ABSTRACT
The goal of this study was to characterize the bacterial diversity on different melon varieties grown in different regions of the US, and determine the influence that region, rind netting, and variety of melon has on the composition of the melon microbiome. Assessing the bacterial diversity of the microbiome on the melon rind can identify antagonistic and protagonistic bacteria for foodborne pathogens and spoilage organisms to improve melon safety, prolong shelf-life, and/or improve overall plant health. Bacterial community composition of melons (n = 603) grown in seven locations over a four-year period were used for 16S rRNA gene amplicon sequencing and analysis to identify bacterial diversity and constituents. Statistically significant differences in alpha diversity based on the rind netting and growing region (p < 0.01) were found among the melon samples. Principal Coordinate Analysis based on the Bray-Curtis dissimilarity distance matrix found that the melon bacterial communities clustered more by region rather than melon variety (R2 value: 0.09 & R2 value: 0.02 respectively). Taxonomic profiling among the growing regions found Enterobacteriaceae, Bacillaceae, Microbacteriaceae, and Pseudomonadaceae present on the different melon rinds at an abundance of ≥ 0.1%, but no specific core microbiome was found for netted melons. However, a core of Pseudomonadaceae, Bacillaceae, and Exiguobacteraceae were found for non-netted melons. The results of this study indicate that bacterial diversity is driven more by the region that the melons were grown in compared to rind netting or melon type. Establishing the foundation for regional differences could improve melon safety, shelf-life, and quality as well as the consumers' health.
Subject(s)
Bacillaceae , Cucumis melo , Cucurbitaceae , United States , Cucurbitaceae/microbiology , Cucumis melo/microbiology , RNA, Ribosomal, 16S/genetics , Bacteria/genetics , EnterobacteriaceaeABSTRACT
Neurotransmitter receptors partition into nanometer-scale subdomains within the postsynaptic membrane that are precisely aligned with presynaptic neurotransmitter release sites. While spatial coordination between pre- and postsynaptic elements is observed at both excitatory and inhibitory synapses, the functional significance of this molecular architecture has been challenging to evaluate experimentally. Here we utilized an optogenetic clustering approach to acutely alter the nanoscale organization of the postsynaptic inhibitory scaffold gephyrin while monitoring synaptic function. Gephyrin clustering rapidly enlarged postsynaptic area, laterally displacing GABAA receptors from their normally precise apposition with presynaptic active zones. Receptor displacement was accompanied by decreased synaptic GABAA receptor currents even though presynaptic release probability and the overall abundance and function of synaptic GABAA receptors remained unperturbed. Thus, acutely repositioning neurotransmitter receptors within the postsynaptic membrane profoundly influences synaptic efficacy, establishing the functional importance of precision pre-/postsynaptic molecular coordination at inhibitory synapses.
Subject(s)
Receptors, GABA-A , Synapses , Synapses/physiology , Carrier Proteins , Receptors, Neurotransmitter , gamma-Aminobutyric AcidABSTRACT
Postsynaptic neurotransmitter receptors and their associated scaffolding proteins assemble into discrete, nanometer-scale subsynaptic domains (SSDs) within the postsynaptic membrane at both excitatory and inhibitory synapses. Intriguingly, postsynaptic receptor SSDs are mirrored by closely apposed presynaptic active zones. These trans-synaptic molecular assemblies are thought to be important for efficient neurotransmission because they concentrate postsynaptic receptors near sites of presynaptic neurotransmitter release. While previous studies have characterized the role of synaptic activity in sculpting the number, size, and distribution of postsynaptic SSDs at established synapses, it remains unknown whether neurotransmitter signaling is required for their initial assembly during synapse development. Here, we evaluated synaptic nano-architecture under conditions where presynaptic neurotransmitter release was blocked prior to, and throughout synaptogenesis with tetanus neurotoxin (TeNT). In agreement with previous work, neurotransmitter release was not required for the formation of excitatory or inhibitory synapses. The overall size of the postsynaptic specialization at both excitatory and inhibitory synapses was reduced at chronically silenced synapses. However, both AMPARs and GABAARs still coalesced into SSDs, along with their respective scaffold proteins. Presynaptic active zone assemblies, defined by RIM1, were smaller and more numerous at silenced synapses, but maintained alignment with postsynaptic AMPAR SSDs. Thus, basic features of synaptic nano-architecture, including assembly of receptors and scaffolds into trans-synaptically aligned structures, are intrinsic properties that can be further regulated by subsequent activity-dependent mechanisms.
