ABSTRACT
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
ABSTRACT
BACKGROUND: Aging is associated with learning and memory disorder, affecting multiple brain areas, especially the hippocampus. Previous studies have demonstrated trilobatin (TLB), as a natural food additive, can extend the life of Caenorhabditis elegans and exhibit neuroprotection in Alzheimer's disease mice. However, the possible significance of TLB in anti-aging remains elusive. PURPOSE: This study aimed to delve into the physiological mechanism by which TLB ameliorated aging-induced cognitive impairment in senescence-accelerated mouse prone 8 (SAMP8) mice. METHODS: 6-month-old SAMP8 mice were administrated with TLB (5, 10, 20 mg/kg/day, i.g.) for 3 months. The therapeutic effect of TLB on aging-induced cognitive impairment was assessed in mice using behavioral tests and aging score. The gut microbiota composition in fecal samples was analyzed by metagenomic analysis. The protective effects of TLB on blood-brain barrier (BBB) and intestinal barrier were detected by transmission electron microscope, H&E staining and western blot (WB) assay. The inhibitive effects of TLB on inflammation in brain and intestine were assessed using immunofluorescence, WB and ELISA assay. Molecular docking and surface plasma resonance (SPR) assay were utilized to investigate interaction between TLB and sirtuin 2 (SIRT2). RESULTS: Herein, the findings exhibited TLB mitigated aging-induced cognitive impairment, neuron injury and neuroinflammation in hippocampus of aged SAMP8 mice. Moreover, TLB treatment repaired imbalance of gut microbiota in aged SAMP8 mice. Furthermore, TLB alleviated the damage to BBB and intestinal barrier, concomitant with reducing the expression of SIRT2, phosphorylated levels of c-Jun NH2 terminal kinases (JNK) and c-Jun, and expression of MMP9 protein in aged SAMP8 mice. Molecular docking and SPR unveiled TLB combined with SIRT2 and down-regulated SIRT2 protein expression. Mechanistically, the potential mechanism of SIRT2 in TLB that exerted anti-aging effect was validated in vitro. As expected, SIRT2 deficiency attenuated phosphorylated level of JNK in HT22 cells treated with d-galactose. CONCLUSION: These findings reveal, for the first time, SIRT2-mediated brain-gut barriers contribute to aging and aging-related diseases, and TLB can rescue aging-induced cognitive impairment by targeting SIRT2 and restoring gut microbiota disturbance to mediate the brain-gut axis. Overall, this work extends the potential application of TLB as a natural food additive in aging-related diseases.
Subject(s)
Aging , Brain-Gut Axis , Cognitive Dysfunction , Gastrointestinal Microbiome , Sirtuin 2 , Animals , Gastrointestinal Microbiome/drug effects , Cognitive Dysfunction/drug therapy , Mice , Aging/drug effects , Sirtuin 2/metabolism , Male , Brain-Gut Axis/drug effects , Blood-Brain Barrier/drug effects , Blood-Brain Barrier/metabolism , Molecular Docking Simulation , Hippocampus/drug effects , Hippocampus/metabolism , Disease Models, AnimalABSTRACT
The addition of antioxidants to rubber is one of the most economical and effective methods for delaying rubber aging. However, antioxidant migration can cause environmental pollution. To address this issue, a new reactive antioxidant was synthesized via the chemical bonding of glycidyl methacrylate (GMA) and p-aminodiphenylamine (PPDA). The product was characterized by Fourier-transform infrared spectroscopy, which confirmed the successful reaction between GMA and PPDA, resulting in a compound with the expected structure. The mixture was then combined with a composite of styrene-butadiene rubber and carbon black. The tensile strength, antioxidant properties, migration, and RPA of the resulting materials were tested and compared with those of the commercial antioxidants N-(1,3-dimethylbutyl)-N'-phenyl-p-phenylenediamine, N-isopropyl-N'-phenyl-1,4-phenylenediamine, and poly(1,2-dihydro-2,2,4-trimethylquinoline). After the glycidyl methacrylate antioxidant was grafted onto p-aminodiphenylamine, it became highly compatible with and dispersed in the rubber matrix. The antiaging and antimigration properties of the rubber antioxidants were enhanced without damaging the mechanical properties of the rubber matrix. The short-term and long-term antiaging and antimigration properties of this antioxidant are superior to those of commercially available antioxidants.
