

Development of novel detection system for sweet potato leaf curl virus using recombinant scFv.

Sweet potato leaf curl virus (SPLCV) causes yield losses in sweet potato cultivation. Diagnostic techniques such as serological detection have been developed because these plant viruses are difficult to treat. Serological assays have been used extensively with recombinant antibodies such as whole immunoglobulin or single-chain variable fragments (scFv). An scFv consists of variable heavy (VH) and variable light (VL) chains joined with a short, flexible peptide linker. An scFv can serve as a diagnostic application using various combinations of variable chains. Two SPLCV-specific scFv clones, F7 and G7, were screened by bio-panning process with a yeast cell which expressed coat protein (CP) of SPLCV. The scFv genes were subcloned and expressed in Escherichia coli. The binding affinity and characteristics of the expressed proteins were confirmed by enzyme-linked immunosorbent assay using SPLCV-infected plant leaves. Virus-specific scFv selection by a combination of yeast-surface display and scFv-phage display can be applied to detection of any virus.

Enhanced Anticancer Effect of Adding Magnesium to Vitamin C Therapy: Inhibition of Hormetic Response by SVCT-2 Activation.

l-Ascorbic acid (vitamin C, AA) is known as an antioxidant, but at high concentrations, AA can kill cancer cells through a prooxidant property. Sodium-dependent vitamin C transporter family-2 (SVCT-2) determines the cellular uptake of AA, and the activity of SVCT-2 is directly related to the anticancer activity of AA. Cancer cells that showed high SVCT-2 expression levels were more sensitive to AA treatment than cancer cells with low SVCT-2 expression levels. Cells with low SVCT-2 expression showed a hormetic response to a low dose of AA. Magnesium ions, which are known to activate SVCT-2, could increase the Vmax value of SVCT-2, so we investigated whether providing magnesium supplements to cancer cells with low SVCT-2 expression that had shown a hormetic response to AA would elevate the Vmax value of SVCT-2, allowing more AA to accumulate. To evaluate the effects of magnesium on cancer cells, MgSO4 and MgCl2 were screened as magnesium supplements; both forms showed synergistic anticancer effects with AA. Taken together, the results of this study suggest that magnesium supplementation enhanced the anticancer effect of AA by inhibiting the hormetic response at a low dose. This study has also demonstrated that AA treatment with magnesium supplementation provided more effective anticancer therapy than AA treatment alone.

Genome-wide identification of long non-coding RNAs in tomato plants irradiated by neutrons followed by infection with Tomato yellow leaf curl virus.

Long non-coding RNAs (lncRNAs) play an important role in regulating many biological processes. In this study, tomato seeds were first irradiated by neutrons. Eight tomato mutants were then selected and infected by Tomato yellow leaf curl virus (TYLCV). RNA sequencing followed by bioinformatics analyses identified 1,563 tomato lncRNAs. About half of the lncRNAs were derived from intergenic regions, whereas antisense lncRNAs accounted for 35%. There were fewer lncRNAs identified in our study than in other studies identifying tomato lncRNAs. Functional classification of 794 lncRNAs associated with tomato genes showed that many lncRNAs were associated with binding functions required for interactions with other molecules and localized in the cytosol and membrane. In addition, we identified 19 up-regulated and 11 down-regulated tomato lncRNAs by comparing TYLCV infected plants to non-infected plants using previously published data. Based on these results, the lncRNAs identified in this study provide important resources for characterization of tomato lncRNAs in response to TYLCV infection.