ABSTRACT
Background: Vine decline disease caused by the fungus Monosporascus cannonballus, is a threat to melon production (Cucumis melo L.) worldwide. Nonetheless, little is known about the metabolites produced during the host pathogen interaction. Thus, the objective of this study was to measure quantities of amino acids produced over time during such an interaction. Methods: Two melon genotypes named TAM-Uvalde (susceptible) and USDA PI 124104 (resistant) were grown and inoculated with M. cannonballus. The metabolites previously stated were measured before inoculation (0 hours) and 24, 48 and 72 hours after inoculation, using high performance liquid chromatography analysis. Results: The production of some amino acids during the interaction of the resistant and susceptible melon genotypes with the fungus M. cannonballus was different regarding quantities over time. Interestingly, hydroxy proline was always up-regulated in higher quantities in response to pathogen infection in the genotype TAM-Uvalde. Also, the up-regulation in higher quantities of gamma-aminobutyric acid in the genotype TAM-Uvalde 48 and 72 hours after inoculation, suggests more penetration of the pathogen in its roots. Hence, taken together, hydroxy proline and gamma-aminobutyric acid levels could be used as markers of susceptibility to vine decline disease caused by M. cannonballus, which could be useful in developing resistant varieties.
Subject(s)
Antifibrinolytic Agents , Ascomycota , Cucumis melo , Flower Essences , Proline , gamma-Aminobutyric Acid , Amino AcidsABSTRACT
Tomato spotted wilt orthotospovirus (TSWV) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene 'Sw-5' offering a broad-spectrum resistance to multiple orthotospoviruses was introduced in tomato cultivars. However, multiple resistance-breaking strains of TSWV were reported worldwide (Ciuffo 2005; Zaccardelli et al. 2008; Batuman et al. 2017; di Rienzo et al. 2018). Symptoms suggestive of orthotospoviral infection including stunting, bronzing, and inward rolling of leaves, and concentric necrotic spots on leaves, petioles, and fruits were observed in two TSWV-resistant tomato cultivars ('BL163' and 'HT 2') planted in a tomato variety trial in Bushland, TX in 2022. Leaf tissues from 45 resistant tomato plants (symptomatic or asymptomatic) from both resistant cultivars were tested using a TaqMan probe-based qPCR assay targeting a 200bp region in nucleoprotein (N) of the TSWV (Gautam et al. 2022). While 25 of those samples tested positive for TSWV, only ten expressed characteristic disease symptoms described above. The possibility of mixed infection in those samples with other endemic viruses in the region viz., alfalfa mosaic virus, groundnut ringspot orthotospovirus, tobacco mosaic virus, tomato chlorotic spot orthotospovirus, tomato mosaic virus, tomato necrotic streak virus, tomato ringspot virus, and tomato torrado virus was discounted through RT-PCR analysis (Kumar et al. 2011; Verbeek et al. 2012; Bratsch et al. 2018). To test the RB phenotype of the observed putative TSWV-RB strains, three-week-old tomato plants from eight commercially available TSWV resistant cultivars and one non-resistant cultivar (n=10 each) were mechanically inoculated with leaf tissues collected from a single symptomatic plant from one of the field-grown resistant cultivars. The experiment was replicated twice. Hypersensitive response was observed on all inoculated leaves of resistant plants one week post inoculation. Furthermore, all eight resistant cultivars started expressing local and systemic TSW symptoms 12 to 16 days post inoculation (dpi), while non-resistant cultivar started expressing