ABSTRACT
This study aimed to investigate spontaneous hypothermia among emergency trauma patients and develop a predictive model. A cohort of 162 emergency trauma patients was categorized into hypothermic (n = 61) and control (n = 101) groups, with trauma severity assessed using the modified Glasgow Coma Scale (GCS). Univariate analysis revealed significant differences between the groups in trauma severity, posture, garment wetness, warming measures, pre-hospital fluid resuscitation, and modified GCS scores (P < 0.05). The hypothermic group exhibited lower prothrombin time compared to the control group (P < 0.05). A logistic regression model was constructed, expressed as Y = 25.76 - 1.030X 1 + 0.725X 2 + 0.922X 3 - 0.750X 4 - 0.57X 6, and its fit was evaluated using the Hosmer-Lemeshow test. The receiver operating characteristic curve demonstrated an area under the curve of 0.871, with 81.2% sensitivity and 79.5% specificity. The Youden index identified the optimal predictive cut-off at its highest (0.58). Validation results included 86.21% sensitivity, 82.93% specificity, and 84.29% accuracy. Risk factors for spontaneous hypothermia after emergency trauma encompassed trauma severity, posture during consultation, clothing dampness upon admission, warming measures during transfer, pre-hospital fluid resuscitation, and modified GCS scores. The risk prediction model demonstrated high accuracy, enabling effective assessment of spontaneous hypothermia risk in emergency trauma patients and facilitating preventive measures.
ABSTRACT
Introduction: The Tarlov cysts are pathological enlargements of the cerebrospinal fluid spaces between the endoneurium and perineurium, which can cause intolerable sciatic pain, motor impairment of lower limbs, and bladder/bowel dysfunction. Currently, the treatment results are unsatisfactory due to the low cure rates and extensive surgical trauma. Thus, there is an ongoing exploration of surgical techniques for Tarlov treatment. In the current study, we present a novel neuroendoscopic-assisted technique that combines the fenestration, leakage sealing, and tamponade of the Tarlov cyst. Methods: Between January 2020 and December 2021, a total of 32 Tarlov patients were enrolled and received neuroendoscopic-assisted surgery. Their pre- and post-surgical Visual Analogue Scale (VAS) scores, major complaints, and MR imaging were recorded for comparison. Results: 27 of 32 patients (84.4%) patients demonstrated immediate pain relief as their VAS scores decreased from 5.6 ± 1.5 to 2.5 ± 1.1 (p < 0.01) on the first day after surgery. At the 3-month follow-up, the patients' average VAS score continued to decrease (1.94 ± 0.8). Meanwhile, saddle paresthesia, urinary incontinence, and constipation were relieved in 6 (50%), 4 (80%), and 5 (41.7%), respectively, according to patients self-report. No surgical-related complication was observed in any of the cases. Discussion: We conclude that neuroendoscopic-assisted surgery is an effective surgical method for symptomatic Tarlov cysts with minimized complications.
ABSTRACT
BACKGROUND: The MYH3-associated myosinopathies comprise a spectrum of rare neuromuscular disorders mainly characterized by distal arthrogryposis with or without other features like pterygia and vertebrae fusion. CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B) is the only known autosomal recessiveMYH3-associated myosinopathy so far, with no more than two dozen cases being reported. MATERIALS AND METHODS: A boy with CPSKF1B was recruited and subjected to a comprehensive clinical and imaging evaluation. Genetic detection with whole-exome sequencing (WES) was performed on the patient and extended family members to identify the causative variation. A series of in silico and in vitro investigations were carried out to verify the pathogenicity of the two variants of the identified compound heterozygous variation. RESULTS: The patient exhibited moderate CPSKF1B symptoms including multiarticular contractures, webbed neck, and spondylocarpotarsal fusion. WES detected a compound heterozygous MYH3 variation consisting of two variants, namely NM_002470.4: c.3377A>G; p. (E1126G) and NM_002470.4: c.5161-2A>C. It was indicated that the NM_002470.4: c.3377A>G; p. (E1126G) variant mainly impaired the local hydrogen bond formation and impacted the TGF-B pathway, while the NM_002470.4: c.5161-2A>C variant could affect the normal splicing of pre-mRNA, resulting in the appearance of multiple abnormal transcripts. CONCLUSIONS: The findings of this study expanded the mutation spectrum of CPSKF1B, provided an important basis for the counseling of the affected family, and also laid a foundation for the functional study of MYH3 mutations.
