Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 10 de 10
Filter
1.
J Oral Facial Pain Headache ; 30(4): 330-337, 2016.
Article in English | MEDLINE | ID: mdl-27792801

ABSTRACT

AIMS: To assess the effects of application of an oxalic acid-based desensitizing agent before restoration of noncarious cervical lesions (NCCLs) with either a silorane-based or a methacrylate-based composite resin on decreasing the absolute risk and intensity of dentin hypersensitivity over the course of a 1-year follow-up. METHODS: NCCLs in 31 patients (age range 24-66 years) were selected and randomly divided into four groups (n = 31 in all groups). In the Z250 and P90 groups, the restorations were performed with a methacrylate-based composite resin (Filtek Z250) and a silorane-based composite resin (Silorane P90), respectively. In the Z250 + OA and P90 + OA groups, the same composite resins were used, but an oxalic acid-based desensitizing agent (Desenssiv, SSWhite) was first applied. All NCCLs were evaluated before restoration (BR) and at 30, 60, 90, 180, and 360 days after treatment. Teeth sensitivity to evaporative and tactile stimuli was measured by a visual analog scale (VAS). The results were analyzed with statistical tools including Wilcoxon and Friedman tests for within-group comparisons and ANOVA and Bonferroni post hoc tests for between-group comparisons (P < .05). RESULTS: Reduction in dentin hypersensitivity was observed for all treatment groups; however, these reductions were more pronounced when oxalic acid was applied before restoring the NCCL (P < .001). Complete elimination of pain was not achieved by any treatment modalities for the first 6 months; afterwards, in the groups that had received application of the oxalate-based desensitizing agent, the absolute risk of dentin hypersensitivity was significantly reduced (P < .01). CONCLUSION: The restoration of sensitive NCCLs with composite resins reduces dentin hypersensitivity. This reduction is more pronounced if an oxalic acid-based desensitizing agent is applied prior to the restoration. In addition, its application reduces the absolute risk of dentin hypersensitivity after 6 months of treatment.


Subject(s)
Dental Restoration, Permanent , Dentin Sensitivity/drug therapy , Oxalic Acid/therapeutic use , Tooth Cervix , Adult , Aged , Bisphenol A-Glycidyl Methacrylate , Double-Blind Method , Female , Humans , Male , Methacrylates , Middle Aged , Silorane Resins , Young Adult
2.
Plant Dis ; 93(4): 432, 2009 Apr.
Article in English | MEDLINE | ID: mdl-30764235

ABSTRACT

Blackberry yellow vein disease (BYVD) has emerged as an important disease of blackberry (Rubus spp.) in the south and southeastern United States (2,3). In an effort to characterize viruses that may be involved in the disease, double-stranded RNA extracted from a symptomatic 'Apache' blackberry from South Carolina was used for shotgun cDNA cloning (4). Sequence analysis showed that in addition to Blackberry yellow vein associated virus (BYVaV) (2), a constant component of BYVD, sequences of Impatiens necrotic spot virus (INSV) also were obtained. The 623-nt fragment of INSV (Genbank Accession No. EU287930) shared 98% nucleotide and amino acid sequence identity with GenBank Accession No. NC003616. Confirmation of the results of the initial shotgun cloning was done by reverse transcription-PCR with primers INSVF (5' GATCTGTCCTGGGATTGTTC 3') and INSVR (5' GTCTCCTTCTGGTTCTATAATCAT 3') that amplify a 460 base fragment of the M RNA of INSV. Amplicons obtained from single-stranded and dsRNA templates were sequenced and found to be identical with EU287930. The identity of INSV by PCR was also supported by positive results with a commercially available INSV-ELISA kit (AC Diagnostics, Fayetteville, AR). Earlier, more than 400 plants from North Carolina, South Carolina, and Virginia with BYVD and other virus-like symptoms were tested for INSV by ELISA and approximately 33% were found to be infected with the virus (1). Thus, INSV appears to be one of the major viruses infecting blackberry in the southeastern United States, and it remains to be seen if INSV acts synergistically with BYVaV and other viruses to contribute to the severity of BYDV. To our knowledge, this is the first report of INSV infecting Rubus spp. References: (1) T. L. Guzmán-Baeny. M.S. thesis. North Carolina State University, Raleigh, 2003. (2) J. Susaimuthu et al. Plant Pathol. 55:607, 2006. (3) J. Susaimuthu et al. Virus Res. 131:145, 2008. (4) I. E. Tzanetakis et al. J. Virol. Methods 124:73, 2005.

