Association of SARS-CoV-2 viral load with abnormal laboratory characteristics and clinical outcomes in hospitalised COVID-19 patients.

We conducted a retrospective, analytical cross-sectional and single-centre study that included 190 hospitalised COVID-19 patients in the Fujian Provincial Hospital South Branch between December 2022 and January 2023 to analyse the correlation of viral loads of throat swabs with clinical progression and outcomes. To normalise the Ct value as quantification of viral loads, we used RNase P gene as internal control gene and subtracted the Ct value of SARS-CoV-2 N gene from the Ct value of RNase P gene, termed △Ct. Most patients were discharged (84.2%), and only 10 (5.6%) individuals who had a lower △Ct value died. The initial △Ct value of participants was also significantly correlated with some abnormal laboratory characteristics, and the duration time of SARS-CoV-2 was longer in patients with severe symptoms and a lower △Ct value at admission. Our study suggested that the △Ct value may be used as a predictor of disease progression and outcomes in hospitalised COVID-19 patients.

[Serological feature and molecular mechanism for a case with A307 subgroup].

OBJECTIVE: To explore the serological feature and molecular mechanism for a case with A307 subgroup of the ABO blood group system. METHODS: Serological assay was carried out to determine the ABO blood group of the proband and his family members. Genotypes for exons 1 to 7 of the ABO gene were determined with sequence-specific primer polymerase chain reaction (SSP-PCR) and direct sequencing. The impact of the variant on the stability of alpha-1,3-N-acetylgalactosaminyltransferase (GTA) was predicted through construction of a 3D molecular model. RESULTS: The proband, his brother and daughter were diagnosed with Aend phenotype by serological analysis. Their ABO genotype was determined as A307/O02, with heterozygous c.467C>T (p.P156L) and c.745C>T (p.R249W) variants identified in exon 7 of the ABO gene. Molecular modeling suggested that the p.R249W variant may alter the number of hydrogen bonds between the amino acids. The protein was predicted to have a decreased Δ Δ G value of thermodynamic stability. CONCLUSION: The p.R249W variant may give rise to the A307 subgroup by reducing the stability of the GTA enzyme, leading to serological features of Aend phenotype.

Detection of Prostate Cancer Antigen 3 and Prostate Cancer Susceptibility Candidate in Non-DRE Urine Improves Diagnosis of Prostate Cancer in Chinese Population.

Although prostate biopsy is the gold standard for the diagnosis of prostate cancer, it also leads to high incidence of negative biopsies and the diagnosis of clinically low-risk prostate cancer and the subsequent overtreatment. It remains an unmet need to discover new biomarkers in order to defer the unnecessary biopsies in clinical practice. In this study, we described a new method, LBXexo score, to measure the urine exosomal PCA3/PRAC expression from non-DRE urine as a noninvasive diagnosis to improve the detection rate in Chinese population with a low serum PSA level. First-voided urine samples were collected to isolate exosomes, and exosomal RNAs of PCA3 and PRAC were measured by quantitative reverse transcription PCR. A significant increase in exoPCA3/PRAC was observed in both any-grade and high-grade prostate cancer groups when compared with the biopsy-negative group. Receiver-operating characteristic curve analyses showed that the LBXexo score significantly improved diagnostic performance in predicting biopsy results, with AUCs of 0.723 (p=0.017) and 0.736 (p=0.038) for any-grade and high-grade (GS ≥ 7) prostate cancer, respectively. For high-grade cancer, LBXexo had the negative and positive predictive values of 100% and 27.59%, respectively, and could potentially avoid unnecessary biopsy. This is the first report in Chinese population that demonstrates the predictive value of the exosomal expression of PCA3 and PRAC derived from non-DRE urine in predicting prostate biopsy outcomes. It could be used in clinical practice to make a better informed biopsy decision and avoid unnecessary biopsies in Chinese population.

[Identification and pedigree analysis of ABO subgroup B303].

OBJECTIVE: To explore the molecular mechanism of a case of ABO discrepancies based on the results of blood group serology. METHODS: Five cases of the two-generation pedigrees were analyzed. ABO genotypes were determined using serological tests. DNA sequence analysis was performed on exon 6, exon 7 and intron 3 of the 5 cases to confirm the genotypes of a proband with B subgroup and 4 family members. RESULTS: There were 3 cases of subgroup AB3 and 1 case of subgroup B3 among the 5 family members. The genotypes were identified as A102/B303 and O02/B303, respectively. B303 differed from B101 by intron 3 point mutation (intron3 + 5G>A). CONCLUSION: The point mutation of intron 3 (intron 3+5G>A) is specific in B303.

Clinical analysis of four serum tumor markers in 458 patients with ovarian tumors: diagnostic value of the combined use of HE4, CA125, CA19-9, and CEA in ovarian tumors.

PURPOSE: To investigate the diagnostic values of human epididymis protein 4 (HE4), carbohydrate antigen 125 (CA125), carbohydrate antigen 19-9 (CA19-9), and carcinoembryonic antigen (CEA) for ovarian tumors. METHODS: The participants were divided into three groups: 386 healthy women (control group), 262 patients with benign ovarian tumors (the benign group), and 196 patients with malignant pelvic tumors (the malignant group). The serum levels of HE4, CA125, CA19-9, and CEA were analyzed by electrochemiluminescent immunoassay. RESULTS: It showed that serum levels of HE4, CA125, CA19-9, and CEA of patients with malignant ovarian tumors were significantly higher than those in the control group and benign group (P<0.01). HE4 had a high specificity (96.56%) in malignant ovarian tumors. The tumor markers HE4, CA125, CA19-9, and CEA had a sensitivity of 63.78%, 62.75%, 35.71%, and 38.78%, respectively. The combined use of two or more tumor markers (parallel test) had a higher diagnostic sensitivity but lower specificity than a single tumor marker. The combined efficiency of HE4 and CA125 was the highest, with a sensitivity and specificity of 80.10% and 69.08%, respectively. HE4 and CA125 combined with the Risk of Ovarian Malignancy Algorithm provided an efficient means of screening and diagnosis of ovarian malignancies. The diagnostic sensitivity increased to 88.52% when three or four tumor markers were used but showed no significant difference compared with the combination of HE4 and CA125 (P>0.05). CONCLUSION: The combination of three or four tumor markers did not improve the diagnostic efficacy when compared with the combination of HE4 and CA125.

[Molecular and Genetic Mechanism of Three Cases of Para-Bombay Blood Group].

OBJECTIVE: To explore molecular and genetic mechanism of 3 cases of para-Bombay blood group. METHODS: The bood samples of proband and family members were selected to identify their blood groups with conventional serologic methods, and salivary components carrying the ABH antigens were detected. The coding regions of FUT1 as well as exon 6 and 7 of the ABO gene were amplified using polymerase chain reaction(PCR), and the FUT1 gene was directly sequenced. RESULTS: All the 3 cases of proband were confirmed as para-Bombay blood group. Direct sequencing revealed h new2 (nt328G→A) and h1(nt 547 ΔAG) in FUT1 gene of the proband 1, and FUT1 genotype was h1/h new2. However, the genotypes of his parents were H/h1 and H/h new2, which were non-Bombay individuals. The FUT1 genotypes of proband 2 and 3 were h1h2 (nt 547 ΔAG) and h1h2 (nt 880 ΔTT), respectively. CONCLUSION: The technology of molecular biology can be used to detect the base deletion mutations in FUT1 gene, which contributes to the analysis of molecular and genetic mechanism of para-Bombay blood group.

[Two novel mutations of FBN1 gene in the patients with MFS among Han population].

