The university as a safe environment during the SARS-COV-2 pandemic: the experience of Bari Politecnico.

the SARS-CoV-2 pandemic started in December 2019 and still remains a major global health issue. Every country in the world has adopted drastic measures to contain the virus, although their stringency varies among countries, ranging from increased surveillance and focused interventions to strict lockdown (1). Italy was the second country where the disease had a major impact early in the pandemic, such that a strict nationwide lockdown was declared from March 9 to May 3, 2020. Nonetheless, between January and May 2020, there were 210,000 COVID-19 cases in Italy and 29,000 deaths were recorded (2). Due to the lockdown, universities (and in general all educational services) shifted to online classes, with students attending lessons and taking their exams from home. On-site activities were reduced to those considered indispensable. Research activities also had to be modified, such as by the adoption of a smart-working model (3). Between May and August 2020, the number of SARS-CoV-2 infections in Italy decreased. In response, the lockdown was loosened and some activities were restarted, albeit with specific safety protocols (social distancing, use of masks, temperature checks at the workplace entry, environmental disinfection, mixed models of smart and in-office work). These actions were accompanied by periodic serological and PCR screening tests (4).

Viroids, the simplest RNA replicons: How they manipulate their hosts for being propagated and how their hosts react for containing the infection.

The discovery of viroids about 45 years ago heralded a revolution in Biology: small RNAs comprising around 350 nt were found to be able to replicate autonomously-and to incite diseases in certain plants-without encoding proteins, fundamental properties discriminating these infectious agents from viruses. The initial focus on the pathological effects usually accompanying infection by viroids soon shifted to their molecular features-they are circular molecules that fold upon themselves adopting compact secondary conformations-and then to how they manipulate their hosts to be propagated. Replication of viroids-in the nucleus or chloroplasts through a rolling-circle mechanism involving polymerization, cleavage and circularization of RNA strands-dealt three surprises: (i) certain RNA polymerases are redirected to accept RNA instead of their DNA templates, (ii) cleavage in chloroplastic viroids is not mediated by host enzymes but by hammerhead ribozymes, and (iii) circularization in nuclear viroids is catalyzed by a DNA ligase redirected to act upon RNA substrates. These enzymes (and ribozymes) are most probably assisted by host proteins, including transcription factors and RNA chaperones. Movement of viroids, first intracellularly and then to adjacent cells and distal plant parts, has turned out to be a tightly regulated process in which specific RNA structural motifs play a crucial role. More recently, the advent of RNA silencing has brought new views on how viroids may cause disease and on how their hosts react to contain the infection; additionally, viroid infection may be restricted by other mechanisms. Representing the lowest step on the biological size scale, viroids have also attracted considerable interest to get a tentative picture of the essential characteristics of the primitive replicons that populated the postulated RNA world.

Current status of viroid taxonomy.

Viroids are the smallest autonomous infectious nucleic acids known so far. With a small circular RNA genome of about 250-400 nt, which apparently does not code for any protein, viroids replicate and move systemically in host plants. Since the discovery of the first viroid almost forty-five years ago, many different viroids have been isolated, characterized and, frequently, identified as the causal agents of plant diseases. The first viroid classification scheme was proposed in the early 1990s and adopted by the International Committee on Taxonomy of Viruses (ICTV) a few years later. Here, the current viroid taxonomy scheme and the criteria for viroid species demarcation are discussed, highlighting the main taxonomic questions currently under consideration by the ICTV Viroid Study Group. The impact of correct taxonomic annotation of viroid sequence variants is also addressed, taking into consideration the increasing application of next-generation sequencing and bioinformatics for known and previously unrecognized viroids.

Viroid-like RNAs from cherry trees affected by leaf scorch disease: further data supporting their association with mycoviral double-stranded RNAs.