symptoms at 9 dpi. TSW incidence across all resistant cultivars was 30-70%, while in susceptible cultivar it was 90%. Symptoms exhibited by all resistant cultivars resembled those of symptoms observed in field collected plants. The expression of Sw-5 gene in all eight resistant cultivars and the lack thereof in a susceptible cultivar was confirmed using Sw-5b specific primers and using Actin as a housekeeping gene in qRT-PCR (Islam et al. 2022). The RB strains in Sw-5 resistant tomato in California (Batuman et al. 2017) had the C118Y mutation in the TSWV NSm protein, consistent with the original reporting of C118Y or T120N RB mutations in 11 TSWV isolates from Spain (NCBI accession # HM015517 & HM015518) (Lopez et al. 2011). The nucleotide and amino acid sequence analysis of NSm gene from Bushland RB isolates from four resistant cultivars (NCBI accessions # OP810513-14 [field], OQ247901-05 [mechanically inoculated]) shared 98.9 and 99.4% homology with the Californian NSm sequences of TSWV RB tomato isolate (KX898453 and ASO67371), respectively. While the Nsm C118Y or T120N RB mutations were absent in all Bushland TSWV RB isolates, they had six additional unique point mutations across the NSm (I163V, P227Q, V290I, N293S, V294I, K296Q), which could potentially be responsible for resistance breaking. Despite the lack of C118Y or T120N RB mutations, Bushland isolates were capable of disrupting Sw-5-mediated TSWV resistance in all eight commercial resistant tomato cultivars. This study suggests a new or a different class of fundamental mechanisms are likely to be responsible for resistance breaking in Sw-5b resistant tomatoes. The new RB strain/s of TSWV therefore pose a substantial threat to tomato production in TX and other tomato-growing regions of the US.
ABSTRACT
ABBREVIATIONS: BCL2: BCL2 apoptosis regulator; BCL10: BCL10 immune signaling adaptor; CARD11: caspase recruitment domain family member 11; CBM: CARD11-BCL10-MALT1; CR2: complement C3d receptor 2; EBNA: Epstein Barr nuclear antigen; EBV: Epstein-Barr virus; FCGR3A; Fc gamma receptor IIIa; GLILD: granulomatous-lymphocytic interstitial lung disease; HV: healthy volunteer; IKBKB/IKB kinase: inhibitor of nuclear factor kappa B kinase subunit beta; IL2RA: interleukin 2 receptor subunit alpha; MALT1: MALT1 paracaspase; MS4A1: membrane spanning 4-domain A1; MTOR: mechanistic target of rapamycin kinase; MYC: MYC proto-oncogene, bHLH: transcription factor; NCAM1: neural cell adhesion molecule 1; NFKB: nuclear factor kappa B; NIAID: National Institute of Allergy and Infectious Diseases; NK: natural killer; PTPRC: protein tyrosine phosphatase receptor type C; SELL: selectin L; PBMCs: peripheral blood mononuclear cells; TR: T cell receptor; Tregs: regulatory T cells; WT: wild-type.
Subject(s)
Epstein-Barr Virus Infections , Humans , Autophagy , Autophagy-Related Proteins/genetics , Herpesvirus 4, Human , Hyperplasia , Leukocytes, Mononuclear/metabolism , Membrane Proteins/genetics , Mutation , NF-kappa B/metabolism , Proto-Oncogene Proteins c-bcl-2/genetics , Vesicular Transport Proteins/geneticsABSTRACT
In 1922, Phytophthora capsici was described by Leon Hatching Leonian as a new pathogen infecting pepper (Capsicum annuum), with disease symptoms of root rot, stem and fruit blight, seed rot, and plant wilting and death. Extensive research has been conducted on P. capsici over the last 100 years. This review succinctly describes the salient mile markers of research on P. capsici with current perspectives on the pathogen's distribution, economic importance, epidemiology, genetics and genomics, fungicide resistance, host susceptibility, pathogenicity mechanisms, and management.