3.
J Intellect Disabil Res ; 51(Pt 2): 91-100, 2007 Feb.
Article in English | MEDLINE | ID: mdl-17217473

ABSTRACT

BACKGROUND: Most standardized intelligence tests require more than 1 hour for administration, which is problematic when evaluating individuals with intellectual disabilities and developmental disabilities (IDDD), because a significant proportion of these individuals can not tolerate lengthy evaluations. Furthermore, most standardized intelligence tests are of limited usefulness for individuals with severe cognitive deficits because of floor effects. METHODS: A number of low-difficulty items were selected from standardized tests. A total of 271 participants with profound, severe, moderate and mild levels of cognitive impairment took part in this study. In the formative phase, 68 participants were evaluated with the selected items, and those items that differentiated between levels of cognitive impairment were retained in the battery. The instrument was then modified and standardized with an additional 203 participants. RESULTS: The instrument, referred to as the Rapid Assessment for Developmental Disabilities (RADD), required 10-25 min for administration. Internal reliability estimates from the RADD total score and from individual subtests satisfied conventional and rigorous statistical criteria (median alpha r = 0.93). The RADD total score was strongly correlated with the level of cognitive impairment (rho = 0.86). The RADD total score and individual subtests differentiated between all levels of cognitive impairment ( Wilks Lambda = 0.135, F(42,525.832) = 12.075, P < 0.001). Receiver operating characteristic curves indicated the instrument was particularly sensitive to the cognitive abilities of the most seriously impaired participants. CONCLUSIONS: The RADD, composed of low-difficulty items from published tests, is rapidly administered, assesses a wide range of cognitive skills and differentiates among all levels of cognitive impairment. The battery has clinical utility with populations exhibiting short attention spans because of its ability to quickly assess a wide range of cognitive abilities. The RADD also has research potential for the documentation of cognitive function in studies of individuals with IDDD.


Subject(s)
Cognition Disorders/diagnosis , Cognition Disorders/epidemiology , Developmental Disabilities/epidemiology , Surveys and Questionnaires , Adolescent , Adult , Aged , Child , Female , Humans , Male , Middle Aged , Reproducibility of Results , Sensitivity and Specificity , Severity of Illness Index
4.
Rev Neurol ; 36(11): 1015-8, 2003.
Article in Spanish | MEDLINE | ID: mdl-12808494

ABSTRACT

INTRODUCTION: The cognitive disorders presented by patients with Parkinson s disease (PD) have drawn attention to the role played by the basal ganglia in cognition. It has been suggested that through a system of cortico subcortical circuits they monitor the work done by the frontal regions by guiding the anterior and posterior attentional systems, whose functioning is necessary for the so called executive functions to be carried out. PATIENTS AND METHODS: We studied 10 patients with PD in developmental stages I and II according to the scale of Hoehn and Yahr, and 10 healthy paired controls. All of them were administered a test for simple sustained attention, complex sustained attention and attentional shift. RESULTS: In the simple sustained attention task there were no significant differences between groups. In the complex sustained attention test the patients committed more mistakes, and in the attentional shift task they committed more omissions and there was a significant increase in reaction time. CONCLUSIONS: Even in the early stages of the disease, patients suffering from Parkinson present cognitive disorders. These are concentrated in the detection and evaluation of new information, in the capability to shift attention between different spatial regions in a flexible manner and in choosing, inhibiting and activating motor programmes. In order to detect these alterations more sensitive and complex tests must be used.