Cherry trees from Spain affected by cherry leaf scorch (CLS), a fungal disease proposed to be caused by Apiognomonia erythrostoma, show symptoms (translucent-chlorotic leaf spots evolving into rusty areas) very similar to those of cherry chlorotic rusty spot disease (CCRS) and Amasya cherry disease, reported in Italy and Turkey, respectively. The three maladies are closely associated with 10-12 double-stranded viral RNAs, and CCRS is additionally associated with two cherry small circular RNAs (cscRNA1 and cscRNA2). Here, we report that a small viroid-like RNA similar to the CCRS-associated cscRNA1 is also present in CLS-affected trees, thus extending the link between the two diseases. Both CLS and CCRS cscRNA1 elements have common features, including sequence identity (88 %), a predicted quasi rod-like conformation with short bifurcations at both termini, and the presence of hammerhead ribozymes in the strands of both polarities. However, cscRNA2, apparently derived from cscRNA1 by deletion of a short hairpin, was not detected in CLS-affected material. Although the biological nature of cscRNAs is unknown, the identification of at least cscRNA1 in different cherry cultivars and in two distinct geographic areas (Spain and Italy), always in close association with the same mycoviral dsRNAs, supports that these viroid-like RNAs could be satellite RNAs.

Identification and characterization of a viroid resembling apple dimple fruit viroid in fig (Ficus carica L.) by next generation sequencing of small RNAs.

Viroids are small (246-401 nt) circular and non coding RNAs infecting higher plants. They are targeted by host Dicer-like enzymes (DCLs) that generate small RNAs of 21-24 nt (sRNAs), which are involved in the host RNA silencing pathways. The accumulation in plant tissues of such viroid-derived small RNAs (vd-sRNAs) is a clear sign of an ongoing viroid infection. In this study, next generation sequencing of a sRNAs library and assembling of the sequenced vd-sRNAs were instrumental for the identification of a viroid resembling apple dimple fruit viroid (ADFVd) in a fig accession. After confirming by molecular methods the presence of this viroid in the fig tree, its population was characterized, showing that the ADFVd master sequence from fig diverges from that of the ADFVd reference variant from apple. Moreover, since this viroid accumulates at a low level in fig, a semi-nested RT-PCR assay was developed for detecting it in other fig accessions. ADFVd seems to have a wider host range than thought before and this poses questions about its epidemiology. A further characterization of ADFVd-sRNAs showed similar accumulation of (+) or (-) vd-sRNAs that mapped on the viroid genome generating hotspot profiles. Moreover, similarly to other nuclear-replicating viroids, vd-sRNAs of 21, 22 and 24 nt in size prevailed in the distribution profiles. Altogether, these data support the involvement of double-stranded RNAs and different DCLs, targeting the same restricted viroid regions, in the genesis of ADFVd-sRNAs.

Viroid-like RNAs from cherry trees affected by leaf scorch disease: further data supporting their association with mycoviral double-stranded RNAs.

Cherry trees from Spain affected by cherry leaf scorch (CLS), a fungal disease proposed to be caused by Apiognomonia erythrostoma, show symptoms (translucent-chlorotic leaf spots evolving into rusty areas) very similar to those of cherry chlorotic rusty spot disease (CCRS) and Amasya cherry disease, reported in Italy and Turkey, respectively. The three maladies are closely associated with 10-12 double-stranded viral RNAs, and CCRS is additionally associated with two cherry small circular RNAs (cscRNA1 and cscRNA2). Here, we report that a small viroid-like RNA similar to the CCRS-associated cscRNA1 is also present in CLS-affected trees, thus extending the link between the two diseases. Both CLS and CCRS cscRNA1 elements have common features, including sequence identity (88%), a predicted quasi rod-like conformation with short bifurcations at both termini, and the presence of hammerhead ribozymes in the strands of both polarities. However, cscRNA2, apparently derived from cscRNA1 by deletion of a short hairpin, was not detected in CLS-affected material. Although the biological nature of cscRNAs is unknown, the identification of at least cscRNA1 in different cherry cultivars and in two distinct geographic areas (Spain and Italy), always in close association with the same mycoviral dsRNAs, supports that these viroid-like RNAs could be satellite RNAs.

Effect of warfarin treatment on thrombin activatable fibrinolysis inhibitor (TAFI) activation and TAFI-mediated inhibition of fibrinolysis.