Subject(s)
Arthrogryposis , Conjunctiva , Contracture , Pterygium , Humans , Male , Arthrogryposis/genetics , Conjunctiva/abnormalities , Contracture/genetics , FamilyABSTRACT
The pathogenesis of aortic aneurysm and dissection continues to be under discussion. Extracellular matrix (ECM) remodeling processes in the aortic wall are hypothesized to be involved in the development of the disorders. Therefore, in a histological study, we investigated the expression of metalloproteases 1 and 9 (MMP1 and MMP9) and their inhibitors (TIMP 1 and TIMP 2) in cardiac surgery patients. In parallel, we studied the aortic roots by echocardiography. Clinical reports of 111 patients (30 women and 81 men) who suffered from aortic aneurysms and aortic dissection were evaluated and studied by transesophageal echocardiography. Seven patients who had coronary heart disease served as "healthy controls". All patients underwent the necessary surgical procedure according to the diagnosed aortic disease in the period from 2007 to 2015. A tissue sample of the aortic biopsies was collected from each patient during surgery. Immunohistochemical staining was performed for MMP1 and MMP9 and TIMP1 and TIMP2 as well. Vascularization was monitored by a CD 31 antibody. In direct comparison, the expressions are not homogeneous. We found the smallest changes in the intima area at all. TIMP 1 and TIMP 2 distribution increases from the lumen of the vessel outward in the wall layers of the aorta. In the case of arteriosclerotic changes, intima had a capillarization, but not in the media. An opposite pattern was found in the dissected aortas. There are differences in the vascularization between the aneurysm and dissection and the different layers, respectively. A different remodeling process of the ECM in comparison to the vascular layers must be hypothesized. Reading the patterns of staining and with regard to the known inhibitory effect of MMP9 on ECM remodeling, but especially TIMP 2 on neoangiogenesis, disturbed nutrition, and dysfunctional vasa vasorum remodeling must be assumed as causes of dissection.
ABSTRACT
AIMS: Development and evaluation of the effectiveness of a Nurse Navigation programme based on Noddings' Care theory on two dependent variables which were professional identity and career planning among first-year undergraduate nursing students. BACKGROUND: First-year undergraduate nursing students generally have a low sense of professional identity and career planning, resulting in a loss of nursing power after graduation. Implemention of a Nurse Navigation program based on Noddings' Care theory may be potentially useful in cultivating their professional identity and career planning. DESIGN: A quasi-experimental study. METHODS: A convenience sample of 122 first-year undergraduate nursing students from two medical universities was recruited between September 2021 and June 2022. Students in the experimental group (n = 63) participated in the Nurse Navigation programme based on Noddings' Care theory, which contained four core components, spreading over 50 lessons. Those in the control group (n = 59) underwent a traditional training programme with five components across 44 lessons. The two groups were compared in terms of their level of professional identity by Professional identity questionnaire for nurse students (PIQNS) and career planning by Career planning questionnaire (CPQ) after the training using the t-test. RESULTS: The mean score of professional identity in the experimental group increased significantly from 51.02 ± 8.46 at baseline to 58.02 ± 8.81 after the intervention (p < 0.001), with a large effect size (Cohen's d=0.810). Also, this post-intervention score was statistically significantly higher than that (52.86 ± 9.27) in the control group (p = 0.002), with a medium effect size (Cohen's d=0.571). The mean score of career planning in the experimental group increased significantly from 81.76 ± 9.86 at baseline to 94.52 ± 10.81 after the intervention (p < 0.001), with a large effect size (Cohen's d = 1.233). Also, this post-intervention score was statistically significantly higher than that (88.25 ± 9.30) in the control group (p < 0.001), with a medium effect size (Cohen's d=0.623). CONCLUSIONS: The Nurse Navigation programme based on Noddings' Care theory showed effectiveness in enhancing professional identity and career planning among first-year undergraduate nursing students in China. Further rigorous studies are needed to examine its effectiveness and long-term impacts on these students.