Subject(s)
Capsicum , Fungicides, Industrial , Phytophthora , Phytophthora/genetics , Plant DiseasesABSTRACT
Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.
ABSTRACT
A-kinase anchoring protein 79-human/150-rodent (AKAP79/150) organizes signaling proteins to control synaptic plasticity. AKAP79/150 associates with the plasma membrane and endosomes through its N-terminal domain that contains three polybasic regions and two Cys residues that are reversibly palmitoylated. Mutations abolishing palmitoylation (AKAP79/150 CS) reduce its endosomal localization and association with the postsynaptic density (PSD). Here we combined advanced light and electron microscopy (EM) to characterize the effects of AKAP79/150 palmitoylation on its postsynaptic nanoscale organization, trafficking, and mobility in hippocampal neurons. Immunogold EM revealed prominent extrasynaptic membrane AKAP150 labeling with less labeling at the PSD. The label was at greater distances from the spine membrane for AKAP150 CS than WT in the PSD but not in extra-synaptic locations. Immunogold EM of GFP-tagged AKAP79 WT showed that AKAP79 adopts a vertical, extended conformation at the PSD with its N-terminus at the membrane, in contrast to extrasynaptic locations where it adopts a compact or open configurations of its N- and C-termini with parallel orientation to the membrane. In contrast, GFP-tagged AKAP79 CS was displaced from the PSD coincident with disruption of its vertical orientation, while proximity and orientation with respect to the extra-synaptic membrane was less impacted. Single-molecule localization microscopy (SMLM) revealed a heterogeneous distribution of AKAP150 with distinct high-density, nano-scale regions (HDRs) overlapping the PSD but more prominently located in the extrasynaptic membrane for WT and the CS mutant. Thick section scanning transmission electron microscopy (STEM) tomography revealed AKAP150 immunogold clusters similar in size to HDRs seen by SMLM and more AKAP150 labeled endosomes in spines for WT than for CS, consistent with the requirement for AKAP palmitoylation in endosomal trafficking. Hidden Markov modeling of single molecule tracking data revealed a bound/immobile fraction and two mobile fractions for AKAP79 in spines, with the CS mutant having shorter dwell times and faster transition rates between states than WT, suggesting that palmitoylation stabilizes individual AKAP molecules in various spine subpopulations. These data demonstrate that palmitoylation fine tunes the nanoscale localization, mobility, and trafficking of AKAP79/150 in dendritic spines, which might have profound effects on its regulation of synaptic plasticity.
ABSTRACT
Anthracnose of watermelon is caused by a fungal pathogen Colletotrichum orbiculare. We generated F2 individuals from three different populations: Population 1 (PI 189225 x 'New Hampshire Midget'), Population 2 ('Perola' x PI 189225), and Population 3 ('Verona' x PI 189225). The biparental F2 populations, parents and F1 individuals were inoculated with an isolate of race 2 anthracnose isolated from watermelon. Leaf lesions were visually rated seven days post inoculation on a scale of 0% (no lesion) to 100% (dead true leaf). Here we present the datasets obtained after the disease inoculation. The distribution of data obtained was visualized using histograms and goodness-of-fit was tested using Chi-Square. These datasets provide information on the mode of inheritance of race 2 anthracnose resistance in watermelon.
ABSTRACT
The nanoscale architecture of synapses has been investigated using multiple super-resolution methods, revealing a common modular structure for scaffolds, neurotransmitter receptors, and presynaptic proteins. This fundamental organization of proteins into subsynaptic domains (SSDs) is thought to be important for synaptic function and plasticity and common to many types of synapses. Using 3D super-resolution Structured Illumination Microscopy (3D-SIM), we recently showed that GABAergic inhibitory synapses exhibit this nanoscale organizational principle and are composed of SSDs of GABA A receptors (GABA A Rs), the inhibitory scaffold gephyrin, and the presynaptic active zone protein, RIM. Here, we have investigated the use of 3D-SIM and dSTORM to analyze the nanoscale architecture of the inhibitory synaptic adhesion molecule, neuroligin-2 (NL2). NL2 is a crucial mediator of inhibitory synapse formation and organization, associating with both GABA A Rs and gephyrin. However, the nanoscale sub-synaptic distribution NL2 remains unknown. We found that 3D-SIM and dSTORM provide complementary information regarding the distribution of NL2 at the inhibitory synapse, with NL2 forming nanoscale structures that have many similarities to gephyrin nanoscale architecture.