BACKGROUND: Severe clotting deficiencies are associated with enhanced in vitro fibrinolysis due to insufficient thrombin activatable fibrinolysis inhibitor (TAFI) activation. Because oral anticoagulant therapy (OAT) with warfarin causes a partial deficiency of vitamin K-dependent factors, its effect on clot lysability remains unclear. OBJECTIVES: To evaluate plasma and blood fibrinolytic capacity in patients under stable OAT (n = 221) as compared with controls (n = 132). METHODS: Fibrinolysis resistance of plasma (turbidimetry) and blood (thromboelastography) clots was calculated as the lysis time of tissue factor-induced clots exposed to 30 and 100 ng mL(-1) t-PA, respectively. RESULTS: Plasma PAI-1 was similar in the two groups, whereas TAFI was slightly lower in patients. OAT plasma clots lysed faster than controls (P = 0.001). The addition of the TAFIa inhibitor PTCI reduced lysis time by 14% in OAT and 34% in controls, and the difference between the groups disappeared. Similar data were obtained with blood clots. Thrombin and TAFIa generation in OAT plasma amounted to roughly 50% of controls, supporting a reduced thrombin-dependent TAFI activation. Clot resistance of OAT plasma was normalized by Ba-citrate plasma eluate or prothrombin but not by BaSO(4) serum eluate, rFVIIa or FX. Surprisingly, circulating levels of TAFIa and its inactive derivative TAFIai were higher in warfarin patients (P < 0.0001) and correlated with plasmin-antiplasmin (P = 0.0001) but not with prothrombin F(1) (+) (2) . CONCLUSIONS: OAT enhances both plasma and blood fibrinolysis by reducing thrombin-dependent TAFI activation, a phenomenon largely determined by low prothrombin levels. At variance with in vitro data, 'basal' in vivo TAFIa/ai levels seem related to plasmin rather than thrombin generation.

Assay performance improved, but which "scorecard" designation for Vitros Troponin I?

BACKGROUND: Since cardiac troponins assay technology should comply with the recommendations of scientific societies (i.e. imprecision (10%) at the 99th percentile value observed in healthy subjects being the analytical qualifying aspect), the aim of the present study was to evaluate whether an improved troponin assay (Vitros Troponin I ES) provides data that meet the "guideline acceptable"criteria recently defined in a proposed scorecard. METHODS: Vitros Troponin I ES, an enhanced chemiluminescence immunoassay, was evaluated in a multicenter study considering: limit of blank (LOB, 60 replicates of 0 calibrators), limit of detection (LOD, 12 measurements for each of 5 serum pools), precision, linearity using control materials and serum plasma pool; matrix samples study matching serum and lithium-heparin plasma (n=107 hospitalized patients); the 99th percentile limit in serum samples from 500 healthy Caucasian donors. RESULTS: LOB and LOD, 0.0029 µg/L and 0.0030 µg/L respectively; coefficients of variation (total CV%), obtained by running 3 levels of control materials and 10 serum pools, from 15.2% (x(-)=0.014 µg/L) to 2.0% (x(-)=5.324 µg/L); method, linear up to 70 µg/L. No significant differences were found between serum and lithium-heparin matched sample (p=0.48) values; 99th percentile limit of cTnI distribution in healthy donors, 0.021 µg/L. CONCLUSION: Since its analytical reliability meets the proposed performance and scorecard requirements, the Vitros TropI method can be considered "contemporary" and "guideline acceptable".

First Report of Cucumber mosaic virus Infecting Solanum jasminoides in Italy.