Subject(s)
Education, Nursing, Baccalaureate , Students, Nursing , Humans , Education, Nursing, Baccalaureate/methods , Curriculum , ChinaABSTRACT
INTRODUCTION: Chaigui granules are a novel manufactured traditional Chinese antidepressant medicine, which is originated from the ancient classical prescription of Xiaoyaosan. It ameliorated depression-like behavior and concomitant symptoms in animal models. But its antidepressant mechanism is still unclear. Therefore, network pharmacology and molecular biology were used to explore underlying antidepressant mechanism in this study. METHODS: Firstly, network pharmacology was used to screen main active ingredients and potential targets in the treatment of depression with Chaigui granules, and to perform pathway enrichment analysis. Secondly, chronic and unpredictable mild stress-induced depression model rats were used, and behavioral tests were used to evaluate the antidepressant effect of Chaigui granules. Finally, the core targets and key pathways predicted by network pharmacology were validated by qRT-PCR and Western blot to determine the relevant gene and protein expression levels in rat hippocampus. RESULTS: The results of network pharmacology indicated that the PI3K/Akt signaling pathway may play a key role in antidepressant of Chaigui granules. The results of animal experiments showed that Chaigui granules significantly modulated behavioral indicators. Subsequently, the upregulation of relative mRNA levels of mTOR, Akt and PI3K and downregulation of GSK-3ß and FoxO3a were observed in rat hippocampus by molecular biology diagnosis. In addition, the decreased expression of Akt and mTOR in CUMS rats hippocampus was significantly reversed, and the expression levels of GSK-3ß and FoxO3a were upregulated. CONCLUSIONS: Based on the results of network pharmacology and animal experiment validation, Chaigui granules may reverse CUMS-induced depression-like behavior in rats through PI3K/Akt/mTOR signaling pathway.
Subject(s)
Depression , Proto-Oncogene Proteins c-akt , Rats , Animals , Depression/drug therapy , Depression/metabolism , Proto-Oncogene Proteins c-akt/metabolism , Phosphatidylinositol 3-Kinases/metabolism , Glycogen Synthase Kinase 3 beta/metabolism , Network Pharmacology , Signal Transduction , TOR Serine-Threonine Kinases/metabolism , Antidepressive Agents/pharmacology , Antidepressive Agents/therapeutic useABSTRACT
Defects in migration and invasion caused by dysregulation of trophoblast epithelial-mesenchymal transformation (EMT) are one of the key factors in the pathogenesis of preeclampsia (PE). RNA-binding motif protein 25 (RBM25) is an RNA-binding protein involved in a variety of cellular processes, including cell proliferation, apoptosis, cell migration and invasion, and EMT. However, the expression and function of RBM25 in placental of PE remain unclear. In this study, we reveal that the expression of RBM25 is significantly elevated in PE placental tissue. RBM25 depletion and over-expression in trophoblast cells increase and decrease, respectively, cell migration and invasion by regulating EMT marker E-cadherin and Vimentin expression. Mechanistically, Grhl2 is involved in RBM25-regulated trophoblast cell migration, invasion, and EMT through RBM25-facilitated mRNA stabilization. Furthermore, the upregulation of Grhl2 enhances the expression of RBM25 through transcription and forms a positive feedback regulation in the progression of PE. These findings suggest that upregulation of RBM25 induces dysregulation of trophoblast EMT by enhancing positive feedback regulation of Grhl2 and RBM25, leading to defects in cell migration and invasion. Targeting this newly identified regulatory axis may provide benefits in the prevention and treatment of PE.
Subject(s)
MicroRNAs , Pre-Eclampsia , Humans , Female , Pregnancy , Trophoblasts/metabolism , Epithelial-Mesenchymal Transition/genetics , Placenta/metabolism , Pre-Eclampsia/pathology , Feedback , Cell Proliferation/genetics , Cell Movement/genetics , MicroRNAs/geneticsABSTRACT
Oxide-based resistive random access memory (RRAM) is standing out in both non-volatile memory and the emerging field of neuromorphic computing, with the consequence of increasing performance demands. Rare-earth doping is often used as an effective means for performance modulation. In this work, the modulation mechanism of the resistive switching (RS) behaviors in trivalent rare-earth Gd-doped HfO2-based RRAM has been carefully investigated using first-principles calculations. The results of electronic structure analysis show that Gd doping would lead to a change in the local geometry of the m-HfO2 defect system and would enhance the Coulomb interaction between the atoms around Gd and oxygen vacancy (VO), which may be one of the reasons for the enhanced conductivity of the HfO2-based RRAM after Gd doping. Thermodynamic and kinetic study results indicate that there is a strong interaction between Gd and its surrounding VO defects, and this strong interaction would not only attract more oxygen vacancies (VOs) to be generated near the dopant Gd, but also increase the migration energy barrier of the +2 charged VOs around the Gd doping site, thus suppressing the random generation of VO filaments, which leads to a better uniformity of the switching parameters during the RS process and improves the performance stability of the devices. The results of this work will provide new insights into modulating the RS behaviors and improving the device performance of HfO2-based RRAM through doping engineering.
