Early changes in skin surface temperature predict body temperature increases in patients with fever: A pilot study.

OBJECTIVE: To investigate the correlation between body temperature and skin surface temperature in intensive care unit patients and to identify specific indicators of skin surface temperature for early fever detection. RESEARCH METHODOLOGY/DESIGN: This pilot study was a prospective, observational investigation conducted at National Cheng Kung University Hospital in Tainan, Taiwan. A total of 54 patients admitted to the Surgical Intensive Care Unit of a tertiary hospital between April and August 2020 were included. Patients utilized the wearable device HEARThremoTM to continuously monitor skin surface temperature and heart rate. Analysis of Variance was applied to identify the association of skin surface temperature with different body temperature groups. The comparison between skin surface temperature and fever over eight time intervals was studied using a generalized estimating equation. RESULTS: In 34 patients (63 %) with a fever (≥38 °C), skin surface temperature increased (P < 0.001) when body temperature increased. The maximum skin surface temperature was significantly associated with fever 180-210 min before the fever events occurred (OR: 2.22, 95 % CI: 1.30-3.80). The mean skin surface temperature was associated with fever 120-150 min before the fever events (OR: 8.70, 95 % CI: 2.08-36.36). CONCLUSIONS: Skin surface temperature can be an important early predictive sign before the onset of fever. Continuous temperature monitoring can detect fever early and initiate treatment in advance. This study serves as a preliminary exploration in this area, laying the groundwork for future comprehensive research. IMPLICATIONS FOR CLINICAL PRACTICE: Continuous monitoring of skin surface temperature empowers nurses to swiftly detect fever, transcending conventional methods. This proactive approach allows for the early identification of physiological abnormalities, facilitating the prompt initiation of further physical assessments and relevant examinations for early treatment commencement.

Cysteine-cysteine Chemokine Receptor Type 5 Plays a Critical Role in Exercise Performance by Regulating Mitochondrial Content in Skeletal Muscle.

Cysteine-cysteine chemokine receptor type 5 (CCR5) is thought to play an important role in the trafficking of lymphoid cells but has recently also been associated with AMPK signaling pathways that are implicated in energy metabolism in skeletal muscle. We hypothesized that genetic deletions of CCR5 would alter mitochondria content and exercise performance in mice. CCR5-/- and wild-type mice with the same genetic background were subjected to endurance exercise and grip strength tests. The soleus muscle was stained with immunofluorescence for myosin heavy chain 7 (MYH7) and succinate dehydrogenase (SDH) analysis as well as the expression of genes associated with muscle atrophy and mitochondrial oxidative phosphorylation were measured using qPCR. Although there were no differences in the weight of the soleus muscle between the CCR5-/- group and the wild-type mice, the CCR5-/- mice showed the following muscular dysfunctions: (i) decreased MYH7 percentage and cross-section area, (ii) higher myostatin and atrogin-1 mRNA levels, (iii) dropped expression of mitochondrial DNA-encoded electron respiratory chain genes (cytochrome B, cytochrome c oxidase subunit III, and ATP synthase subunit 6) as well as mitochondrial generation genes (PPARγ and PGC-1α), and (iv) lower SDH activity and exercise performance when compared with wild-type mice. In addition, genes associated with mitochondrial biogenesis (PGC-1α, PPARγ, and MFN2) and mitochondrial complex (ND4 and Cytb) were upregulated when the skeletal muscle cell line C2C12 was exposed to cysteine-cysteine chemokine ligand 4 (a ligand of CCR5) in vitro. These findings suggested that attenuation of endurance exercise performance is related to the loss of mitochondrial content and lower SDH activity of soleus muscle in CCR5 knockout mice. The present study provides evidence indicating that the chemokine receptor CCR5 might modulate the skeletal muscle metabolic energy system during exercise.

Epidemiology of Oral Cancer in Taiwan: A Population-Based Cancer Registry Study.