ABSTRACT
Accurate, rapid quantitation of the capsaicinoid and capsinoid compounds produced by peppers (Capsicum spp.) is essential to assess quality. Here, we developed a rapid ultra-high performance liquid chromatography method for the simultaneous separation of five major capsaicinoids and three major capsinoids from peppers. Optimal chromatographic separation was achieved using a phenyl-hexyl stationary phase with a mobile phase of acidified water and methanol with a flow rate of 0.5 ml/min at a column temperature of 55 °C over 5 min. The method was validated by testing linearity, precision, robustness, and limits of detection and quantification. The developed method was successfully employed to profile capsaicinoids and capsinoids from different pepper cultivars. Out of the 10 pepper cultivars analysed, all three major capsinoids were detected in two cultivars. To the best of our knowledge, this is the first report of successful separation of nordihydrocapsiate from capsiate and quantification of nordihydrocapsiate.
Subject(s)
Capsaicin , Capsicum , Capsaicin/analogs & derivatives , Capsaicin/analysis , Capsicum/chemistry , Chromatography, High Pressure Liquid/methodsABSTRACT
The efficacy of plant-based antimicrobials against Salmonella Newport and Listeria monocytogenes on melon rinds was evaluated. Four cantaloupe and 3 honeydew melon varieties grown in Georgia, Arizona, Texas, North Carolina, Indiana and California were tested. Melon rinds (10 g pieces) were inoculated with 5-6 log CFU/10 g rind of S. Newport or L. monocytogenes. Samples were then immersed in 5 % olive extract or 0.5 % oregano oil antimicrobial solution and gently agitated for 2 min. Samples were stored at 4 °C and surviving populations of both bacteria were enumerated at days 0 and 3. Plant-based antimicrobials reduced S. Newport and L.monocytogenes population on all rind samples, regardless of the melon types, varieties or growing locations. Compared to the control, antimicrobial treatments caused up to 3.6 and 4.0 log reductions in populations of Salmonella and L. monocytogenes, respectively. In most cases, plant-based antimicrobial treatments reduced pathogen populations to below the detection limit (1 log CFU/g) at day 3. In general, oregano oil had better antimicrobial activity than olive extract and the antimicrobial treatments were more effective on Salmonella than on L. monocytogenes. The plant-based antimicrobial treatments exhibited better microbial reductions on honeydews than on cantaloupes. These antimicrobials could potentially be used as sanitizers for decontaminating melons.
Subject(s)
Anti-Infective Agents , Cucurbitaceae , Food Contamination/prevention & control , Listeria monocytogenes , Salmonella enterica , Anti-Infective Agents/pharmacology , Colony Count, Microbial , Consumer Product Safety , Cucurbitaceae/microbiology , Food Handling , Food Microbiology , Listeria monocytogenes/drug effects , Salmonella enterica/drug effects , United StatesABSTRACT
GABAergic synaptic inhibition controls neuronal firing, excitability, and synaptic plasticity to regulate neuronal circuits. Following an acute excitotoxic insult, inhibitory synapses are eliminated, reducing synaptic inhibition, elevating circuit excitability, and contributing to the pathophysiology of brain injuries. However, mechanisms that drive inhibitory synapse disassembly and elimination are undefined. We find that inhibitory synapses are disassembled in a sequential manner following excitotoxicity: GABAARs undergo rapid nanoscale rearrangement and are dispersed from the synapse along with presynaptic active zone components, followed by the gradual removal of the gephyrin scaffold, prior to complete elimination of the presynaptic terminal. GABAAR nanoscale reorganization and synaptic declustering depends on calcineurin signaling, whereas disassembly of gephyrin relies on calpain activation, and blockade of both enzymes preserves inhibitory synapses after excitotoxic insult. Thus, inhibitory synapse disassembly occurs rapidly, with nanoscale precision, in a stepwise manner and most likely represents a critical step in the progression of hyperexcitability following excitotoxicity.
