ABSTRACT
Osteosarcoma is an aggressive form of bone cancer and affects the health in children and adolescents. Although conventional treatment improves the osteosarcoma survival, some patients have metastasis and drug resistance, leading to a worse prognosis. Therefore, it is necessary to explore the molecular mechanism of osteosarcoma occurrence and progression, which could discover the novel treatment for osteosarcoma. Long noncoding RNAs (lncRNAs) have been reported to regulate osteosarcoma occurrence and malignant progression. LncRNA HOXA-AS3 facilitates the tumorigenesis and progression in a variety of human cancers. However, the underlying mechanism of lncRNA HOXA-AS3-induced oncogenesis is poorly determined in osteosarcoma. To address this point, we utilized several cellular biological strategies and molecular approaches to explore the biological functions and mechanisms of lncRNA HOXA-AS3 in osteosarcoma cells. We found that lncRNA HOXA-AS3 facilitates cell proliferation and invasion via targeting miR-218-5p/FOXP1 axis in osteosarcoma. In conclusion, lncRNA HOXA-AS3 could be a promising target for osteosarcoma treatment.
Subject(s)
Bone Neoplasms , Cell Proliferation , Forkhead Transcription Factors , Gene Expression Regulation, Neoplastic , MicroRNAs , Osteosarcoma , RNA, Long Noncoding , Repressor Proteins , Osteosarcoma/genetics , Osteosarcoma/pathology , Osteosarcoma/metabolism , MicroRNAs/genetics , MicroRNAs/metabolism , Humans , RNA, Long Noncoding/genetics , RNA, Long Noncoding/metabolism , Cell Proliferation/genetics , Cell Line, Tumor , Repressor Proteins/genetics , Repressor Proteins/metabolism , Forkhead Transcription Factors/genetics , Forkhead Transcription Factors/metabolism , Bone Neoplasms/genetics , Bone Neoplasms/pathology , Bone Neoplasms/metabolism , Neoplasm Invasiveness , Cell Movement/geneticsABSTRACT
Ulcerative colitis (UC) is a chronic inflammatory bowel disease with intricate pathogenesis and varied presentation. Accurate diagnostic tools are imperative to detect and manage UC. This study sought to construct a robust diagnostic model using gene expression profiles and to identify key genes that differentiate UC patients from healthy controls. Gene expression profiles from eight cohorts, encompassing a total of 335 UC patients and 129 healthy controls, were analyzed. A total of 7530 gene sets were computed using the GSEA method. Subsequent batch correction, PCA plots, and intersection analysis identified crucial pathways and genes. Machine learning, incorporating 101 algorithm combinations, was employed to develop diagnostic models. Verification was done using four external cohorts, adding depth to the sample repertoire. Evaluation of immune cell infiltration was undertaken through single-sample GSEA. All statistical analyses were conducted using R (Version: 4.2.2), with significance set at a P value below 0.05. Employing the GSEA method, 7530 gene sets were computed. From this, 19 intersecting pathways were discerned to be consistently upregulated across all cohorts, which pertained to cell adhesion, development, metabolism, immune response, and protein regulation. This corresponded to 83 unique genes. Machine learning insights culminated in the LASSO regression model, which outperformed others with an average AUC of 0.942. This model's efficacy was further ratified across four external cohorts, with AUC values ranging from 0.694 to 0.873 and significant Kappa statistics indicating its predictive accuracy. The LASSO logistic regression model highlighted 13 genes, with LCN2, ASS1, and IRAK3 emerging as pivotal. Notably, LCN2 showcased significantly heightened expression in active UC patients compared to both non-active patients and healthy controls (P < 0.05). Investigations into the correlation between these genes and immune cell infiltration in UC highlighted activated dendritic cells, with statistically significant positive correlations noted for LCN2 and IRAK3 across multiple datasets. Through comprehensive gene expression analysis and machine learning, a potent LASSO-based diagnostic model for UC was developed. Genes such as LCN2, ASS1, and IRAK3 hold potential as both diagnostic markers and therapeutic targets, offering a promising direction for future UC research and clinical application.