Oral cancer (OC) is one of the most common cancers worldwide, and its incidence has regional differences. In this study, the cancer registry database obtained from 1980 to 2019 was used to analyze the characteristic of incidence of OC by average annual percentage change (AAPC) and an age-period-cohort model. Spearman's correlation was used to analyze the relationship between the age-standard incidence rates (ASR) of OC and related risk factors. Our results showed that the ASR of OC increased from 4.19 to 27.19 per 100,000 population with an AAPC of 5.1% (95% CI = 3.9-6.3, p value < 0.001) in men and from 1.16 to 2.8 per 100,000 population with an AAPC of 3.1% (95% CI = 2.6-3.6, p value < 0.001) in women between 1980-1984 and 2015-2019. The age-period-cohort model reported a trend of rising then declining for the rate ratio in men, with peaks occurring in the 1975 cohort, with a rate ratio of 6.80. The trend of incidence of oral cancer was related to changes in the consumption of cigarettes and alcohol and production of betel quid, with r values of 0.952, 0.979 and 0.963, respectively (all p values < 0.001). We strongly suggest avoiding these risk factors in order to prevent OC.

[Detection of Fever Using Continuous Skin Temperature Monitoring in Hospitalized Older Adults].

BACKGROUND: The continuous monitoring of body surface temperature has been proven to help detect potential fever events in hospitalized patients. However, the efficacy of using body surface temperature to detect fever in older adults remains unclear due to the relatively low and slower-to-change body surface temperature in this population. PURPOSE: This study was designed to investigate 1) the relationship between changes in body surface and routine tympanic temperatures, 2) the correlation between body surface temperature measurement frequency and detection of fever, and 3) the factors related to the incidence of fever in hospitalized older adults. METHODS: A prospective study was conducted on 33 hospitalized older adults aged 65 years or older who were suspected to have or diagnosed with an infection in an infectious disease and medical ward at a medical center in southern Taiwan from March to November 2020. Demographic, routine tympanic temperature, and heart rate data were collected by reviewing the participants' medical records. Body surface temperatures were monitored continuously using HEARThermo every 10 seconds until one of the following conditions were met: hospital discharge, no fever for three continuous days, and HEARThermo was removed. Descriptive analysis was used to compare the variations in body surface temperature and routine tympanic temperature measurements. Pearson correlation was used to analyze the correlation between different measurement frequencies and fever events. Finally, mixed effects logistic regression was used to analyze the factors significantly related to fever events. RESULTS: Seven hundred and twenty routine body temperature measurements were taken, with 209 (29.0%) fever events detected in 23 (69.7%) of the participants. The body surface temperatures were more closely correlated with tympanic temperatures during fever events than non-fever events (r = .260, p < .001). More fever events were detected using body surface temperature monitoring frequencies of every 10 seconds and every 1 minute. After controlling for demographic factors, the results of the mixed effect model indicate that body surface temperature and heart rate are significant factors related to fever events in hospitalized older adults (odds ratio, OR: 1.74, p < .001; OR: 1.11, p < .001). CONCLUSIONS / IMPLICATIONS FOR PRACTICE: The continuous monitoring of body surface temperature may improve the detection of fever events in hospitalized older adults. The application of wearable devices and cloud platforms may further facilitate the real-time assessment and care capabilities of nurses, thus reducing their workload and improving care quality.

The anti-melanogenic effects of 3-O-ethyl ascorbic acid via Nrf2-mediated α-MSH inhibition in UVA-irradiated keratinocytes and autophagy induction in melanocytes.

3-O-ethyl ascorbic acid (EAA) is an ether-derivative of ascorbic acid, known to inhibit tyrosinase activity, and is widely used in skincare formulations. Nevertheless, the molecular mechanisms underlying the EAA's effects are poorly understood. Here, the anti-melanogenic activity of EAA was demonstrated through Nrf2-mediated α-MSH inhibition in UVA-irradiated keratinocytes (HaCaT) and autophagy induction and inhibition of α-MSH-stimulated melanogenesis in melanocytes (B16F10). EAA pretreatment increased the HaCaT cell viability but suppressed ROS-mediated p53/POMC/α-MSH pathways in UVA-irradiated cells. Further, the conditioned medium from EAA-pretreated and UVA-irradiated HaCaT cells suppressed the MITF-CREB-tyrosinase pathways leading to the inhibition of melanin synthesis in B16F10 cells. EAA treatment increased nuclear Nrf2 translocation via the p38, PKC, and ROS pathways leading to HO-1, γ-GCLC, and NQO-1 antioxidant expression in HaCaT cells. However, Nrf2 silencing reduced the EAA-mediated anti-melanogenic activity, evidenced by impaired antioxidant gene expression and uncontrolled ROS (H202) generation following UVA irradiation. In B16F10 cells, EAA-induced autophagy was shown by enhanced LC3-II levels, AVO formation, Beclin-1 upregulation, and activation of p62/SQSTM1. Further, EAA-induced anti-melanogenic activity was substantially decreased in autophagy inhibitor (3-MA) pretreated or LC3 knockdown B16F10 cells. Notably, transmission electron microscopy data showed increased melanosome-engulfing autophagosomes in EAA-treated B16F10 cells. Moreover, EAA also down-regulated MC1R, TRP-1/-2, tyrosinase expressions, and melanin synthesis by suppressing the cAMP-CREB-mediated MITF expression in B16F10 cells stimulated with α-MSH. In vivo studies on the zebrafish model further confirmed that EAA inhibited tyrosinase expression/activity and endogenous pigmentation. In conclusion, 3-O-ethyl ascorbic acid is an effective skin-whitening agent and could be used as a topical agent for cosmetic purposes.