Subject(s)
Attention/physiology , Cognition Disorders/physiopathology , Parkinson Disease/pathology , Parkinson Disease/physiopathology , Humans , Neuropsychological Tests
5.
Rev. neurol. (Ed. impr.) ; 36(11): 1015-1018, 1 jun., 2003.
Article in Es | IBECS | ID: ibc-27645

ABSTRACT

Introducción. Los trastornos cognitivos que presentan los pacientes con enfermedad de Parkinson (EP) han llamado la atención sobre la función de los ganglios basales en la cognición. Se ha propuesto que monitorizan el trabajo de las regiones frontales mediante un sistema de circuitos cortico subcorticales, al guiar a los sistemas atencionales anterior y posterior, cuyo funcionamiento se necesita para el desarrollo de las llamadas funciones ejecutivas. Pacientes y métodos. Se estudiaron 10 pacientes con EP en estadios evolutivos I y II según la escala de Hoehn yYahr y 10 controles sanos pareados. A todos se les aplicó una prueba de atención sostenida simple, atención sostenida compleja y de cambio atencional. Resultados. En la prueba de atención sostenida simple no hubo diferencias significativas entre los grupos. En la de atención sostenida compleja los pacientes cometieron una mayor cantidad de errores, y en la de cambio atencional cometieron más omisiones y aumentaron significativamente su tiempo de reacción. Conclusiones. Los pacientes parkinsonianos que se encuentran en estadios tempranos de la enfermedad presentan alteraciones cognitivas. Éstas se concentran en la detección y evaluación de nueva información, en la posibilidad de cambiar de manera flexible la atención entre regiones espaciales diferentes y en elegir, inhibir y activar programas motores. Para detectar estas alteraciones se precisa de pruebas más sensibles y complejas (AU)


Subject(s)
Humans , Parkinson Disease , Attention , Cognition Disorders , Neuropsychological Tests
6.
Genesis ; 31(1): 17-29, 2001 Sep.
Article in English | MEDLINE | ID: mdl-11668674

ABSTRACT

Rab GTPases are essential for vesicular transport. Rab GDP dissociation inhibitor (GDI) binds to GDP-bound rabs, removes rabs from acceptor membranes and delivers rabs to donor membranes. We isolated lethal GDI mutations in Drosophila and analyzed their developmental phenotypes. To learn how these mutations affect GDI structure, the crystal structure of Drosophila GDI was determined by molecular replacement to a resolution of 3.0 A. Two hypomorphic, missense mutations are located in domain II of GDI at highly conserved positions, but not in previously identified sequence conserved regions. The mutant GDIs were tested for ability to extract rabs from membranes and showed wild-type levels of rab membrane extraction. The two missense alleles showed intragenic complementation, indicating that domain II of GDI may have two separable functions. This study indicates that GDI function is essential for development of a complex, multicellular organism and that puparium formation and pole cell formation are especially dependent on GDI function.


Subject(s)
Cell Membrane/metabolism , Drosophila melanogaster/embryology , Embryonic Development , Guanine Nucleotide Dissociation Inhibitors/physiology , Alleles , Animals , Blotting, Western , Conserved Sequence , Crystallography, X-Ray , Drosophila melanogaster/genetics , Ethyl Methanesulfonate/pharmacology , Female , Genes, Lethal , Genetic Complementation Test , Guanine Nucleotide Dissociation Inhibitors/chemistry , Homozygote , In Vitro Techniques , Male , Mutagenesis/drug effects , Mutation, Missense , Phenotype , Protein Structure, Secondary , Sequence Analysis, DNA
7.
Prim Care Update Ob Gyns ; 8(2): 53-58, 2001 Mar.
Article in English | MEDLINE | ID: mdl-11246028

ABSTRACT

Although hantaviruses have been known to exist for over 40 years, they were thought only to be the cause of hemorrhagic fever and renal syndrome (HFRS) in Europe and Asia. Rodents are the primary hosts of hantaviruses, and humans become infected mainly by inhalation of viral particles in the rodent excreta. The United States was thought to be spared from pathologic hantaviruses until the summer of 1993, when an outbreak of acute respiratory distress syndrome occurred in the Four Corners region of the United States, which includes Colorado, New Mexico, Arizona, and Utah. Through serological studies, the etiologic agent of this respiratory disease was found to be a heretofore-unknown hantavirus that was named the Sin Nombre virus. The resulting condition was renamed Hantavirus Pulmonary Syndrome (HPS). HPS begins as a febrile prodrome and quickly progresses to a life-threatening cardiorespiratory failure. A laboratory triad of thrombocytopenia, leucocytosis with bandemia, and immunoblasts is specific to HPS, and enzyme-linked immunosorbent assay remains the gold standard for diagnosis of hantaviruses. The management of both HFRS and HPS is mainly supportive, although ribavirin has been shown to be useful for HFRS. Eliminating exposure to rodents remains the key to prevention of hantavirus infection.