Subject(s)
Brain Injuries/physiopathology , Membrane Proteins/metabolism , Neurons/metabolism , Presynaptic Terminals/metabolism , Receptors, GABA-A/metabolism , Synapses/metabolism , Animals , Female , Male , Mice, Inbred C57BL , Neuronal Plasticity , Rats , Rats, Sprague-Dawley , Signal TransductionABSTRACT
BACKGROUND: Watermelon seeds are a powerhouse of value-added traits such as proteins, free amino acids, vitamins, and essential minerals, offering a paleo-friendly dietary option. Despite the availability of substantial genetic variation, there is no sufficient information on the natural variation in seed-bound amino acids or proteins across the watermelon germplasm. This study aimed to analyze the natural variation in watermelon seed amino acids and total protein and explore underpinning genetic loci by genome-wide association study (GWAS). METHODS: The study evaluated the distribution of seed-bound free amino acids and total protein in 211 watermelon accessions of Citrullus spp, including 154 of Citrullus lanatus, 54 of Citrullus mucosospermus (egusi) and three of Citrullus amarus. We used the GWAS approach to associate seed phenotypes with 11,456 single nucleotide polymorphisms (SNPs) generated by genotyping-by-sequencing (GBS). RESULTS: Our results demonstrate a significant natural variation in different free amino acids and total protein content across accessions and geographic regions. The accessions with high protein content and proportion of essential amino acids warrant its use for value-added benefits in the food and feed industries via biofortification. The GWAS analysis identified 188 SNPs coinciding with 167 candidate genes associated with watermelon seed-bound amino acids and total protein. Clustering of SNPs associated with individual amino acids found by principal component analysis was independent of the speciation or cultivar groups and was not selected during the domestication of sweet watermelon. The identified candidate genes were involved in metabolic pathways associated with amino acid metabolism, such as Argininosuccinate synthase, explaining 7% of the variation in arginine content, which validate their functional relevance and potential for marker-assisted analysis selection. This study provides a platform for exploring potential gene loci involved in seed-bound amino acids metabolism, useful in genetic analysis and development of watermelon varieties with superior seed nutritional values.
ABSTRACT
Secreted amyloid-ß (Aß) peptide forms neurotoxic oligomeric assemblies thought to cause synaptic deficits associated with Alzheimer's disease (AD). Soluble Aß oligomers (Aßo) directly bind to neurons with high affinity and block plasticity mechanisms related to learning and memory, trigger loss of excitatory synapses and eventually cause cell death. While Aßo toxicity has been intensely investigated, it remains unclear precisely where Aßo initially binds to the surface of neurons and whether sites of binding relate to synaptic deficits. Here, we used a combination of live cell, super-resolution and ultrastructural imaging techniques to investigate the kinetics, reversibility and nanoscale location of Aßo binding. Surprisingly, Aßo does not bind directly at the synaptic cleft as previously thought but, instead, forms distinct nanoscale clusters encircling the postsynaptic membrane with a significant fraction also binding presynaptic axon terminals. Synaptic plasticity deficits were observed at Aßo-bound synapses but not closely neighboring Aßo-free synapses. Thus, perisynaptic Aßo binding triggers spatially restricted signaling mechanisms to disrupt synaptic function. These data provide new insight into the earliest steps of Aßo pathology and lay the groundwork for future studies evaluating potential surface receptor(s) and local signaling mechanisms responsible for Aßo binding and synapse dysfunction.
