General Direct Anticancer Effects of Deer Growing Antler Extract in Several Tumour Cell Lines, and Immune System-Mediated Effects in Xenograft Glioblastoma.

Deer antlers are the fastest growing tissue. Because they are based on proto-oncogenes, to avoid the risk of cancer, antlers evolved strong anticancer mechanisms, and thus their extract (DVA) is effective also against the few human tumours studied so far. We assessed whether DVA is a general anticancer compound by testing the direct effects in cells of different tumours: glioblastoma (GBM; lines U87MG and U251), colorectal (CRC; lines DLD-1, HT-29, SW480, and SW620), breast cancer (BRCA; lines MCF7, SKBR3, and PA00), and leukaemia (THP-1). DVA reduced the viability of tumours but not healthy cells (NHC; lines 293T and HaCaT). Mobility decreased at least for the longest test (72 h). Intraperitoneal/oral 200 mg DVA/kg administration in GBM xenograft mice for 28 d reduced tumour weight by 66.3% and 61.4% respectively, and it also reduced spleen weight (43.8%). In addition, tumours treated with DVA showed symptoms of liquefactive necrosis. Serum cytokines showed DVA up-regulated factors related to tumour fighting and down-regulated those related to inducing immune tolerance to the tumour. DVA shows general anticancer effects in the lines tested and, in GBM mice, also strong indirect effects apparently mediated by the immune system. DVA may contain a future anticancer medicine without secondary effects.

Traces of Human-Mediated Selection in the Gene Pool of Red Deer Populations.

In this study, we analysed the effect of human-mediated selection on the gene pool of wild and farmed red deer populations based on genotyping-by-sequencing data. The farmed red deer sample covered populations spread across seven countries and two continents (France, Germany, Hungary, Latvia, New Zealand, Poland, and Slovakia). The Slovak and Spain wild red deer populations (the latter one in a large game estate) were used as control outgroups. The gene flow intensity, relationship and admixture among populations were tested by the Bayesian approach and discriminant analysis of principal components (DAPC). The highest gene diversity (He = 0.19) and the lowest genomic inbreeding (FHOM = 0.04) found in Slovak wild population confirmed our hypothesis that artificial selection accompanied by bottlenecks has led to the increase in overall genomic homozygosity. The Bayesian approach and DAPC consistently identified three separate genetic groups. As expected, the farmed populations were clustered together, while the Slovak and Spanish populations formed two separate clusters. Identified traces of genetic admixture in the gene pool of farmed populations reflected a strong contemporary migration rate between them. This study suggests that even if the history of deer farming has been shorter than traditional livestock species, it may leave significant traces in the genome structure.

SWATH-MS Quantitative Proteomic Analysis of Deer Antler from Two Regenerating and Mineralizing Sections.

Antlers are the only organ in the mammalian body that regenerates each year. They can reach growth rates of 1-3 cm/day in length and create more than 20 cm2/day of skin in the antler tips (their growth centers). Previous proteomic studies regarding antlers have focused on antler growth centers (tips) compared to the standard bone to detect the proteins involved in tissue growth. However, proteins of cell differentiation and regeneration will be more accurately detected considering more growing tissues. Thus, we set out to compare proteins expressed in antler tips (the highest metabolism rate and cell differentiation) vs. middle sections (moderate cell growth involving bone calcification), using ribs as controls. Samples were obtained in mid-June with antlers' phenology corresponding to the middle of their growth period. Quantitative proteomic analysis identified 259 differentially abundant proteins mainly associated with antioxidant metabolic mechanisms, protein formation and Wnt signalling pathway, meanwhile, the mid antler section was linked to blood proteins. The high metabolic rate and subsequent risk of oxidative stress also seem to have resulted in strong antioxidant mechanisms. These results suggest that redox regulation of proteins is a key factor in the model of deer antler regeneration.

Physicochemical, Microbiological and Technological Properties of Red Deer (Cervus elaphus) Milk during Lactation.

This study describes chemical, physical, microbiological and technological characteristics of red deer milk and the effect of lactation on these parameters in order to know their potential aptitude to elaborate dairy products. During 18 weeks, milk from five hinds was monitored for composition, bacteriology, somatic cell count (SCC), physical properties and rennet coagulation. Mean values (g/100 g) for fat, protein, lactose and dry matter were 10.4, 7.1, 4.3 and 24.2, respectively, and for urea, 265 mg/100 mL. Except for lactose, a significant increase in these components was observed (p < 0.01) as lactation progressed. The average values for bacteriology and SCC were 5.3 log cfu/mL and 4.7 log cells/mL, respectively. Regarding physical properties, conductivity (mean: 2.8 ms/cm), viscosity (3.1 Cp), coordinates L* (89.9) and a* (-3.1) and milk fat globule diameter (D4,3: 6.1 µm) increased along with lactation while density (1.038 g/mL) decreased (p < 0.01). The pH (6.7), acidity (22.9° Dornic), coordinate b* (8.4) and ethanol stability (66.6% v/v) were stable during the study period. The stage of lactation also has a significant impact on milk coagulation properties and mean curd yield was 3.29 g/10 mL. These results suggest that red deer milk could be a potential innovative source of milk for the dairy industry.

Anti-tumour activity of deer growing antlers and its potential applications in the treatment of malignant gliomas.

A recent study showed that antlers have evolved a high rate of growth due to the expression of proto-oncogenes and that they have also evolved to express several tumour suppressor genes to control the risk of cancer. This may explain why deer antler velvet (DAV) extract shows anti-tumour activity. The fast growth of antler innervation through the velvet in close association to blood vessels provides a unique environment to study the fast but non-cancerous proliferation of heterogeneous cell populations. We set out to study the anti-cancer effect of DAV in glioblastoma (GB) cell lines in comparison with temozolomide, a chemotherapeutic drug used to treat high-grade brain tumours. Here we report, for the first time, that DAV extract from the tip, but not from mid-parts of the antler, exhibits an anti-tumour effect in GB cell lines (T98G and A172) while being non-toxic in non-cancerous cell lines (HEK293 and HACAT). In T98G cells, DAV treatment showed reduced proliferation (37.5%) and colony-formation capacity (84%), inhibited migration (39%), induced changes in cell cycle progression, and promoted apoptosis. The anticancer activity of DAV extract as demonstrated by these results may provide a new therapeutic strategy for GB treatment.

Novel DNA Aptamers Against CCL21 Protein: Characterization and Biomedical Applications for Targeted Drug Delivery to T Cell-Rich Zones.

The chemokine (C-C motif) ligand 21 (CCL21) is a cytokine that attracts CCR7-positive cells to the T cell (paracortical) zone of lymph nodes by directional migration of these cells along the CCL21 gradient. In this article, we sought to mimic this chemotactic mechanism, by identifying a novel aptamer that binds CCL21 with high affinity. In vitro selection of DNA aptamers was performed by the Systematic Evolution of Ligands by Exponential Enrichment. Quantitative polymerase chain reaction (qPCR) and enzyme-linked oligonucleotide assay were used to screen for high-affinity aptamers against human and mouse CCL21 protein, respectively. Three such aptamers were identified. Surface plasmon resonance showed equilibrium dissociation constant (Kd) for these three aptamers in the nano to picomolar range. Cytotoxicity assays showed <10% toxicity in HEK293 and HL-60 cells. Last, in vivo biodistribution was successfully performed and CCL21 chemokine-binding aptamers were quantified within the draining lymph nodes and spleen using qPCR. Fluorescence microscopy revealed that one of the aptamers showed significantly higher presence in the paracortex than the control aptamer. The use of anti-CCL21 aptamers to mimic the chemotaxis mechanism thus represents a promising approach to achieve targeted delivery of drugs to the T cell-rich zones of the lymph node. This may be important for the treatment of HIV infection and the eradication of HIV reservoirs.

Potential inhibition of HIV-1 encapsidation by oligoribonucleotide-dendrimer nanoparticle complexes.

BACKGROUND: Encapsidation, the process during which the genomic RNA of HIV is packaged into viral particles, is an attractive target for antiviral therapy. This study explores a novel nanotechnology-based strategy to inhibit HIV encapsidation by an RNA decoy mechanism. The design of the 16-mer oligoribonucleotide (RNA) decoy is based on the sequence of stem loop 3 (SL3) of the HIV packaging signal (Ψ). Recognition of the packaging signal is essential to the encapsidation process. It is theorized that the decoy RNA, by mimicking the packaging signal, will disrupt HIV packaging if efficiently delivered into lymphocytes by complexation with a carbosilane dendrimer. The aim of the study is to measure the uptake, toxicity, and antiviral activity of the dendrimer-RNA nanocomplex. MATERIALS AND METHODS: A dendriplex was formed between cationic carbosilane dendrimers and the RNA decoy. Uptake of the fluorescein-labeled RNA into MT4 lymphocytes was determined by flow cytometry and confocal microscopy. The cytoprotective effect (50% effective concentration [EC50]) and the effect on HIV replication were determined in vitro by the methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay and viral load measurements, respectively. RESULTS: Flow cytometry and confocal imaging demonstrated efficient transfection of lymphocytes. The dendriplex containing the Ψ decoy showed some activity (EC50 =3.20 µM, selectivity index =8.4). However, there was no significant suppression of HIV viral load. CONCLUSION: Oligoribonucleotide decoys containing SL3 of the packaging sequence are efficiently delivered into lymphocytes by carbosilane dendrimers where they exhibit a modest cytoprotective effect against HIV infection.

Analysis of Current Pulses in HeLa-Cell Permeabilization Due to High Voltage DC Corona Discharge.

Corona discharges are commonly utilized for numerous practical applications, including bio-technological ones. The corona induced transfer of normally impermeant molecules into the interior of biological cells has recently been successfully demonstrated. The exact nature of the interaction of the corona discharge with a cell membrane is still unknown, however, previous studies have suggested that it is either the electric fields produced by ions or the chemical interaction of the reactive species that result in the disruption of the cell membrane. This disruption of the cell membrane allows molecules to permeate into the cell. Corona discharge current constitutes a series of pulses, and it is during these pulses that the ions and reactive species are produced. It stands to reason, therefore, that the nature of these corona pulses would have an influence on the level of cell permeabilization and cell destruction. In this investigation, an analysis of the width, rise-time, characteristic frequencies, magnitude, and repetition rate of the nanosecond pulses was carried out in order to establish the relationship between these factors and the levels of cell membrane permeabilization and cell destruction. Results obtained are presented and discussed.

Cell-based Assays for Assessing Toxicity: A Basic Guide.

Assessment of toxicity is an important component of the drug discovery process. Cellbased assays are a popular choice for assessing cytotoxicity. However, these assays are complex because of the wide variety of formats and methods that are available, lack of standardization, confusing terminology and the inherent variability of biological systems and measurement. This review is intended as a guide on how to take these factors into account when planning, conducting and/or interpreting cell based toxicity assays.

Long-term maintenance of skin immune system in a NOD-Scid IL2rγ(null) mouse model transplanted with human skin.

We developed a NOD-Scid IL2rγ(null) mouse model transplanted with human skin that brings fundamental insight on in vivo cellular mechanisms of intradermal immunization and antigen presentation by dermal dendritic and epidermal Langerhans cells for skin T-cell immunity. Indeed, T-cell immunity is a crucial checkpoint for the induction of in vivo rapid control of skin infection. With the long-term preservation of a complete human skin immune system, this model offers the unique opportunity not only to better understand mechanisms of skin immune response but also to test new compounds and devices for cutaneous routes of vaccination, as well as new therapeutics approach for skin diseases, allergies or infections.

Synthesis, structure and molecular modelling of anionic carbosilane dendrimers.

Anionic carbosilane dendrimers of generations 1-3 have been synthesized containing carboxylate G(n)X(C(2)H(4)CO(2)Na)(m) and sulfonate G(n)X(C(2)H(4)SO(3)Na)(m) peripheral groups and derived from two different cores, 1,3,5-(HO)(3)C(6)H(3) (X = O(3)) and Si(C(3)H(5))(4) (X = Si). The peripheral anionic groups make these dendrimers water soluble, despite their highly hydrophobic framework. These dendrimers present a net negative charge in water, which was influenced by the pH of the medium. This characteristic was studied by pH titration. Also molecular modeling calculations have been performed to study differences in an aqueous medium between carboxylate and sulfonate dendrimers of different cores. The results obtained were also compared with those obtained from DOSY NMR experiments and zeta-potential measurements.

Gene therapy in HIV-infected cells to decrease viral impact by using an alternative delivery method.

The ability of dendrimer 2G-[Si{O(CH(2))(2)N(Me)(2) (+)(CH(2))(2)NMe(3) (+)(I(-))(2)}](8) (NN16) to transfect a wide range of cell types, as well as the possible biomedical application in direct or indirect inhibition of HIV replication, was investigated. Cells implicated in HIV infection such as primary peripheral blood mononuclear cells (PBMC) and immortalized suspension cells (lymphocytes), primary macrophages and dendritic cells, and immortalized adherent cells (astrocytes and trophoblasts) were analyzed. Dendrimer toxicity was evaluated by mitochondrial activity, cell membrane rupture, release of lactate dehydrogenase, erythrocyte hemolysis, and the effect on global gene expression profiles using whole-genome human microarrays. Cellular uptake of genetic material was determined using flow cytometry and confocal microscopy. Transfection efficiency and gene knockdown was investigated using dendrimer-delivered antisense oligonucleotides and small interfering RNA (siRNA). Very little cytotoxicity was detected in a variety of cells relevant to HIV infection and erythrocytes after NN16 dendrimer treatment. Imaging of cellular uptake showed high transfection efficiency of genetic material in all cells tested. Interestingly, NN16 further enhanced the reduction of HIV protein 24 antigen release by antisense oligonucleotides due to improved transfection efficiency. Finally, the dendrimer complexed with siRNA exhibited therapeutic potential by specifically inhibiting cyclooxygenase-2 gene expression in HIV-infected nervous system cells. NN16 dendrimers demonstrated the ability to transfect genetic material into a vast array of cells relevant to HIV pathology, combining high efficacy with low toxicity. These results suggest that NN16 dendrimers have the potential to be used as a versatile non-viral vector for gene therapy against HIV infection.

Binding properties of water-soluble carbosilane dendrimers.

Dendrimers have been proposed as new carriers for drug delivery. They have distinctive characteristics, such as uniform and controlled size, monodispersity and modifiable surface group functionality, which make them extremely useful for biomedical applications. In this study, the binding capacity of water-soluble carbosilane dendrimers was examined. A double fluorimetric titration method with 1-anilinonaphthalene-8-sulphonic acid (ANS) was used to estimate the binding constant and the number of binding centers per dendrimer molecule. The data obtained suggest that ANS interacts non-covalently with the dendrimers. Second generation dendrimers have an open, asymmetric structure that allows them to encapsulate ANS. The ability of the polymers to interact with DNA was assessed by an ethidium bromide (EB) displacement assay. All the dendrimers studied bound to DNA in competition with EB, though the strength of binding varied. Dendrimer interactions with a protein (BSA) were tested using fluorescence quenchers. The dendrimers caused no conformation change in the protein, indicating that interactions between carbosilane dendrimers and BSA are weak and occur preferentially at the protein surface.

Analysis of interaction between dendriplexes and bovine serum albumin.

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.

Water-soluble carbosilane dendrimers protect phosphorothioate oligonucleotides from binding to serum proteins.

Treatment of dendriplexes formed between water-soluble carbosilane dendrimers and phosphorothioate oligodeoxynucleotides (ODN) with the anionic detergent sodium dodecyl sulfate disrupted the complexes indicating that the nature of the union in such dendriplexes is merely electrostatic. However, dendriplexes were not dissociated by serum proteins like bovine or human serum albumins, as assessed by gel electrophoresis and fluorescence experiments. This would imply a dendrimer-mediated protective effect able to prevent ODN interactions with serum proteins and additionally could translate into a reduction of the ODN doses needed to achieve the biological effects. The employment of carbosilane dendrimers as carriers may solve the problem of ODN kidnapping by plasmatic proteins as a key drawback for therapeutics involving ODNs. As examples, transfection processes on normal primary peripheral blood cells and diagnosis of HIV infection in the presence of serum have been assayed.

Water-soluble carbosilane dendrimers: synthesis biocompatibility and complexation with oligonucleotides; evaluation for medical applications.

Novel amine- or ammonium-terminated carbosilane dendrimers of type nG-[Si{OCH2(C6H3)-3,5-(OCH2CH2NMe2)2}]x, nG-[Si{O(CH2)2N(Me)(CH2)2NMe2}]x and nG-[Si{(CH2)3NH2}]x or nG-[Si{OCH2(C6H3)-3,5-(OCH2CH2NMe3 +I-)2}]x, nG-[Si{O(CH2)2N(Me)(CH2)2NMe3 +I-}]x, and nG-[Si{(CH2)3NH3 +Cl-}]x have been synthesized and characterized up to the third generation by two strategies: 1) alcoholysis of Si--Cl bonds with amino alcohols and subsequent quaternization with MeI, and 2) hydrosilylation of allylamine with Si--H bonds of the dendritic systems and subsequent quaternization with HCl. Quaternized carbosilane dendrimers are soluble in water, although degradation is apparent due to hydrolysis of Si--O bonds. However, dendrimers containing Si--C bonds are water-stable. The biocompatibility of the second-generation dendrimers in primary cell cultures of peripheral blood mononuclear cells (PBMCs) and erythrocytes have been analyzed, and they show good toxicity profiles over extended periods. In addition, we describe a study on the interactions between the different carbosilane dendrimers and DNA oligodeoxynucleotides (ODNs) and plasmids along with a comparative analysis of their toxicity. They can form complexes with DNA ODNs and plasmids at biocompatible doses via electrostatic interaction. Also a preliminary transfection assay has been accomplished. These results demonstrate that the new ammonium-terminated carbosilane dendrimers are good base molecules to be considered for biomedical applications.