Solanum jasminoides Paxton (potato vine or jasmine nightshade) is a vegetatively propagated ornamental species within the Solanaceae family. Recently, symptomless plants of this species were reported as natural hosts of the quarantine pest, Potato spindle tuber viroid (PSTVd) in Italy (1). In January 2008, approximately 1,000 potted, 2-year-old plants of S. jasminoides growing in an ornamental nursery in Sicily showed virus-like mosaic and malformation of leaves. Symptoms were observed on approximately 60% of the plants. Leaf tissue, collected from 30 symptomatic and 10 symptomless plants, was analyzed by double-antibody sandwich-ELISA with polyclonal antisera specific to Cucumber mosaic virus (CMV), Tomato spotted wilt virus, and Impatiens necrotic spot virus (Loewe Biochemica, Sauerlach, Germany). The same samples were also analyzed by tissue-printing hybridization with a PSTVd-specific digoxigenin-labelled riboprobe. All the symptomatic samples tested positive only with antisera against CMV, but negative in all other tests. The symptomless samples were negative in all the performed tests. To confirm the association of CMV with the diseased plants, total RNA was extracted from the same samples (RNeasy Plant Mini Kit; Qiagen, Hilden, Germany) and analyzed by reverse transcription (RT)-PCR using CMV-specific primers MP+5'-CATGGCTTTCCAAGGTACCAG-3' and MP-5'-CTAAAGACCGTTAACCACCTGC-3' that amplify a 844-bp fragment from the MP gene (2). The expected fragment was amplified only from samples of symptomatic tissue. CMV was also detected in mother plants grown in the same nursery and showing same mosaic symptoms. Definitive identification of the pathogen was obtained by cloning and sequencing the RT-PCR product. The obtained sequence (GenBank Accession No. EU828783) had 99 and 98% similarity with the subgroup I-A isolates CMV-LUN (GenBank Accession No. EU432183) and CMV-Fny (GenBank Accession No. DI0538), respectively. To our knowledge, this is the first report of CMV infecting S. jasminoides and it adds a new host to the more than 1,000 species (85 plant families) infected by this virus. The high incidence of the disease in the nursery could be due to propagation of cuttings from an infected source. References: (1) F. Di Serio. J. Plant Pathol. 89:297, 2007. (2) H. X. Lin et al. J. Virol. 78:6666, 2004.

Molecular characterization of the largest mycoviral-like double-stranded RNAs associated with Amasya cherry disease, a disease of presumed fungal aetiology.

The sequence of the four large (L) double-stranded RNAs (dsRNAs) associated with Amasya cherry disease (ACD), which has a presumed fungal aetiology, is reported. ACD L dsRNAs 1 (5121 bp) and 2 (5047 bp) potentially encode proteins of 1628 and 1620 aa, respectively, that are 37% identical and of unknown function. ACD L dsRNAs 3 (4458 bp) and 4 (4303 bp) potentially encode proteins that are 68% identical and contain the eight motifs conserved in RNA-dependent RNA polymerases (RdRp) of dsRNA mycoviruses, having highest similarity with those of members of the family Totiviridae. Both terminal regions share extensive conservation in all four RNAs, suggesting a functional relationship between them. As ACD L dsRNAs 1 and 2 do not encode RdRps, both are probably replicated by those from either ACD L dsRNA 3 or 4. Partial characterization of the equivalent L dsRNAs 3 and 4 associated with cherry chlorotic rusty spot revealed essentially identical sequences.

Close structural relationship between two hammerhead viroid-like RNAs associated with cherry chlorotic rusty spot disease.

Analysis of the population of cherry small circular RNAs (cscRNAs) from trees affected by cherry chlorotic rusty spot (CCRS) showed two groups of variants with similar sequence but differing in size (394-415 and 372-377 nt for cscRNA1 and cscRNA2, respectively) because of the presence or absence of a 27-nt fragment folding into a hairpin in their predicted quasi-rod-like secondary structures. These structures were preserved by co-variations and compensatory mutations, as well as by additional complex rearrangements. The variability also preserved the central conserved core and the stability of the helices of the plus and minus hammerhead ribozymes, supporting their role in replication of cscRNAs. The smaller variants most likely derive from the larger through recombination events. Possible functional relationships between cscRNAs and certain mycoviral-like double-stranded RNAs, also associated with CCRS, are discussed.

Total testing process: appropriateness in laboratory medicine.

BACKGROUND: The need to reduce costs in Laboratory Medicine is often related to the possibility of reducing test requests without taking into account patients' outcomes. Therefore, the term "appropriateness" in Laboratory Medicine as referred to the specific steps (pre-analytical, analytical, post-analytical) and related to the clinical process could allow the improvement of clinical effectiveness and economic efficiency. METHODS: Our experience has shown an improvement in analytical appropriateness (reorganization and re-engineering by Laboratory automation) and pre-analytical appropriateness (critical revision of the panel for cardiac markers) by evaluating the workload and errors rate in the pre-analytical phase. RESULTS: We obtained an economic saving (119,580 euro/year) in cardiac markers request (analytical appropriateness: 60%, pre-analytical appropriateness: 40%) and also an improvement in clinical appropriateness (diagnosis and therapy). CONCLUSIONS: Our data confirm the need to improve communications between physicians and Laboratory Medicine as regards the pre-analytical step and to implement educational programs for defining criteria and procedures. Appropriateness in analytical and post-analytical steps contribute to achieve economic saving (Core lab, POCT) and improvement of the turn-around time (TAT).