Subject(s)
Alzheimer Disease , Amyloid beta-Peptides , Humans , Neuronal Plasticity , Neurons , SynapsesABSTRACT
The Ca2+/Calmodulin-dependent protein kinase II (CaMKII) is a central regulator of synaptic plasticity and has been implicated in various neurological conditions, including schizophrenia. Here, we characterize six different CaMKIIα variants found in patients with schizophrenia. Only R396stop disrupted the 12-meric holoenzyme structure, GluN2B binding, and synaptic localization. Additionally, R396stop impaired T286 autophosphorylation that generates Ca2+-independent "autonomous" kinase activity. This impairment in T286 autophosphorylation was shared by the R8H mutation, the only mutation that additionally reduced stimulated kinase activity. None of the mutations affected the levels of CaMKII expression in HEK293 cells. Thus, impaired CaMKII function was detected only for R396stop and R8H. However, two of the other mutations have been later identified also in the general population, and not all mutations found in patients with schizophrenia would be expected to cause disease. Nonetheless, for the R396stop mutation, the severity of the biochemical effects found here would predict a neurological phenotype.
ABSTRACT
Cucumis melo L is one of the most commercial and economical crops in the world with several health beneficial compounds as such carotenoids, amino acids, vitamin A and C, minerals, and dietary fiber. Evaluation of the volatile organic compounds (VOCs) in different melon (Cucumis melo L.) breeding lines provides useful information for improving fruit flavor, aroma, and antimicrobial levels. In this study, the VOCs in 28 melon breeding lines harvested in 2019 were identified and characterized using head space solid-phase microextraction (HS-SPME) coupled with gas chromatography-mass spectrometry (GC-MS). This identified 113 VOCs with significant differences in composition and contents of among the breeding lines, including 15 esters, 27 aldehydes, 35 alcohols, 14 ketones, 4 acids, 10 hydrocarbons, 5 sulfurs, and 3 other compounds. The highest average contents of all the VOCs were found in BL-30 (13,973.07 µg/kg FW) and the lowest were in BL-22 (3947.13 µg/kg FW). BL-9 had high levels of carotenoid-derived VOCs. The compounds with the highest contents were benzaldehyde, geranylacetone, and ß-ionone. Quality parameters such as color and sugar contents of melons were also measured. All the melon color readings were within the typical acceptable range. BL-22 and BL-14 had the highest and lowest sugar contents, respectively. Principal component analysis (PCA) produced diverse clusters of breeding lines based on flavor and aroma. BL-4, BL-7, BL-12, BL-20, and BL-30 were thus selected as important breeding lines based on their organoleptic, antimicrobial, and health-beneficial properties.
ABSTRACT
Tomato (Solanum lycopersicum) fruit is a rich source of health-promoting compounds, and epidemiological studies show that tomato consumption may reduce the risk of chronic diseases. This study compared the effect of genotype, production system, and their interaction on eight tomato varieties grown in the open-field (OF) or net-house (NH), a structure completely covered with a 50-mesh screen to reduce pest and wind damage, in South Texas. The NH structure reduced solar radiation up to ~30% and decreased wind speed by 6.44 km/h compared with conditions measured in the OF. We simultaneously analyzed 16 phenolics and indoleamines using ultra-high-performance liquid chromatography coupled with quadrupole time-of-flight high-resolution mass spectrometry (UHPLC/ESI-HR-QTOFMS). The chemometric analysis showed a distinct difference between NH- and OF-grown tomatoes irrespective of the variety. The melatonin and serotonin contents showed a cultivar-specific effect of the production system. Likewise, the effect of cultivation systems on levels of phenolic acids and flavonoids varied based on tomato cultivar. Among the studied phenolic acids, significantly enhanced levels of sinapic acid were observed in OF-grown tomatoes. Similarly, we detected a considerable genotypic effect on gallic acid, p-coumaric acid, ferulic acid, sinapic acid, and naringin. The interaction of cultivar and production system substantially affected gallic acid, protocatechuic acid, sinapic acid, and apigenin. However, further studies need to be performed to explore the environment-specific effects on the total composition. In summary, our results indicate that the production system plays an important role in tomato composition beyond the natural genetic variation among cultivars.