An Innovative Wearable Device For Monitoring Continuous Body Surface Temperature (HEARThermo): Instrument Validation Study.

BACKGROUND: Variations in body temperature are highly informative during an illness. To date, there are not many adequate studies that have investigated the feasibility of a wearable wrist device for the continuous monitoring of body surface temperatures in humans. OBJECTIVE: The objective of this study was to validate the performance of HEARThermo, an innovative wearable device, which was developed to continuously monitor the body surface temperature in humans. METHODS: We implemented a multi-method research design in this study, which included 2 validation studies-one in the laboratory and one with human subjects. In validation study I, we evaluated the test-retest reliability of HEARThermo in the laboratory to measure the temperature and to correct the values recorded by each HEARThermo by using linear regression models. We conducted validation study II on human subjects who wore HEARThermo for the measurement of their body surface temperatures. Additionally, we compared the HEARThermo temperature recordings with those recorded by the infrared skin thermometer simultaneously. We used intraclass correlation coefficients (ICCs) and Bland-Altman plots to analyze the criterion validity and agreement between the 2 measurement tools. RESULTS: A total of 66 participants (age range, 10-77 years) were recruited, and 152,881 completed data were analyzed in this study. The 2 validation studies in the laboratory and on human skin indicated that HEARThermo showed a good test-retest reliability (ICC 0.96-0.98) and adequate criterion validity with the infrared skin thermometer at room temperatures of 20°C-27.9°C (ICC 0.72, P<.001). The corrected measurement bias averaged -0.02°C, which was calibrated using a water bath ranging in temperature from 16°C to 40°C. The values of each HEARThermo improved by the regression models were not significantly different from the temperature of the water bath (P=.19). Bland-Altman plots showed no visualized systematic bias. HEARThermo had a bias of 1.51°C with a 95% limit of agreement between -1.34°C and 4.35°C. CONCLUSIONS: The findings of our study show the validation of HEARThermo for the continuous monitoring of body surface temperatures in humans.

Characterising frailty, metrics of continuous glucose monitoring, and mortality hazards in older adults with type 2 diabetes on insulin therapy (HARE): a prospective, observational cohort study.