Application of a diagnostic algorithm in autoantibody testing: assessment of clinical effectiveness and economic efficiency.

BACKGROUND: Guidelines aim to assist physicians about appropriate health care for specific clinical circumstances. Therefore, they must be continuously updated, integrated and tailored to local situations. METHODS: We applied recently developed guidelines for autoantibody testing by assessing their economic (efficiency) and clinical (effectiveness) impact. Since June 2002, a test order algorithm has been adopted for autoantibody testing requests (3258). In particular, the guidelines were modified taking into account the needs of different departments and the results were compared to those (2762) of the previous period (January-May 2002) that had not been integrated with any diagnostic algorithm. RESULTS: A significant reduction in the number of anti-double stranded DNA (anti-dsDNA) (21.4%) and anti-Extractable Nuclear Antigens (anti-ENA) (19%) was found (p<0.0001), while the number of anti-nuclear antibody (ANA) test was unchanged (p=n.s.); further reduction in clinically inappropriate test request rates (23%) was observed. CONCLUSIONS: The application of guidelines allowed the improvement of diagnostic tests' efficiency and clinical effectiveness (patient's outcomes), thus confirming the need to apply eventual modifications to the diagnostic process taking into consideration different clinical needs.

First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic.

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.

Local expression of enzymatically active class I beta-1, 3-glucanase enhances symptoms of TMV infection in tobacco.

Mutant tobacco plants deficient for class I beta-1,3-glucanase (GLU I) are decreased in their susceptibility to virus infection. This is correlated with delayed virus spread, a reduction in the size exclusion limit of plasmodesmata and increased cell-wall deposition of the beta-1,3-glucan callose. To further investigate a role of GLU I during cell-to-cell movement of virus infection, we inserted the GLU I coding sequence into TMV for overexpression in infected cells. Compared with the size of local lesions produced on plants infected with virus expressing either an enzymatically inactive GLU I or a frameshift mutant of the gene, the size of local lesions caused by infection with virus expressing active GLU I was consistently increased. Viruses expressing antisense GLU I constructs led to lesions of decreased size. Similar effects were obtained for virus spread using plants grown at 32 degrees C to block the hypersensitive response. Together, these results indicate that enzymatically active GLU I expressed in cells containing replicating virus can increase cell-to-cell movement of virus. This supports the view that GLU I induced locally during infection helps to promote cell-to-cell movement of virus by hydrolyzing callose. Moreover, our results provide the first direct evidence that a biological function of a plant beta-1,3-glucanase depends on its catalytic activity.

Sense- and antisense-mediated gene silencing in tobacco is inhibited by the same viral suppressors and is associated with accumulation of small RNAs.

Antisense-mediated gene silencing (ASGS) and posttranscriptional gene silencing (PTGS) with sense transgenes markedly reduce the steady-state mRNA levels of endogenous genes similar in transcribed sequence. RNase protection assays established that silencing in tobacco plants transformed with plant-defense-related class I sense and antisense chitinase (CHN) transgenes is at the posttranscriptional level. Infection of tobacco plants with cucumber mosaic virus strain FN and a necrotizing strain of potato virus Y, but not with potato virus X, effectively suppressed PTGS and ASGS of both the transgenes and homologous endogenes. This suggests that ASGS and PTGS share components associated with initiation and maintenance of the silent state. Small, ca. 25-nt RNAs (smRNA) of both polarities were associated with PTGS and ASGS in CHN transformants as reported for PTGS in other transgenic plants and for RNA interference in Drosophila. Similar results were obtained with an antisense class I beta-1,3-glucanase transformant showing that viral suppression and smRNAs are a more general feature of ASGS. Several current models hold that diverse signals lead to production of double-stranded RNAs, which are processed to smRNAs that then trigger PTGS. Our results provide direct evidence for mechanistic links between ASGS and PTGS and suggest that ASGS could join a common PTGS pathway at the double-stranded RNA step.