Subject(s)
Colitis, Ulcerative , Machine Learning , Humans , Colitis, Ulcerative/genetics , Colitis, Ulcerative/diagnosis , Algorithms , Gene Expression Profiling/methods , Transcriptome , Interleukin-1 Receptor-Associated Kinases/genetics , Male , Female , Lipocalin-2/genetics , Case-Control Studies , Biomarkers , AdultABSTRACT
OBJECTIVE: To investigate causal associations between diabetes, insulin treatment and osteoporosis using LDSC analysis with a 2-way Mendelian randomization study. METHODS: LDSC analysis was used to estimate the likelihood-scale heritability of the genome-wide association study used with genetic correlation between the 2 genome-wide association study used. Then a 2-sample Mendelian randomization study was performed using 3 methods including inverse variance weighted, MR Egger, and weighted median. RESULTS: The genetic correlation between diabetes, insulin treatment (h2_Z = 3.70, P = 2.16e-4), osteoporosis (h2_Z = 4.93, h2_p = 8.13e-7) and genes was significant. There was a significant genetic correlation (rg = 0.122, P = 0.0211). There was a causal association between diabetes, insulin treatment and osteoporosis [P = 0.003754, OR (95%CI) = 0.998876 (0.998116-0.999636)], while no causal association existed between osteoporosis and insulin use (P = 0.998116-0.999636) causal association existed (P = 0.333244). CONCLUSION: There was a strong genetic correlation between diabetes, insulin treatment and osteoporosis, a causal association between diabetes, insulin treatment and osteoporosis, and no causal association between osteoporosis and diabetes, insulin treatment.
Subject(s)
Genome-Wide Association Study , Insulin , Mendelian Randomization Analysis , Osteoporosis , Humans , Insulin/therapeutic use , Insulin/adverse effects , Osteoporosis/genetics , Osteoporosis/epidemiology , Diabetes Mellitus/genetics , Diabetes Mellitus/epidemiology , Polymorphism, Single NucleotideABSTRACT
To investigate the higher order topology in MoTe2, the supercurrent interference phenomena in Nb/MoTe2/Nb planar Josephson junctions have been systematically studied. By analyzing the obtained interference pattern of the critical supercurrents and performing a comparative study of the edge-touched and untouched junctions, it's found that the supercurrent is dominated by the edges, rather than the bulk or surfaces of MoTe2. An asymmetric Josephson effect with a field-tunable sign is also observed, indicating the nontrivial origin of the edge states. These results not only provide initial evidence for the hinge states in the higher order topological insulator MoTe2, but also demonstrate the potential applications of MoTe2-based Josephson junctions in rectifying the supercurrent.
ABSTRACT
To investigate the causal relationship between metformin use and osteoporosis and different subtypes of osteoporosis using a 2-sample Mendelian randomization method. Data from genome-wide association studies were analyzed, with the exposure factor being metformin and the outcome variables being osteoporosis and different subtypes. Mendelian randomization was performed using Inverse Variance Weighted (IVW), MR-Egger, and weight median (WM) methods, and heterogeneity tests, horizontal multivariate analyses, and sensitivity analyses were performed. The IVW method analysis with metformin and osteoporosis showed Pâ =â 1.53E-04, OR (95%CI)â =â 1.81E-02 (2.27E-02-1.44E-01); the IVW method analysis with metformin and postmenopausal osteoporosis with pathologic fracture showed Pâ =â 2.22E-01, OR (95%CI)â =â 4.89E-02 (3. 83E-04-6.23Eâ +â 00); the IVW method using metformin with osteoporosis with pathological fracture showed that Pâ =â 2.14E-01, OR (95%CI)â =â 1.64Eâ +â 00(5.78E-02-6.44E-04); the IVW method using metformin with pharmacological osteoporosis with pathological fracture showed that Pâ =â 9. 83E- 01, OR (95%CI)â =â 1.11Eâ +â 00 (3.99E-05-3.11Eâ +â 04); IVW method of metformin use and pharmacological osteoporosis showed that Pâ =â 5.99E-01, OR (95%CI)â =â 2.27Eâ +â 01 (2.00E-04-2.57Eâ +â 06); there is a causal relationship between metformin use and osteoporosis, but there is no causal relationship between metformin use and postmenopausal osteoporosis with pathological fracture, osteoporosis with pathological fracture, pharmacological osteoporosis, and pharmacological osteoporosis with pathological fracture, and metformin use is a protective factor for osteoporosis.