ABSTRACT
AIMS: We aimed to test a model in which hope and spiritual well-being acted as protective factors against anxiety and depressive symptoms in childhood cancer patients (CCPs). We hypothesized that hope and spiritual well-being were mutually reinforcing factors that would both reduce anxiety and depressive symptoms. METHODS: Using path analysis, the hypothetical model was tested on a cross-sectional sample of 412 Chinese CCPs aged 8-17 years. Self-reported measures were used to obtain data on participants' social and clinical characteristics, spiritual well-being, hope, anxiety and depressive symptoms. RESULTS: The hypothetical model was supported. Results suggested that sex, treatment type and diagnosis predicted spiritual well-being; diagnosis and time since diagnosis predicted hope. Spiritual well-being and hope were mutually predictive and mutually reinforcing, and were both negatively associated with anxiety and depressive symptoms. This model predicted 40% of the variance in spiritual well-being, 37% in hope, 39% in depressive symptoms, and 28% in anxiety. CONCLUSION: Spiritual well-being and hope were mutually reinforcing and served as protective factors against anxiety and depressive symptoms. These support the value for integrating spiritual and hope elements in developing interventions for CCPs to improve their spiritual and psychological well-being along the disease trajectory.
Subject(s)
Hope , Neoplasms , Psychological Well-Being , Child , Humans , Anxiety/psychology , Cross-Sectional Studies , Depression/psychology , East Asian People , Neoplasms/therapy , Neoplasms/psychology , Spirituality , AdolescentABSTRACT
BACKGROUND: Currently, a paramount issue in nursing education is to motivate nursing undergraduate interns to develop self-directed learning skills and improve their practice satisfaction and professional identity, so as to meet the growing demands in healthcare. OBJECTIVES: This study aimed to examine the effectiveness of a motivational programme based on the Existence-Relatedness-Growth (ERG) theory in developing self-directed learning skills, improving practice satisfaction and promoting the professional identity of nursing undergraduate interns in China. DESIGN: A quasi-experimental study design. SETTING: A government-funded tertiary teaching hospital in Guangzhou, Guangdong province, China. METHODS: This study was conducted with 99 nursing undergraduate interns in a hospital between June 2020 and April 2022. The interns in the experimental group (n = 50) participated in the motivational programme based on ERG theory, while those in the control group (n = 49) underwent a traditional training programme. The interns in the two groups were compared in terms of their degree of self-directed learning, practice satisfaction and professional identity after the training, using independent samples t-test. RESULTS: After the internship, interns in the experimental group showed a statistically significantly higher level of self-directed learning and practice satisfaction than those in the control group (p < 0.05). However, no significant difference was observed in professional identity between the two groups after the internship. CONCLUSIONS: The motivational programme based on ERG theory was shown to be effective in improving self-directed learning and practice satisfaction in nursing undergraduate interns. A large-scale randomized controlled trial is warranted to confirm the results.
Subject(s)
Education, Nursing , Internship and Residency , Students, Nursing , Humans , Learning , Delivery of Health CareABSTRACT
BACKGROUND: Praziquantel (PZQ) has been the first line antischistosomal drug for all species of Schistosoma, and the only available drug for schistosomiasis japonica, without any alternative drugs since the 1980s. However, PZQ cannot prevent reinfection, and cannot cure schistosomiasis thoroughly because of its poor activity against juvenile schistosomes. In addition, reliance on a single drug is extremely dangerous, the development and spread of resistance to PZQ is becoming a great concern. Therefore, development of novel drug candidates for treatment and control of schistosomiasis is urgently needed. METHODOLOGYS/PRINCIPAL FINDINGS: One of the PZQ derivative christened P96 with the substitution of cyclohexyl by cyclopentyl was synthesized by School of Pharmaceutical Sciences of Shandong University. We investigated the in vitro and in vivo activities of P96 against different developmental stages of S. japonicum. Parasitological studies and scanning electron microscopy were used to study the primary action characteristics of P96 in vitro. Both mouse and rabbit models were employed to evaluate schistosomicidal efficacy of P96 in vivo. Besides calculation of worm reduction rate and egg reduction rate, quantitative real-time PCR was used to evaluate the in vivo antischistosomal activity of P96 at molecular level. In vitro, after 24h exposure, P96 demonstrated the highest activities against both juvenile and adult worm of S. japonicum in comparison to PZQ. The antischistosomal efficacy was concentration-dependent, with P96 at 50µM demonstrating the most evident schistosomicidal effect. Scanning electron microscopy demonstrated that P96 caused more severe damages to schistosomula and adult worm tegument compared to PZQ. In vivo, our results showed that P96 was effective against S. japonicum at all developmental stages. Notably, its efficacy against young stage worms was significantly improved compared to PZQ. Moreover, P96 retained the high activity comparable to PZQ against the adult worm of S. japonicum. CONCLUSIONS: P96 is a promising drug candidate for chemotherapy of schistosomiasis japonica, which has broad spectrum of action against various developmental stage, potentially addressing the deficiency of PZQ. It might be promoted as a drug candidate for use either alone or in combination with PZQ for the treatment of schistosomiasis.