8.
J Cataract Refract Surg ; 26(10): 1442-50, 2000 Oct.
Article in English | MEDLINE | ID: mdl-11033389

ABSTRACT

PURPOSE: To assess the viability of custom excimer laser ablations for treating irregular astigmatism. SETTING: Single-center prospective study of a new custom-ablation technique. METHODS: Twelve patients received 15 custom ablations for irregular astigmatism resulting from keratoconus, penetrating keratoplasty for keratoconus, prior decentered laser in situ keratomileusis, or incisional refractive surgery. Follow-up ranged from 6 weeks to 14 months. Initially, the laser beam was manually decentered; later, the Contoured Ablation Patterns (CAP) method (VISX, Inc.) was used to automatically decenter the ablation over the corneal elevation. RESULTS: Results are presented in a case-by-case fashion. In the manual decentration group, the uncorrected visual acuity (UCVA) was 20/50 or better in 9 of 11 eyes (81.8%) and 20/40 or better in 7 eyes (63.6%). Surgery resolved or decreased visual symptoms when present. The best corrected visual acuity (BCVA) was maintained or improved in all eyes. Persistent

Subject(s)
Astigmatism/surgery , Keratomileusis, Laser In Situ/methods , Photorefractive Keratectomy/methods , Adult , Cornea/anatomy & histology , Cornea/surgery , Corneal Topography , Female , Humans , Lasers, Excimer , Male , Middle Aged , Prospective Studies , Visual Acuity
9.
J Helminthol ; 72(4): 343-7, 1998 Dec.
Article in English | MEDLINE | ID: mdl-9858632

ABSTRACT

A single oral dose of an aqueous suspension containing 11,350,000 chlamydospores of a Mexican isolate of Duddingtonia flagrans (FTHO-8) given to sheep, resulted in a maximum reduction of 88% (range 86.7-90.4%) of the population of Haemonchus contortus infective larvae in the faeces. The effect of this treatment continued for 4-5 days after administration of the suspension. The possible use of this treatment as a method of control of ovine haemonchosis is discussed.


Subject(s)
Fungi , Haemonchiasis/therapy , Haemonchiasis/veterinary , Pest Control, Biological/methods , Sheep Diseases/parasitology , Administration, Oral , Animals , Feces/parasitology , Female , Haemonchus/isolation & purification , Male , Sheep , Sheep Diseases/therapy
10.
Ann N Y Acad Sci ; 793: 521-4, 1996 Sep 30.
Article in English | MEDLINE | ID: mdl-8906205

ABSTRACT

There is evidence to support a relationship between oxidative stress and protease release in "ischemia-reperfusion damage." We have proposed that aprotinin may exert an antioxidant effect. A double blind clinical trial was performed with a control (G-1) and treated (G-2) groups, both submitted to CMCS. Blood samples were taken 5 times. Biochemical indicators were measured spectrophotometrically. Aprotinin was supplied by Bayer. Malonildialdehyde levels were greater in G-1 (7.2 +/- 3.6 nmoles/ml) than in G-2 (4 +/- 1.65) at the time of reperfusion. Phospholipase A2 exhibited a tendency of higher activity in G-1 than in G-2. Uric acid levels were higher in G-2 (431 +/- 274 mumoles/1) than in G-1 (224 +/- 188) at 5 minutes after aortic clamping, and catalase activity was greater in G-2 (294 +/- 55 KU/1) than in G-1 (118 +/- 47) at time of reperfusion. Low cardiac output was 10% in G-2 and 30% in G-1. Arrythmias appeared in 30% of G-2 and in 60% of G-1. These results suggest an antioxidant effect of aprotinin under ischemia-reperfusion conditions.


Subject(s)
Aprotinin/therapeutic use , Cardiac Surgical Procedures/adverse effects , Myocardial Reperfusion Injury/prevention & control , Double-Blind Method , Humans , Myocardial Reperfusion Injury/etiology , Oxidative Stress
SELECTION OF CITATIONS
SEARCH DETAIL