Subject(s)
Fractures, Spontaneous , Metformin , Osteoporosis, Postmenopausal , Osteoporosis , Humans , Female , Osteoporosis, Postmenopausal/drug therapy , Genome-Wide Association Study , Mendelian Randomization Analysis , Osteoporosis/drug therapy , Osteoporosis/epidemiology , Osteoporosis/genetics , Metformin/adverse effectsABSTRACT
Osteosarcoma is the most common bone malignancy. There are many studies on the prognostic factors of children and adolescents, but the characteristics and prognostic factors of adult osteosarcoma are rarely studied. The aim of this study was to construct a nomogram for predicting the prognosis of adult osteosarcoma. Information on all osteosarcoma patients aged ≥ 18 years from 2004 to 2015 was downloaded from the surveillance, epidemiology and end results database. A total of 70% of the patients were included in the training set and 30% of the patients were included in the validation set. Univariate log-rank analysis and multivariate cox regression analysis were used to screen independent risk factors affecting the prognosis of adult osteosarcoma. These risk factors were used to construct a nomogram to predict 3-year and 5-year prognosis in adult osteosarcoma. Multivariate cox regression analysis yielded 6 clinicopathological features (age, primary site, tumor size, grade, American Joint Committee on Cancer stage, and surgery) for the prognosis of adult osteosarcoma patients in the training cohort. A nomogram was constructed based on these predictors to assess the prognosis of adult patients with osteosarcoma. Concordance index, receiver operating characteristic and calibration curves analyses also showed satisfactory performance of the nomogram in predicting prognosis. The constructed nomogram is a helpful tool for exactly predicting the prognosis of adult patients with osteosarcoma, which could enable patients to be more accurately managed in clinical practice.
Subject(s)
Bone Neoplasms , Osteosarcoma , Adolescent , Child , Humans , Adult , Prognosis , Nomograms , Osteosarcoma/epidemiology , Calibration , Bone Neoplasms/epidemiologyABSTRACT
OBJECTIVE: Complex cerebral arteriovenous malformations (AVMs) require a combined therapy of endovascular embolization and microsurgical resection to eliminate the lesion and maximize neurological protection, while a deliberate time interval might contribute to optimal clinical outcomes. The present study aimed to explore the feasibility of this paradigm. METHODS: All patients who underwent deliberately planned presurgery embolization and microsurgery resection between 2015 and 2023 were reviewed, with baseline data, postoperative complications, and follow-up outcomes recorded. The modified Rankin scale (mRS) was used to evaluate clinical outcomes, with mRS 0-2 defined as good. RESULTS: A total of 30 patients were included in the study (15 were ruptured AVMs). The median Spetzler-Martin grade of baseline AVMs was 3 (interquartile range: 2-3). The median interval between the last embolization and microsurgery was 5 days (interquartile range: 2.25-7). The complete removal rate was 100%, and the overall permanent complication rate was 16.67%. At the last follow-up, 26 patients achieved mRS 0-2, while 28 had improved or unaltered mRS. The last follow-up mRS significantly improved from baseline and discharge (P = 0.0006 and P = 0.006). The last follow-up mRS decreased by 0.65 for each additional day of time interval before the 4.4-day inflection point (ß = -0.65, P = 0.02) in the AVM ruptured cohort. CONCLUSIONS: The deliberately staged combined procedure of embolization and microsurgery might be a safe and efficacious strategy for Spetzler-Martin grade 2-5 AVMs, 4-5 days might be an appropriate staged time interval for ruptured AVMs, although further studies are needed to substantiate these findings.