Subject(s)
Praziquantel , Schistosomiasis japonica , Schistosomicides , Animals , Mice , Rabbits , Microscopy, Electron, Scanning , Praziquantel/analogs & derivatives , Praziquantel/pharmacology , Schistosoma japonicum/drug effects , Schistosomiasis japonica/drug therapy , Schistosomicides/pharmacologyABSTRACT
OBJECTIVE: Mesenchymal stem cell (MSC)-derived exosomes (MSC-exo) can treat reproductive disorders. However, the action of microRNAs (miRNAs) in this mechanism has yet to be systematically investigated. This study aimed to explore the effect of MSC-exo on TGF-ß1-induced endometrial fibrosis in intrauterine adhesions and elucidate the regulatory mechanisms involved in key genes by comparing miRNA expression profiles. METHODS: MSC-exo were isolated and identified based on particle size and protein marker detection. Cell counting kit-8, flow cytometry, and western blotting were used to determine the effects of MSC-exo on cell function and fibrosis in human endometrial epithelial cells (hEECs). Subsequently, we sequenced and annotated the small RNA in MSC-exo and TGF-ß1-induced MSC-exo to screen for differentially expressed (DE) miRNAs. After the prediction and functional enrichment of target genes of DE miRNAs, key genes were selected for functional experiments. RESULTS: TGF-ß1 inhibited the proliferation of hEECs and promoted apoptosis and fibrosis. However, these effects were significantly reversed by the addition of MSC and MSC-exo. Fifteen DE miRNAs were identified by comparing the miRNA profiles of MSC-exo and TGF-ß1-induced MSC-exo. Among these, miR-145-5p was found to be significantly upregulated in TGF-ß1-induced MSC-exo. Furthermore, the addition of miR-145-5p mimic was found to reverse fibrosis in hEECs while promoting the expression of key autophagy protein P62. CONCLUSION: MSC-exo ameliorated TGF-ß1-induced endometrial fibrosis. RNA sequencing, bioinformatic analysis, and functional experiments revealed that miR-145-5p may exert its action through the P62-dependent autophagy pathway.
ABSTRACT
INTRODUCTION: Cancer and its treatment affect children's physical, psychological and social well-being throughout the disease trajectory. Spiritual well-being is a fundamental dimension of people's overall health and is considered a source of strength to motivate patients to cope with and adapt to their disease. Appropriate spiritual interventions are important to mitigate the psychological impact of cancer on children, with an ultimate goal of improving their quality of life (QoL) throughout the treatment course. However, the overall effectiveness of spiritual interventions for paediatric patients with cancer remains unclear. This paper describes a protocol to systematically summarise the characteristics of studies related to existing spiritual interventions and synthesise their effectiveness on psychological outcomes and QoL among children with cancer. METHODS AND ANALYSIS: Ten databases will be searched to identify appropriate literature: MEDLINE, the Cochrane Central Register of Controlled Trials, EMBASE, CINAHL, PsycINFO, LILACS, OpenSIGLE, the Chinese Biomedical Literature Database, the Chinese Medical Current Contents and the Chinese National Knowledge Infrastructure. All randomised controlled trials that meet our inclusion criteria will be included. The primary outcome will be QoL as evaluated by self-reported measures. The secondary outcomes will be self-reported or objectively measured psychological outcomes, including anxiety and depression. Review Manager V.5.3 will be used to synthesise the data, calculate treatment effects, perform any subgroup analyses and assess the risk of bias in included studies. ETHICAL AND DISSEMINATION: The results will be presented at international conferences and published in peer-reviewed journals. As no individual data will be involved in this review, ethical approval is not required.