BACKGROUND: To our knowledge, no previous study has examined the inter-relationship between frailty, dysglycaemia, and mortality in frail older adults with type 2 diabetes who are on insulin therapy. We used continuous glucose monitors (CGMs) to profile this patient population and determine the prognostic value of CGM metrics. We hypothesised that incremental frailty was associated with increased hypoglycaemia or time below range (TBR). METHODS: HARE was a multicentre, prospective, observational cohort study with mortality hazard analysis carried out in four hospitals in Hong Kong. Eligible participants were community-living adults aged 70 years and older; had had type 2 diabetes for 5 years or more; were on insulin therapy; were frail; and were not hospitalised at the time of frailty assessment and CGM recording. Glucose control was characterised according to the Advanced Technologies and Treatments for Diabetes 2019 international consensus clinical targets. Frailty index was computed, and comprehensive frailty assessments and targeted serum metabolic profiling were performed. The Jonckheere-Terpstra test for trend was used to analyse frailty index tertiles and variables. Inter-relationships between CGM metrics and frailty, glycated haemoglobin A1c (HbA1c), and serum albumin were characterised using adjusted regression models. Survival analysis and Cox proportional hazard modelling were performed. FINDINGS: Between July 25, 2018, and Sept 27, 2019, 225 participants were recruited, 222 of whom had CGMs fitted and 215 of whom had analysable CGM data (190 were frail, 25 were not frail). Incremental frailty was associated with older age, greater HbA1c, worse renal function, and history of stroke. Eight of 11 CGM metrics were significantly associated with frailty. Decreased time in range (TIR; glucose concentration 3·9-10·0 mmol/L) and increased time above range (TAR) metrics were strongly correlated with increased frailty and hyperglycaemia, whereas TBR metrics were marginally or not different between frailty levels. Glucose-lowering agents did not significantly affect regression estimates. In patients with HbA1c of 7·5% or more, reduced serum albumin was associated with level 2 TAR (glucose concentration >13·9 mmol/L) and dysglycaemia. During a median follow-up of 28·0 months (IQR 25·3-30·4), increased level 2 TAR was predictive of mortality explainable by frailty in the absence of detectable interaction. Each 1% increment of level 2 TAR was associated with 1·9% increase in mortality hazard. INTERPRETATION: In older adults with type 2 diabetes who are on insulin therapy, incremental frailty was associated with increased dysglycaemia and hyperglycaemia rather than hypoglycaemia. Mortality hazard was increased with severe hyperglycaemia. Future clinical studies and trials targeting actionable CGM metrics highlighted in this study could translate into improved care and outcomes. FUNDING: Health and Medical Research Fund, Food and Health Bureau, The Government of the Hong Kong Special Administrative Region of China.

Comparison of Demographic Parameters and Predation Rates of Orius strigicollis (Hemiptera: Anthocoridae) Fed on Eggs of Tetranychus urticae (Acari: Tetranychidae) and Cadra cautella (Lepidoptera: Pyralidae).

Orius strigicollis (Poppius) is an anthocorid bug with high foraging ability on thrips as well as on mites, and the bug has been considered as a potential biological control agent in Taiwan. Life table and predation studies of O. strigicollis fed on Cadra cautella (Walker) and Tetranychus urticae (Koch) eggs were conducted at 25 ± 1°C. Data were analyzed and compared using TWOSEX-MSChart and CONSUME-MSChart software. O. strigicollis fed on eggs of C. cautella, a substitute prey, showed significantly higher survival rate and developmental rate than individuals fed on their natural prey, T. urticae eggs. The fecundity of O. strigicollis fed on C. cautella eggs was, on average, 13.2 times higher than that of those fed on T. urticae eggs, despite of the fact that during the entire nymphal stage, the consumption rate of O. strigicollis on T. urticae eggs was ca. 9 times higher than on almond moth eggs The conversion rate (i.e., number of prey eggs needed to produce one predator egg) for this predatory bug reared on T. urticae eggs and almond moth eggs were 604.6 and 6.0, respectively, indicating that almond moth eggs served as an effective alternative prey for ensuring the predator's reproduction. This is the first study pertaining to the population parameters and predation rates of O. strigicollis using the age-stage two-sex approach to describe differences between O. strigicollis populations reared on natural and alternative preys. This information may be useful in mass rearing programs and field application involving this biological control agent.

Differential regulation of Arabidopsis plastid gene expression and RNA editing in non-photosynthetic tissues.

RNA editing is one of the post-transcriptional processes that commonly occur in plant plastids and mitochondria. In Arabidopsis, 34 C-to-U RNA editing events, affecting transcripts of 18 plastid genes, have been identified. Here, we examined the editing and expression of these transcripts in different organs, and in green and non-green seedlings (etiolated, cia5-2, ispF and ispG albino mutants, lincomycin-, and norflurazon-treated). The editing efficiency of Arabidopsis plastid transcripts varies from site to site, and may be specifically regulated in different tissues. Steady state levels of plastid transcripts are low or undetectable in etiolated seedlings, but most editing sites are edited with efficiencies similar to those observed in green seedlings. By contrast, the editing of some sites is completely lost or significantly reduced in other non-green tissues; for instance, the editing of ndhB-149, ndhB-1255, and ndhD-2 is completely lost in roots and in lincomycin-treated seedlings. The editing of ndhD-2 is also completely lost in albino mutants and norflurazon-treated seedlings. However, matK-640 is completely edited, and accD-794, atpF-92, psbE-214, psbF-77, psbZ-50, and rps14-50 are completely or highly edited in both green and non-green tissues. In addition, the expression of nucleus-encoded RNA polymerase dependent transcripts is specifically induced by lincomycin, and the splicing of ndhB transcripts is significantly reduced in the albino mutants and inhibitor-treated seedlings. Our results indicate that plastid gene expression, and the splicing and editing of plastid transcripts are specifically and differentially regulated in various types of non-green tissues.