Subject(s)
Embolization, Therapeutic , Intracranial Arteriovenous Malformations , Radiosurgery , Humans , Microsurgery/methods , Treatment Outcome , Retrospective Studies , Embolization, Therapeutic/methods , Intracranial Arteriovenous Malformations/diagnostic imaging , Intracranial Arteriovenous Malformations/surgery , Radiosurgery/methods , Rupture/surgeryABSTRACT
[This corrects the article DOI: 10.3389/fbioe.2023.1182187.].
ABSTRACT
Background: This study aims to evaluate the effectiveness and safety of low-dose (1.5â mg) fondaparinux for venous thromboembolism (VTE) prophylaxis in patients post-total knee arthroplasty (TKA). Methods: We retrospectively identified 314 patients who carried out the primary TKAs and received fondaparinux for VTE chemoprophylaxis between July 2020 and December 2021. A total of 141 TKA patients were excluded according to the exclusion criteria. Two groups of patients were established: the low-dose group included 84 patients who injected 1.5â mg of fondaparinux, and the regular-dose group included 89 patients who injected 2.5â mg of fondaparinux. The pre-operative blood analysis and coagulation assays were performed. The surgical time, the incidence of symptomatic VET, blood loss, wound complication, bleeding, drainage, and mortality of patients were determined and assessed. Results: The pre-operative blood analysis, body mass index, sex, age, and coagulation assays of patients in both groups were comparable. In terms of symptomatic pulmonary embolism and deep vein thrombosis, there was no significant difference (variation) between the two groups. However, patients in both groups showed a substantial difference in terms of blood loss, drain volume, wound complication, and transfusion rate. Conclusion: In prevention of VET in patients post-TKA, low-dose fondaparin is as effective as conventional dose fondaparinux. A significant decrease in blood loss, post-surgical transfusion rates, and wound complications were detected in patients given low-dose fondaparinux compared to those receiving regular-dose fondaparinux.
ABSTRACT
Polyetheretherketone (PEEK) has been used extensively in biomedical engineering and it is highly desirable for PEEK implant to possess the ability to promote cell growth and significant osteogenic properties and consequently stimulate bone regeneration. In this study, a manganese modified PEEK implant (PEEK-PDA-Mn) was fabricated via polydopamine chemical treatment. The results showed that manganese was successfully immobilized on PEEK surface, and the surface roughness and hydrophilicity significantly improved after surface modification. Cell experiments in vitro demonstrated that the PEEK-PDA-Mn possesses superior cytocompatibility in cell adhesion and spread. Moreover, the osteogenic properties of PEEK-PDA-Mn were proved by the increased expression of osteogenic genes, alkaline phosphatase (ALP), and mineralization in vitro. Further rat femoral condyle defect model was utilized to assess bone formation ability of different PEEK implants in vivo. The results revealed that the PEEK-PDA-Mn group promoted bone tissue regeneration in defect area. Taken together, the simple immersing method can modify the surface of PEEK, giving outstanding biocompatibility and enhanced bone tissue regeneration ability to the modified PEEK, which could be applied as an orthopedic implant in clinical.
ABSTRACT
Background: Osteoporosis (OP) is a common metabolic bone disease characterized by loss of bone mass. IL-10 is considered to be a powerful immune and inflammatory suppressor. This study aimed to assess association between genetic loci in IL-10 and susceptibility to OP. Methods: Association analysis between IL-10 genetic loci and OP risk through SNPStats online software. FPRP analysis (false-positive report probability) verified whether the positive results were noteworthy findings. Linkage disequilibrium (LD) and haplotype analysis were completed by Haploview 4.2 and SNPStats. Multi-factor dimensionality reduction (MDR) was used to assess interaction of SNP-SNP in susceptibility to OP. Results: Allele "G" of IL-10-rs1554286 (OR = 1.21, p = 0.013), allele "C" of IL-10-rs1518111 (OR = 1.22, p = 0.011), allele "C" of IL-10-rs3024490 (OR = 1.20, p = 0.018), and allele "G" of IL-10-rs1800871 (OR = 1.21, p = 0.015) were risk factors for OP. In females, smoking, drinking, or aging ≤60 years old participants, the above genetic loci are also significantly associated with the increased risk of OP. FPRP analysis showed that all positive results are noteworthy findings. There are significant differences in serum levels of uric acid, mean hemoglobin concentration, or mean hemoglobin among different genotypes of IL-10 gene loci. MDR showed that four loci model composed rs1554286, rs1518111, rs3021094, and rs1800871 is the best model for predicting OP risk. Conclusion: IL-10-rs1554286, -rs1518111, -rs3021094, and -rs1800871 are risk factors for susceptibility to OP.
ABSTRACT
Polyetheretherketone (PEEK) has been widely applied in biomedical engineering. However, the unsatisfactory bioactivity essentially limits the clinical application of PEEK. In this study, a simply immersing method was proposed to fabricate a dual-functional PEEK with antibacterial properties and enhanced bone integration. Firstly, the surface of PEEK was modified with a polydopamine (PDA) coating by incubating at dopamine solution. Afterward, the PEEK-PDA was modified with manganese (Mn) and silver (Ag) ions by the soaking method to fabricate the PEEK-PDA-Mn/Ag. The physicochemical capabilities of PEEK-PDA-Mn/Ag were further explored in the ions release, wettability, morphology, and element distributions. PEEK-PDA-Mn/Ag obviously accelerated the adhesion and distribution of MC3T3-E1 cells, indicating favorable biosafety in vitro. Meanwhile, the osteogenic properties of PEEK-PDA-Mn and PEEK-PDA-Mn/Ag were proved by the increased expression of osteogenic genes, alkaline phosphatase (ALP), and mineralization in vitro. Additionally, the wide antibacterial capabilities of PEEK-PDA-Mn/Ag were proved in both Staphylococcus aureus (S. aureus) and Escherichia coli (E. coli) in vitro. Furthermore, the PEEK-PDA-Mn/Ag was antibacterial with capability in enhancing osseointegration in vivo. Overall, the simply immersing method can modify the surface of PEEK, giving the bioactivity, biocompatibility, and antibacterial ability to the composited PEEK, which could be applied as an orthopedic implant in clinical.
Subject(s)
Osseointegration , Staphylococcus aureus , Escherichia coli , Polyethylene Glycols/chemistry , Benzophenones/pharmacology , Ketones/pharmacology , Ketones/chemistry , Anti-Bacterial Agents/pharmacology , Anti-Bacterial Agents/chemistry , Osteogenesis , Bacteria , IonsABSTRACT
OBJECTIVE: Osteoporosis (OP) is a widespread disease that causes risks of spine and hip fractures. Morinda officinalis polysaccharide (MOP) shows therapeutic potential in OP. This article intended to understand the mechanism by which MOP impacts bone mineral density (BMD) and serum trace elements in OP rats. METHODS: OP rat models were established by bilateral ovariectomy (OVX). Rats were intragastrically administered with MOP or ZLN005 [the activator of peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α)] since the first day after operation for 8 weeks. Microstructural changes in OP rats were analyzed using micro-computed tomography system. Contents of serum Zn, Cu, Fe, and Mg in rats were measured. Levels of serum superoxide dismutase (SOD), glutathione peroxidase (GSH-PX), GSH, and malondialdehyde (MDA) in rats were determined by Enzyme-linked immunosorbent assay. Protein levels of PGC-1α and peroxisome proliferator-activated receptor γ (PPARγ) in cartilage tissues of rats were determined via Western blotting. RESULTS: MOP enhanced BMD, bone volume per trabecular volume (BV/TV), Tb.N, and Tb.Th and reduced Tb.Sp in the distal femur of OVX rats, elevated levels of serum Cu, Fe, and Mg and contents of SOD, GSH, and GSH-PX and decreased MDA content. Moreover, MOP suppressed the PGC-1α/PPARγ pathway. Activation of PGC-1α partially abolished the action of MOP on ameliorating OP in OVX rats and strengthening anti-oxidation ability. CONCLUSION: MOP mitigated OP in OVX rats by inhibiting the PGC-1α/PPARγ pathway.
Subject(s)
Morinda , Osteoporosis , Animals , Female , Humans , Rats , Osteoporosis/drug therapy , Osteoporosis/etiology , Ovariectomy , Polysaccharides/pharmacology , Polysaccharides/therapeutic use , PPAR gamma/metabolism , Superoxide Dismutase/metabolism , X-Ray MicrotomographyABSTRACT
BACKGROUND: Osteoarthritis (OA) is a prevalent inflammatory joint disorder. microRNAs (miRNAs) are increasingly involved in OA. AIM: Our study is proposed to clarify the role of miR-124-3p in chondrocyte pyroptosis and cartilage injury in OA. METHODS: OA mouse model was established via the treatment of destabilization of the medial meniscus (DMM), and the in vitro cell model was also established as mouse chondrocytes were induced by lipopolysaccharide (LPS). Mouse cartilage injury was assessed using safranin-O-fast green staining, hematoxylin-eosin staining, and OARSI grading method. Expressions of miR-124-3p, MALAT1, KLF5, and CXCL11 were determined. Cartilage injury (MMP-13, osteocalcin), inflammation (IL-6, IL-2, TNF-, IL-1ß, and IL-18)- and pyroptosis-related factors (Cleaved Caspase-1 and GSDMD-N) levels were detected. Mechanically, MALAT1 subcellular localization was confirmed. The binding relationships of miR-124-3p and MALAT1 and MALAT1 and KLF5 were verified. MALAT1 half-life period was detected. Then, miR-124-3p was overexpressed using agomiR-124-3p to perform the rescue experiments with oe-MALAT1 or oe-CXCL11. RESULTS: miR-124-3p was downregulated in DMM mice and LPS-induced chondrocytes where cartilage injury, and increased levels of inflammation- and pyroptosis-related factors were found. miR-124-3p overexpression relieved cartilage injury and repressed chondrocyte pyroptosis. miR-124-3p bounds to MALAT1 to downregulate its stability and expression, and MALAT1 bounds to KLF5 to enhance CXCL11 transcription. Overexpression of MALAT1 or CXCL11 annulled the repressive function of miR-124-3p in chondrocyte pyroptosis. CONCLUSION: miR-124-3p reduced MALAT1 stability and inhibited the binding of MALAT1 and KLF5 to downregulate CXCL11, thereby suppressing chondrocyte pyroptosis and cartilage injury in OA.
Subject(s)
MicroRNAs , Osteoarthritis , RNA, Long Noncoding , Animals , Mice , Apoptosis , Cartilage/metabolism , Caspases/metabolism , Cells, Cultured , Chondrocytes/metabolism , Eosine Yellowish-(YS)/metabolism , Hematoxylin/metabolism , Inflammation/metabolism , Interleukin-18/metabolism , Interleukin-2/metabolism , Interleukin-6/metabolism , Lipopolysaccharides , Matrix Metalloproteinase 13/metabolism , MicroRNAs/metabolism , Osteoarthritis/genetics , Osteoarthritis/metabolism , Osteocalcin/metabolism , Pyroptosis/genetics , RNA, Long Noncoding/genetics , RNA, Long Noncoding/metabolismABSTRACT
Background: Acute ischemic stroke (AIS) due to isolated proximal posterior cerebral artery (PPCA) occlusion is rare but associated with high morbidity and mortality rates. However, the optimal treatment strategy for patients with AIS caused by PPCA remains unclear. We discuss our single-center experience with endovascular treatment (EVT) in patients with PPCA. Methods: Data from patients with AIS due to PPCA occlusion were retrospectively analyzed. We analyzed procedural details, the degree of reperfusion, functional outcomes, and complications. Functional outcomes were determined using the modified Rankin Scale (mRS) at 90 days, and good outcome was defined as mRS 0-2 at 90 days. Successful reperfusion was defined as modified treatment in cerebral ischemia (mTICI) 2b-3 after endovascular therapy. Safety variables included symptomatic hemorrhage (defined as an increase of four or more points in the National Institute of Health Stroke Scale score), vessel perforation or dissection, and new ischemic stroke in different territories. Results: Seven patients were included in this study. The mean age of the patients was 64 ± 12.4 years. Successful reperfusion was achieved in all seven patients (100%). Good outcomes were achieved at 90 days in 2 patients (28.6%), and favorable outcomes were observed in five patients (71.4%). One patient underwent angioplasty as rescue therapy after three attempts. One patient died because of severe gastrointestinal bleeding 24â h after EVT, which was probably a complication of intravenous alteplase. One patient had an embolism in the basilar artery and achieved complete reperfusion after rescue thrombectomy. Another patient had a complication of vessel dissection in the PPCA and underwent stent implantation as rescue therapy. We observed no recurrence of ischemic stroke or any intracranial hemorrhage on non-contrast computed tomography 24â h after the procedure. Conclusion: EVT may represent an alternative treatment strategy for patients with acute ischemic stroke caused by PPCA.