Biological Properties of Apple Scar Skin Viroid: Isolates, Host Range, Different Sensitivity of Apple Cultivars, Elimination, and Natural Transmission.

Studies conducted over the last 10 years have revealed that the disease caused by the apple scar skin viroid (ASSVd) is extremely rare in Europe. ASSVd was detected by molecular hybridization and indexing in field plots on the apple indicators Starkrimson and Indo, which showed symptoms of dapple apple disease within 2 years, and rough scarred skin within 3 years, respectively. Results from both approaches were in agreement. In an attempt to improve the biological detection of ASSVd, the Japanese PK13 isolate was inoculated to 4 Prunus, 13 Malus, 17 Pyrus, and 17 other pomaceous species. All the species tested of the Malus, Pyrus, Sorbus, Chaenomeles, Cydonia, and Pyronia genera were susceptible to ASSVd based upon back indexing and hybridization, but none developed leaf or bark symptoms during a 2-year period. The viroid was not detected in the tested members of genera Amelanchier, Aronia, Cotoneaster, Crataegus, Prunus, and Pyracantha. Symptoms on fruit of 42 commercial apple cultivars experimentally inoculated with ASSVd fell into five groups ranging from inconspicuous spots to severely scarred skin and cracking. ASSVd was eliminated from most of the infected apple plants when they were subjected to a dormant stage followed by thermotherapy and shoot tip grafting. Analysis of more than 400 apple seedlings, originated from Starkrimson and Indo fruits with typical ASSVd symptoms, showed that there is little or no seed transmission of this viroid. However, ASSVd was transmitted at a low rate under field conditions to adjacent trees.

A 451-nucleotide circular RNA from cherry with hammerhead ribozymes in its strands of both polarities.

The sequence of 451 nucleotides of a cherry small circular RNA (csc RNA1) associated with a cherry disease has been determined. Both csc RNA1 and its complementary strand can form hammerhead structures similar to those found previously in other plant and animal small RNAs. In the branched secondary structure of lowest free energy of csc RNA1, the sequences involved in the hammerhead structures, which comprise approximately one-fourth of this RNA, are found opposite each other, forming part of a rod-like segment. Plus- and minus-strand full-length transcripts of csc RNA1 self-cleaved during transcription and after purification, as predicted by the hammerhead structures, which are stable and very probably act as single hammerhead structures. The minus-strand hammerhead structure of csc RNA1 is exceptional in having a central loop with only 11 conserved nucleotides, a situation previously observed in only one other natural hammerhead structure. Both hammerhead structures of csc RNA1 are also peculiar in having an A instead of a C preceding the self-cleavage sites. The in vivo concentration of the plus strand of csc RNA1 is only slightly higher than that of its complementary strand, and significant fractions of both strands are extracted from the tissue in the form of a complex. csc RNA1 has sequence similarities to viroids and especially to some viroid-like satellite RNAs; they also share some characteristics of their corresponding hammerhead structures with these satellite RNAs. These observations, together with the association in symptomatic tissue of csc RNA1 with a set of presumably viral double-stranded RNAs, suggest that csc RNA1 is a new viroid-like satellite RNA.

Identification and molecular properties of a 306 nucleotide viroid associated with apple dimple fruit disease.

A new viroid associated with an apple fruit disorder similar to, but more severe than, the dapple apple disease induced in some varieties by apple scar skin viroid (ASSVd) has been found. The new viroid, tentatively termed apple dimple fruit viroid (ADFVd), is a circular RNA of 306 nucleotides which adopts a quasi-rod-like conformation of minimum free energy. It contains the core nucleotides of the central conserved region (CCR) of the ASSVd group as well as the terminal conserved region (TCR) present in all members of the ASSVd and potato spindle tuber viroid (PSTVd) monophyletic groups. ADFVd has the highest sequence similarity with ASSVd and the 294 nucleotide citrus viroid CVd-IIIb sharing with the latter an almost identical left terminal domain. The right- and left-hand termini of ADFVd are formed by almost perfect duplications of sequences found in the CCR upper and lower strands, respectively, of PSTVd and closely related viroids.