To detect the mutations of fibrillin-1 (FBN1) gene in the patients with Marfan syndrome (MFS), polymerase chain reaction (PCR) and denaturing high-performance liquid chromatography (DHPLC) were conducted to screen for the mutations in FBN1 gene. Sequence analyses were carried out when the DNA amplification fragments of the DHPLC elution profiles showed difference from the corresponding normal elution profile. Two novel mutations were detected in two families with MFS, respectively. One was a multiplex mutation in exon 55 containing a deletion mutation c.6862_6871delGGCTGTGTAG (p.Gly2288MetfsX109), a synonymous mutation (c.6861A>G) and an intronic mutation c.[6871+1_6871+11delGTAAGAGGATC; 6871+34dupCATCAGAAGTGACAGTGGACA], and the other was a missense mutation in exon 20 c.2462G>A (p.Cys821Tyr). The results indicated that the deletion mutation c.[6862_6871delGGCTGT GTAG; 6871+1_6871+11delGTAAGAGGATC] (p.Gly2288MetfsX109) and the missense mutation c.2462G>A (p.Cys821Tyr) of FBN1 gene may cause the two family patients with MFS respectively.

[Two gene mutations in fibrillin 1 of Marfan syndrome].

OBJECTIVE: To detect novel mutations in the fibrillin 1 (FBN1) and transforming growth factor beta receptor type II (TGFBR2) genes by screening the genes from 14 patients with Marfan syndrome. METHODS: Denaturing high performance liquid chromatography (DHPLC) was introduced to screen for FBN1 and TGFBR2 mutations exon-by-exon. The DNA amplification fragments which DHPLC elution profiles showed different from the corresponding normal elution profile were sequenced to identify the positions and types of mutations. Restriction fragment length polymorphism (RFLP) was employed to further prove the mutations when needed. RESULTS: Two gene mutations of the FBN1 were found in the patients with Marfan syndrome. They were a novel substitutional mutation (Intron29 +4A > T) of FBN1 and a recurrent nonsense mutation (8080C >T) of FBN1. CONCLUSION: Intron29 +4A > T and 8080C > T of FBN1 are possibly the pathogenesis of the MFS patients.

Upregulated production of IL-6, but not IL-10, by interferon-alpha induces SOCS3 expression and attenuates STAT1 phosphorylation in myeloma cells.

Interferon-alpha (IFN-alpha) is used as a treatment for multiple myeloma, although its clinical effects remain controversial. Here, we investigated whether IFN-alpha altered the autocrine production of interleukin-6 (IL-6) or IL-10, both identified as key cytokines regulating myeloma cell growth/survival, and found that IL-6, but not IL-10, induced by IFN-alpha attenuated IFN-alpha-mediated signaling in myeloma cells via an upregulated SOCS3. Using reverse transcription-polymerase chain reaction, expression of the IL-6 gene (IL-6) and IL-10 was detected in two and three of eight myeloma cell lines, respectively. When myeloma cells were cultured with IFN-alpha, an increase of IL-6 and IL-10 production was detected in IL-6-expressing and in IL-10-expressing cells, respectively. IFN-alpha inhibited the cell growth of these myeloma lines. Addition of an IL-6-neutralizing antibody prolonged the phosphorylation of STAT1 induced by IFN-alpha and significantly enhanced the cell growth suppression of IFN-alpha on IL-6-expressing cells. However, a similar blocking of IL-10 in the presence of IFN-alpha did not affect the growth/survival of IL-10-expressing cells. Interestingly, exogenous IL-6, but not IL-10, induced high levels of SOCS3 expression. Although upregulation of SOCS3 was also observed in the presence of IFN-alpha alone in IL-6-expressing cells, this expression was completely abrogated by the IL-6-neutralizing antibody. The L929 cell line transfected with SOCS3 showed the protection from the growth suppression of IFN-alpha. These results suggest that IL-6 induced by IFN-alpha plays an important role in the growth/survival of myeloma cells via an autocrine loop, and upregulated SOCS3 by IL-6 may be at least partially responsible for the IL-6-mediated inhibition of IFN-alpha signaling in myeloma cells.