ABSTRACT
BACKGROUND: Ultrasound is a critical non-invasive test for preoperative diagnosis of ovarian cancer. Deep learning is making advances in image-recognition tasks; therefore, we aimed to develop a deep convolutional neural network (DCNN) model that automates evaluation of ultrasound images and to facilitate a more accurate diagnosis of ovarian cancer than existing methods. METHODS: In this retrospective, multicentre, diagnostic study, we collected pelvic ultrasound images from ten hospitals across China between September 2003, and May 2019. We included consecutive adult patients (aged ≥18 years) with adnexal lesions in ultrasonography and healthy controls and excluded duplicated cases and patients without adnexa or pathological diagnosis. For DCNN model development, patients were assigned to the training dataset (34â488 images of 3755 patients with ovarian cancer, 541â442 images of 101â777 controls). For model validation, patients were assigned to the internal validation dataset (3031 images of 266 patients with ovarian cancer, 5385 images of 602 with benign adnexal lesions), external validation datasets 1 (486 images of 67 with ovarian cancer, 933 images of 268 with benign adnexal lesions), and 2 (1253 images of 166 with ovarian cancer, 5257 images of 723 benign adnexal lesions). Using these datasets, we assessed the diagnostic value of DCNN, compared DCNN with 35 radiologists, and explored whether DCNN could augment the diagnostic accuracy of six radiologists. Pathological diagnosis was the reference standard. FINDINGS: For DCNN to detect ovarian cancer, AUC was 0·911 (95% CI 0·886-0·936) in the internal dataset, 0·870 (95% CI 0·822-0·918) in external validation dataset 1, and 0·831 (95% CI 0·793-0·869) in external validation dataset 2. The DCNN model was more accurate than radiologists at detecting ovarian cancer in the internal dataset (88·8% vs 85·7%) and external validation dataset 1 (86·9% vs 81·1%). Accuracy and sensitivity of diagnosis increased more after DCNN-assisted diagnosis than assessment by radiologists alone (87·6% [85·0-90·2] vs 78·3% [72·1-84·5], p<0·0001; 82·7% [78·5-86·9] vs 70·4% [59·1-81·7], p<0·0001). The average accuracy of DCNN-assisted evaluations for six radiologists reached 0·876 and were significantly augmented when they were DCNN-assisted (p<0·05). INTERPRETATION: The performance of DCNN-enabled ultrasound exceeded the average diagnostic level of radiologists matched the level of expert ultrasound image readers, and augmented radiologists' accuracy. However, these observations warrant further investigations in prospective studies or randomised clinical trials. FUNDING: National Key Basic Research Program of China, National Sci-Tech Support Projects, and National Natural Science Foundation of China.
Subject(s)
Deep Learning , Ovarian Neoplasms , Adolescent , Adult , China , Female , Humans , Ovarian Neoplasms/diagnostic imaging , Prospective Studies , Retrospective Studies , Ultrasonography/methodsABSTRACT
Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) is a member of transcriptional coactivator of the peroxisome proliferator-activated receptor. It is involved in lipid metabolism, energy metabolism, adipocyte differentiation and regulation of mitochondrial biogenesis. Therefore, the genetic variation of PPARGC1A gene will be of great value. The purposes of this study were to detect novel InDels within the PPARGC1A gene and analyze the effects of genetic polymorphisms on growth traits. We detected a novel 17 bp insertion polymorphism within the eleventh intron of the sheep PPARGC1A gene. Experimental results revealed that the InDel (insertion/deletion) genotypes distribution of the seven breeds of sheep was significant differences, of which three genotypes were detected. After correlation analysis, there were many significant phenotypic differences between the body size traits of the three genotypes. Interestingly, the dominant genotype was different in body weight both in STHS sheep and HS sheep. In summary, the 17 bp insertion polymorphism within the PPARGC1A gene had a great influence on the growth traits of sheep, which may provide a potential theoretical basis for marker-assisted selection in sheep genetic breeding.
Subject(s)
INDEL Mutation , Polymorphism, Genetic , Animals , Genotype , INDEL Mutation/genetics , Peroxisome Proliferator-Activated Receptor Gamma Coactivator 1-alpha/genetics , Phenotype , Polymorphism, Genetic/genetics , Sheep/geneticsABSTRACT
PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics.
Subject(s)
INDEL Mutation , Animals , Body Weight , Cattle/genetics , Gene Expression , Genotype , INDEL Mutation/genetics , PhenotypeABSTRACT
Background and purpose: The management of patients with symptomatic non-acute atherosclerotic intracranial artery occlusion (sNAA-ICAO), which is a special subset with high morbidity and a high probability of recurrent serious ischemic events despite standard medical therapy, has been clinically challenging. A number of small-sample clinical studies have discussed endovascular recanalization for sNAA-ICAO and the lack of a uniform standard of operation time. The purpose of this study was to investigate the time correlation of successful recanalization. Methods: From January 2013 to August 2021, 69 consecutive patients who underwent endovascular recanalization for sNAA-ICAO were analyzed retrospectively in the First Affiliated Hospital of Harbin Medical University. The technical success rate, periprocedural complications, and rate of TIA/ischemic stroke during follow-up were evaluated. Results: The overall technical success rate was 73.91% (51/69), and the rate of perioperative complications was 37.68% (26/69). The percentage of patients with perioperative symptoms was 27.53% (19/69). The rate of serious symptomatic perioperative complications was 8.70% (6/69). After adjusting for age, sex, and BMI, the effect of the time from the last symptom to operation on successful recanalization was 0.42 (IQR, 0.20, 0.88, P = 0.021), before the inflection point (51 days). Conclusions: Endovascular recanalization for sNAA-ICAO is technically feasible in reasonably selected patients. The perioperative safety is within the acceptable range. Before 51 days, the last symptoms to operation time, for every 10 days of delay, the probability of successful recanalization is reduced by 57%.
ABSTRACT
The recurrence of patients with epithelial ovarian cancer (EOC) is largely attributed to tumour cells escaping from the surveillance of immune cells. However, to date there is a lack of studies that have systematically evaluated the associations between the infiltration fraction of immune cells and the recurrence risk of EOC. Based on the micro-ribonucleic acid (microRNA) expression profiles of 441 EOC patients, we constructed a microRNA-based panel with recurrence prediction potential using non-negative matrix factorization consensus clustering. Then, we evaluated the association between recurrence risk and infiltration proportions among 10 immune cell types by CIBERSORT and a multivariable Cox regression model. As a result, we identified a 72-microRNA-based panel that could stratify patients into high and low risk of recurrence. The infiltration of plasma cells and M1 macrophages was consistently significantly associated with the risk of recurrence in patients with EOC. Plasma cells were significantly associated with a decreased risk of relapse [hazard ratio (HR) = 0.58, p = 0.006), while M1 macrophages were associated with an increased risk of relapse (HR = 1.59, p = 0.003). Therefore, the 72-microRNA-based panel, M1 macrophages and plasma cells may hold potential to serve as recurrence predictors of EOC patients in clinical practice.