Subject(s)
Neoplasms , Quality of Life , Child , Humans , Anxiety , Neoplasms/psychology , Neoplasms/therapy , Spirituality , Systematic Reviews as TopicABSTRACT
Mammalian genes were long thought to be constrained within somatic cells in most cell types. This concept was challenged recently when cellular organelles including mitochondria were shown to move between mammalian cells in culture via cytoplasmic bridges. Recent research in animals indicates transfer of mitochondria in cancer and during lung injury in vivo, with considerable functional consequences. Since these pioneering discoveries, many studies have confirmed horizontal mitochondrial transfer (HMT) in vivo, and its functional characteristics and consequences have been described. Additional support for this phenomenon has come from phylogenetic studies. Apparently, mitochondrial trafficking between cells occurs more frequently than previously thought and contributes to diverse processes including bioenergetic crosstalk and homeostasis, disease treatment and recovery, and development of resistance to cancer therapy. Here we highlight current knowledge of HMT between cells, focusing primarily on in vivo systems, and contend that this process is not only (patho)physiologically relevant, but also can be exploited for the design of novel therapeutic approaches.
Subject(s)
Mitochondria , Neoplasms , Animals , Phylogeny , Mitochondria/metabolism , Neoplasms/genetics , Neoplasms/metabolism , Energy Metabolism , MammalsABSTRACT
OBJECTIVE: To investigate the association between folate levels and the risk of gestational diabetes mellitus (GDM) risk during the whole pregnancy. DESIGN: In this retrospective cohort study of pregnant women, serum folate levels were measured before 24 gestational weeks (GW). GDM was diagnosed between 24th and 28th GW based on the criteria of the International Association of Diabetes and Pregnancy Study Groups. General linear models were performed to examine the association of serum folate with plasma glucose (i.e. linear regressions) and risk of GDM (i.e. log-binomial regressions) after controlling for confounders. Restricted cubic spline regression was conducted to test the dosage-response relationship between serum folate and the risk of GDM. SETTING: A sigle, urban hospital in Shanghai, China. PARTICIPANTS: A total of 42 478 women who received antenatal care from April 2013 to March 2017 were included. RESULTS: Consistent positive associations were observed between serum folate and plasma glucose levels (fasting, 1-h, 2-h). The adjusted relative risks (RR) and 95 % CI of GDM across serum folate quartiles were 1·00 (reference), 1·15 (95 % CI (1·04, 1·26)), 1·40 (95 % CI (1·27, 1·54)) and 1·54 (95 % CI (1·40, 1·69)), respectively (P-for-trend < 0·001). The positive association between serum folate and GDM remained when stratified by vitamin B12 (adequate v. deficient groups) and the GW of serum folate measurement (≤13 GW v. >13 GWs). CONCLUSIONS: The findings of this study may provide important evidence for the public health and clinical guidelines of pregnancy folate supplementation in terms of GDM prevention.
Subject(s)
Diabetes, Gestational , Pregnancy , Female , Humans , Diabetes, Gestational/epidemiology , Blood Glucose , Retrospective Studies , East Asian People , China/epidemiology , Folic AcidABSTRACT
OBJECTIVE@#To investigate and analyze the risk factors of massive hemorrhage in patients with renal cell carcinoma and venous tumor thrombus undergoing radical nephrectomy and removal of venous tumor thrombus.@*METHODS@#From January 2014 to June 2020, 241 patients with renal cancer and tumor thrombus in a single center of urology at Peking University Third Hospital were retrospectively analyzed. All patients underwent radical nephrectomy and removal of venous tumor thrombus. The relevant preoperative indicators, intraoperative conditions, and postoperative data were statistically analyzed by using statistical software of SPSS 18.0. The main end point of the study was intraoperative bleeding volume greater than 2 000 mL. Logistic regression analysis was used to determine the relevant influencing factors. First, single factor Logistic regression was used for preliminary screening of influencing factors, and variables with single factor Logistic regression analysis P < 0.05 were included in multivariate Logistic regression. In all statistical analyses, P < 0.05 is considered statistically significant.