The relationships between quality of life, psychiatric illness, and suicidal ideation in geriatric veterans living in a veterans' home: a structural equation modeling approach.

OBJECTIVE: This study tested a structural model and examined the relationships between age, suicidal ideation, and scores on the 5-item Brief Symptom Rating Scale (BSRS-5), the 15-item Geriatric Depression Scale (GDS-15), and the Medical Outcome Study Short Form-12 (MOS SF-12) in a sample of veterans' home residents. METHODS: Of the 266 individuals recruited, 226 completed the questionnaires, resulting in a response rate of 84.9%. Participants completed the BSRS-5, GDS-15, MOS SF-12, and a demographic survey. Analysis of Moment Structures, Version 7.0, was used to test the structural relationships of the model with a structural equation modeling analysis and a maximum likelihood ratio estimation. Patient subitem scores, which ranked their feelings of depression, hostility, and inferiority, were summed to determine their 3-BSRS-subitem sum scores. RESULTS: The measures of model fitness were as follows: goodness-of-fit (χ = 12.03, df = 7, p = 0.1), goodness-of-fit index (0.98), adjusted goodness-of-fit index (0.95), comparative fit index (0.99), parsimony ratio (0.47), and root mean square error of approximation (0.06). All indices suggested that the final model fit the data well. Age was inversely related to physical component summary, which was inversely related to the 3-BSRS-subitem sum score. Mental component summary was inversely related to the 3-BSRS-subitem sum score and the GDS-15. Physical component summary was inversely related to the GDS-15. The 3-BSRS-subitem sum score correlated with suicidal ideation. CONCLUSIONS: The data reveal a significant relationship between quality of life and suicidal ideation, which may be affected more by the 3-BSRS-subitem sum score than by the GDS-15. The proposed model has the potential to help healthcare professionals effectively design and implement their suicide prevention programs.

The suitability of the BSRS-5 for assessing elderly who have attempted suicide and need to be referred for professional mental health consultation in a metropolitan city, Taiwan.

OBJECTIVES: The goals of this study are to (1) investigate the prevalence of necessary referral for professional mental health consultation for elderly people who attempted suicide ("suicide-attempted") in Kaohsiung city, Taiwan during 2006-2007, (2) assess whether the 5-item Brief Symptom Rating Scale (BSRS-5) can be used as an efficient screening instrument for assessing the probability of a second suicide attempt among the elderly, and (3) examine predictors of needing referral among the suicide-attempted. METHODS: During the study period, 144 suicide-attempted elderly subjects were enrolled. Demographic data, BSRS-5, SAD PERSONS scale, and Medical Outcome Study Short Form-12 (MOS SF-12) data were collected by a trained semi-professional. The prevalence of necessary referrals for the suicide-attempted elderly was estimated, and the salient factors for their referral were evaluated with logistic regression analysis. RESULTS: A total of 109 participants out of the 144 recruited completed the questionnaires, giving a response rate of 75.7%. The prevalence of necessary referrals for professional mental health consultation was 33.9% (37/109). The significant predictors of needing referrals were lower scores for MCS (OR = 0.89; 95% CI = 0.83-0.96), family discord (OR = 3.86; 95% CI = 1.17-12.75), and type of interviewee (OR = 4.97; 95% CI = 1.57-15.74). CONCLUSION: When the BSRS-5 is used to evaluate the referral of elderly patients who have attempted suicide for a professional mental health consultation, it is best to conduct in-person interviews to ask whether the elderly patient still has any suicidal ideation. In addition, evaluating quality of life and level of family discord may also be crucial for suicide prevention in the elderly.

Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator.