Dissecting causal relationships between immune cells, plasma metabolites, and COPD: a mediating Mendelian randomization study.

Objective: This study employed Mendelian Randomization (MR) to investigate the causal relationships among immune cells, COPD, and potential metabolic mediators. Methods: Utilizing summary data from genome-wide association studies, we analyzed 731 immune cell phenotypes, 1,400 plasma metabolites, and COPD. Bidirectional MR analysis was conducted to explore the causal links between immune cells and COPD, complemented by two-step mediation analysis and multivariable MR to identify potential mediating metabolites. Results: Causal relationships were identified between 41 immune cell phenotypes and COPD, with 6 exhibiting reverse causality. Additionally, 21 metabolites were causally related to COPD. Through two-step MR and multivariable MR analyses, 8 cell phenotypes were found to have causal relationships with COPD mediated by 8 plasma metabolites (including one unidentified), with 1-methylnicotinamide levels showing the highest mediation proportion at 26.4%. Conclusion: We have identified causal relationships between 8 immune cell phenotypes and COPD, mediated by 8 metabolites. These findings contribute to the screening of individuals at high risk for COPD and offer insights into early prevention and the precocious diagnosis of Pre-COPD.

N-terminal lid swapping contributes to the substrate specificity and activity of thermophilic lipase TrLipE.

TrLipE is a thermophilic lipase that has potential commercial applications because of its catalytic ability under extreme conditions. Consistent with most lipases, the lid of TrLipE is located over the catalytic pocket, controls the substrate channel to the active center, and regulates the substrate specificity, activity, and stability of the enzyme through conformational changes. TrLipE from Thermomicrobium roseum has potential industrial applications, which is hindered by its weak enzymatic activity. Here, 18 chimeras (TrL1-TrL18) were reconstructed by N-terminal lid swapping between TrLipE and structurally similar enzymes. The results showed that the chimeras had a similar pH range and optimum pH as wild TrLipE but a narrower temperature range of 40-80°C, and TrL17 and the other chimeras showed lower optimum temperatures of 70°C and 60°C, respectively. In addition, the half-lives of the chimeras were lower than those of TrLipE under optimum temperature conditions. Molecular dynamics simulations indicated that chimeras had high RMSD, RMSF, and B-factor values. When p-nitrophenol esters with different chains were used as substrates, compared with TrLipE, most of the chimeras had a low Km and high kcat value. The chimeras TrL2, TrL3, TrL17, and TrL18 could specifically catalyze the substrate 4-nitrophenyl benzoate, with TrL17 showing the highest kcat/Km value of 363.88 ± 15.83 L⋅min-1⋅mmol-1. Mutants were then designed by investigating the binding free energies of TrL17 and 4-nitrophenyl benzoate. The results indicated that single, double, and triple substitution variants (M89W and I206N; E33W/I206M and M89W/I206M; and M89W/I206M/L21I and M89W/I206N/L21I, respectively) presented approximately 2- to 3-fold faster catalysis of 4-nitrophenyl benzoate than the wild TrL17. Our observations will facilitate the development of the properties and industrial applications of TrLipE.

Treatment Protocols in the Efficacy and Safety of Anti-EGFR Medicines in Combination with Standard Therapy for Patients with Nasopharyngeal Cancer: A Meta-Analysis.

Objective: This study was conducted to compare the efficacy of standard therapy (radiotherapy/RT/CT) with that of antiepidermal growth factor receptor (anti-EGFR) monoclonal antibody (NPC) therapy in patients with advanced nasopharyngeal cancer. Methods: A meta-analysis was performed to meet the objective of this study. The English databases PubMed, Cochrane Library, and Web of Science were searched. The literature review compared anti-EGFR-targeted therapy with conventional therapy practices. The main outcome measure was overall survival (OS). Secondary goals were progression-free survival (PFS), locoregional recurrence-free survival (LRRFS), distant metastasis-free survival (DMFS), and adverse events (grade 3). Results: The database search resulted in 11 studies, with a total of 4219 participants. It was found that combining an anti-EGFR regimen with conventional therapy did not enhance OS (hazard ratio [HR] = 1.18; 95%confidence interval [CI] = 0.51-2.40; p = 0.70) or PFS appreciably (HR = 0.95; 95%CI = 0.51-1.48; p = 0.88) in patients with nasopharyngeal carcinoma. While LRRFS increased considerably (HR = 0.70; 95%CI = 0.67-1.00; p = 0.01), the combined regimen did not improve DMFS (HR = 0.86; 95%CI = 0.61-1.12; p = 0.36). Treatment-related adverse events included haematological toxicity (RR = 0.2; 95%CI = 0.08-0.45; p = 0.01), cutaneous reactions (RR = 7.05; 95%CI = 2.15-23.09; p = 0.01), and mucositis (RR = 1.96; 95%CI = 1.58-2.09; p = 0.01). Conclusions: Individuals who have nasopharyngeal cancer do not have an increased chance of surviving until a local recurrence of their disease if they get normal therapy in addition to an anti-EGFR regimen. However, this combination does not enhance overall survival. On the other hand, this factor adds to an increase in the number of adverse effects.

Efficient Biotransformation of Sclareol to Sclareolide by Filobasidium magnum JD1025.

In this study, a newly isolated strain Filobasidium magnum JD1025 was investigated for its production of sclareolide, which was verified to be a valuable raw material in various industrial fields. Together with a comprehensive analysis of the genome sequence, effective fermentation method to convert sclareol to sclareolide via the isolated strain was explored and optimized by taking the selected co-solvent and nitrogen source into account. The results showed that the final conversion rate could be achieved at 88.79 ± 1.06% with the initial sclareol concentration of 30 g·L-1 after 72 h in baffled flask. The corresponding yield concentration of sclareolide was 21.62 ± 0.26 g·L-1 and the conversion rate per unit thallus attained to 6.11 ± 0.06 % g-1·L-1. Overall, the current study suggested a valid method for the application of Filobasidium magnum JD1025 as bio-transformer to produce sclareolide from sclareol.

Preparation and Characterization of an Ancient Aminopeptidase Obtained from Ancestral Sequence Reconstruction for L-Carnosine Synthesis.

As a biologically active peptide, L-carnosine has been widely used in the pharmaceutical, cosmetic and health care industries due to its various physiological properties. However, relatively little research is available regarding L-carnosine's enzymatic synthesis function. In this study, a potential enzyme sequence with the function of carnosine synthesizing was screened out using the ancestral sequence reconstruction (ASR) technique. Identified with L-carnosine synthesis activity, this enzyme was further confirmed using autoproteolytic phenomenon via Western blot and N-terminal sequencing. After purification, the enzymatic properties of LUCA-DmpA were characterized. The melting temperature (Tm) and denaturation enthalpy (ΔH) of LUCA-DmpA were 60.27 ± 1.24 °C and 1306.00 ± 26.73 kJ·mol-1, respectively. Circular dichroism (CD) spectroscopy results showed that this ancestral enzyme was composed of α-helix (35.23 ± 0.06%), ß-sheet (11.06 ± 0.06%), ß-turn (23.67 ± 0.06%) and random coil (32.03 ± 0.06%). The enzyme was characterized with the optimal temperature and pH of 45 °C and 9.0, respectively. Notably, LUCA-DmpA was also characterized with remarkable pH tolerance based on the observation of more than 85% remaining enzymatic activity after incubation at different pH buffers (pH = 6-11) for 12 h. Additionally, rather than being improved or inhibited by metal ions, its enzymatic activity was found to be promoted by introducing organic solvent with a larger log P value. Based on these homology modeling results, the screened LUCA-DmpA is suggested to have further optimization potential, and thereafter to be offered as a promising candidate for real industrial applications.

Hotspots and Mechanisms of Action of the Thermostable Framework of a Microbial Thermolipase.

The lipase TrLipB from Thermomicrobium roseum is highly thermostable. However, its thermostable skeleton and mechanism of action should be investigated for industrial applications. Toward this, TrLipB was crystallized using the hanging-drop vapor diffusion method and subjected to X-ray diffraction at 2.0 Å resolution in this study. The rigid sites, such as the prolines on the relatively flexible loops on the enzyme surface, were scanned. Soft substitutions of these sites were designed using both molecular dynamics (MD) simulation and site-directed mutagenesis. The thermostability of several substitutions decreased markedly, while the catalytic efficiencies of the P9G, P127G, P194G, and P300G mutants reduced substantially; additionally, the thermostable framework of the double mutant, P194G/P300G, was considerably perturbed. However, the substitutions on the lid of the enzyme, including P49G and P48G, promoted the catalytic efficiency to approximately 150% and slightly enhanced the thermostability below 80 °C. In MD simulations, the P100G, P194G, P100G/P194G, P194G/P300G, and P100G/P194G/P300G mutants showed high B-factors and RMSD values, whereas the secondary structures, radius of gyration, H-bonds, and solvent accessible surface areas of these mutants were markedly affected. Our observations will assist in understanding the natural framework of a stable lipase, which might contribute to its industrial applications.

Research Progress of PI3K/PTEN/AKT Signaling Pathway Associated with Renal Cell Carcinoma.

Renal cell carcinoma is a common renal malignancy of the urinary system and the most malignant type of kidney cancer. Phosphatidylinositol 3-kinase (PI3K) is an intracellular phosphatidylinositol kinase associated with oncogene products such as v-src and with serine/threonine kinase activity, and its increased activity correlates with the development of several cancers. Protein kinase B (AKT) is a cyclic guanosine phosphate-dependent protein kinase that plays an important role in cell survival and apoptosis. Phosphatase and tensin homolog (PTEN), a newly discovered oncogene in recent years, participates in tumorigenesis and development by competing with tyrosine kinases for common substrates. The product encoded by PTEN was found to negatively regulate the PI3K/Akt signaling pathway, thereby inhibiting cell proliferation and promoting apoptosis. The PI3K/PTEN/AKT signaling pathway has also been identified in several studies as being involved in the development of several malignancies, including renal cell carcinoma. Radiotherapy is currently one of the most effective means of treatment for renal cell carcinoma, whereas it is predisposed to significant tolerance during the course of radiotherapy, thereby leading to treatment failure. Therefore, new treatment options may potentiate the efficiency of renal cell carcinoma treatment. With the development of tumor molecular biology, targeted biological therapy for malignant tumors has gradually become a research hotspot. Given the above research background, this study reviews the application of the PI3K/PTEN/AKT signaling pathway in renal cell carcinoma, aiming to provide more references for the treatment of clinical renal cell carcinoma.

Adenylation domains of nonribosomal peptide synthetase: A potential biocatalyst for synthesis of dipeptides and their derivatives.

Dipeptides and their derivatives are important functional compounds that can be applied to fields such as medicine and food. As biological macromolecules, the adenylation domains of nonribosomal peptide synthetase (NRPS) can recognize and activate various building blocks, such as amino acids, for the biosynthesis of nonribosomal peptides. In this way, the amide bond formation can be achieved through a nucleophilic reaction where the adenylation domain serves as a biocatalyst and is further used to conduct dipeptide synthesis. In this study, the adenylation domains (BAA2, BBA2, and BCA4) of bacitracin synthetase were predicted and expressed. The substrate evaluation results showed that adenylation domains displayed broad substrate selectivity for amino acids in vitro. Furthermore, the use of dipeptide synthesis in adenylation domains suggested that the polarity of amino acids could have an influence on nucleophilic reactions. Finally, L-alanyl-L-glutamine and aspartame were successfully synthesized through catalysis by the adenylation domains BAA2 and BCA4, respectively. This study expands on approaches to the synthesis of functional dipeptides and their derivatives based on the chemoenzymatic process.

Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression.

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was "ACTTAGTTTAAGCAATAGACAAAGT", and this can be degenerated to "ACTTWGTTTAWSSNATAVACAAAGT" in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

Enhancing Geranylgeraniol Production by Metabolic Engineering and Utilization of Isoprenol as a Substrate in Saccharomyces cerevisiae.

The amount of geranylgeranyl diphosphate (GGPP) is vital for microbial production of geranylgeraniol (GGOH) in Saccharomyces cerevisiae. In this study, a GGPP synthase with stronger catalytic ability was used to increase the supply of GGPP, and an engineered strain producing 374.02 mg/L GGOH at the shake flask level was constructed. Then, by increasing the metabolic flux of the mevalonate (MVA) pathway and the supply of isopentenyl pyrophosphate (IPP), the titer was further increased to 772.98 mg/L at the shake flask level, and we achieved the highest GGOH titer to date of 5.07 g/L in a 5 L bioreactor. This is the first report on the utilization of isoprenol for increasing the amount of IPP and enhancing GGOH production in S. cerevisiae. In the future, these strategies and engineered strains can be used to enhance the production of other terpenoids in S. cerevisiae.

Efficient Biotransformation of Phytosterols to Dehydroepiandrosterone by Mycobacterium sp.

In this study, a method for the efficient production of dehydroepiandrosterone (DHEA) from phytosterols in a vegetable oil/aqueous two-phase system by Mycobacterium sp. was developed. After the 3-hydroxyl group of phytosterols was protected, they could be converted into DHEA with high yield and productivity by Mycobacterium sp. NRRL B-3683. In a shake flask biotransformation, 15.05 g l-1 of DHEA and a DHEA yield of 85.39% (mol mol-1) were attained after 7 days with an initial substrate concentration of 25 g l-1. When biotransformation was carried out in a 30-l stirred bioreactor with 25 g l-1 substrate, the DHEA concentration and yield was 16.33 g l-1 and 92.65% (mol mol-1) after 7 days, respectively. The results of this study suggest that inexpensive phytosterols could be utilized for the efficient production of DHEA.

Strategy of oxygen transfer coefficient control on the L-erythrulose fermentation by newly isolated Gluconobacter kondonii

Background: The effect of diverse oxygen transfer coefficient on the L-erythrulose production from meso-erythritol by a newly isolated strain, Gluconobacter kondonii CGMCC8391 was investigated. In order to elucidate the effects of volumetric mass transfer coefficient (K La) on the fermentations, baffled and unbaffled flask cultures, and fed-batch cultures were developed in present work. Results: With the increase of the K La value in the fed-batch culture, L-erythrulose concentration, productivity and yield were significantly improved, while cell growth was not the best in the high K La. Thus, a two-stage oxygen supply control strategy was proposed, aimed at achieving high concentration and high productivity of L-erythrulose. During the first 12 h, Klawas controlled at 40.28 h-1 to obtain high value for cell growth, subsequently K La was controlled at 86.31 h-1 to allow for high L-erythrulose accumulation. Conclusions: Under optimal conditions, the L-erythrulose concentration, productivity, yield and DCW reached 207.9 ± 7.78 g/L, 6.50 g/L/h, 0.94 g/g, 2.68 ± 0.17 g/L, respectively. At the end of fermentation, the L-erythrulose concentration and productivity were higher than those in the previous similar reports.