@*RESULTS@#Among the 241 patients included, there were 60 cases of massive hemorrhage, 48 males and 12 females, with a median age of 62 years. The number of non-massive hemorrhage was 181. There were 136 males and 45 females, with a median age of 59 years. Univariate analysis showed that the clinical symptoms (both systemic and local symptoms, OR 2.794, 95%CI 1.087-7.181, P=0.033), surgical approach (open surgery, OR 9.365, 95%CI 4.447-19.72, P < 0.001), Mayo grade (Mayo 3-4, OR 5.257, 95%CI 2.806-10.886, P < 0.001), American Society of Anesthesiologists (ASA) score (ASA level 3, OR 2.842, 95%CI 1.338-6.036, P=0.007), preoperative hemoglobin (OR 0.978, 95%CI 0.965-0.991, P=0.001), preoperative platelet count (OR 0.996, 95%CI 0.992-1.000, P=0.037), maximum tumor thrombus width (OR 1.061, 95%CI 1.033-1.091, P < 0.001), Complicated with bland thrombus (OR 4.493, 95%CI 2.264-8.915, P < 0.001), adrenalectomy (OR 3.101, 95%CI 1.614-5.958, P=0.001), segmental resection of the inferior vena cava (OR 2.857, 95%CI 1.395-5.852, P=0.004). There was a statistically significant difference in these aspects(P < 0.05). Multivariate Logistic regression analysis showed that there was a statistically significant difference in surgical approach (open surgery, OR 6.730, 95%CI 2.947-15.368;P < 0.001), Mayo grade (Mayo 3-4, OR 2.294, 95%CI 1.064-4.948, P=0.034), Complicated with bland thrombus (OR 3.236, 95%CI 1.492-7.020, P=0.003).@*CONCLUSION@#Combining the results of univariate and multivariate Logistic regression analysis, the surgical approach, Mayo grade, and tumor thrombus combined with conventional thrombus were associated risk factors for massive hemorrhage during surgery for renal cell carcinoma with tumor thrombus. Patients who undergo open surgery, high Mayo grade, and tumor thrombus combined with conventional thrombus are at a relatively higher risk of massive hemorrhage.
Subject(s)
Male , Female , Humans , Middle Aged , Carcinoma, Renal Cell/pathology , Retrospective Studies , Thrombosis/etiology , Kidney Neoplasms/pathology , Vena Cava, Inferior/surgery , Nephrectomy/methods , Thrombectomy/methods , Risk Factors , HemorrhageABSTRACT
This study aimed to investigate the mechanism of Jiu Wei Bu Xue Oral Liquid on insomnia rats combining the methods of network pharmacology, molecular docking and experimental verification. UPLC-Q-TOF-MS/MS method and TCMIP, TCMSP databases were used to collect the ingredients and targets of Jiu Wei Bu Xue Oral Liquid. Protein-protein interactions and network analysis were performed to screen the key network targets and putative active ingredients of Jiu Wei Bu Xue Oral Liquid in treatment of insomnia, and then following by biological function and KEGG pathway analysis. Then binding ability for key network targets and putative active ingredients were predicted with molecular docking. The prediction targets were validated in para-chlorophenylalanine (PCPA) induced insomnia rats with administration of Jiu Wei Bu Xue Oral Liquid (2, 4, 8 mL·kg-1) for 7 days. Pentobarbital sodium induced sleeping test were performed to evaluate the synergistic sleep-aiding effect of Jiu Wei Bu Xue Oral Liquid. Then glutamic acid (Glu), γ-aminobutyrate (GABA) content and glutamate decarboxylase 1 (GAD67) activity in hypothalamus or hippocampus were evaluated, and the expressions of GAD67, γ-aminobutyric acid receptor subunit α1 (GABRA1) and γ-aminobutyric acid receptor subunit β2 (GABRB2) in hippocampus were detected by qRT-PCR and Western blot methods. Animal experiments were approved by the Institutional Committee on Animal Care of Guangxi Institute of Chinese Medicine & Pharmaceutical Science (the number of permission: 2022060802). Results showed that 16 key network targets and 16 putative active ingredients were obtained by analyzing the herbs-ingredients-targets network of Jiu Wei Bu Xue Oral Liquid in treatment of insomnia. Network pharmacology and molecular docking all indicated these active ingredients, for example atractylenolide Ⅲ, showed better binding ability with GABRA1 and GABRB2. Animal study indicated that, compared to PCPA-induced insomnia model, Jiu Wei Bu Xue Oral Liquid remarkably shortened the sleeping latency and increased the sleeping duration, increased GAD67 activity and the production of GABA in hippocampus of insomnia rats, as well as the expressions of GAD67, GABRA1 and GABRB2, while decreased Glu content in hypothalamus, leading to decreasing of Glu/GABA ratio and recovery of Glu-GABA balance. These results indicated that Jiu Wei Bu Xue Oral Liquid improved insomnia symptoms and helped maintain the Glu-GABA balance within hypothalamus and hippocampus, and reduced the excitatory neurotoxicity within brain. The mechanism may due to the elevation of GAD67 expression and enzyme activity, and the enhancement of type-A GABA receptor (GABAAR)-mediated neurons inhibition.