Cretaceous crown male ant reveals the rise of modern lineages.

Most described Mesozoic ants belong to stem groups that existed only during the Cretaceous period. Previously, the earliest known crown ants were dated to the Turonian (Late Cretaceous, ca. 94-90 million years ago (Ma)) deposits found in the USA, Kazakhstan, and Botswana. However, the recent discovery of an alate male ant in Kachin amber from the earliest Cenomanian (ca. 99 Ma), representing a new genus and species, Antiquiformica alata, revises the narrative on ant diversification. Antiquiformica can be distinctly differentiated from all known male stem ants by its geniculate antennae with elongated scape, extending far beyond the occipital margin of the head and half the length of the funiculus, as well as its partly reduced forewing venation. Furthermore, the combination of a one-segmented waist with a well-developed node, elongated scape extending beyond the occipital margin, and reduced forewing venation, particularly the completely reduced m-cu and rs-m crossveins and absence of rm and mcu closed cells, firmly places the fossil within the extant subfamily Formicinae. Fourier transform infrared spectroscopy (FTIR) confirmed that the amber containing Antiquiformica alata originated from the Kachin mines in Myanmar. This discovery significantly revises our understanding of the early evolution of Formicinae. The presence of Antiquiformica in Cenomanian amber indicates that the subfamily Formicinae emerged at least by the start of the Late Cretaceous, with crown ants likely originating earlier during the earliest Cretaceous or possibly the Late Jurassic, although paleontological evidence is lacking to support the latter hypothesis.

Preparation and characterisation of kaempferol composite carrier solid dispersion: evaluation of its application in preventing soybean oil spoilage.

Kaempferol (KPF) can be used as a natural antioxidant and food additive in food processing. However, the poor solubility of KPF limited its bioavailability and application. In order to improve the solubility of KPF, kaempferol composite carrier solid dispersion (KPF-CC-SD) was prepared and the process was optimised. When the ratio of KPF: CA (citric acid): Soluplus reached 1:4:6, the dissolution rate was the highest, and the sample was stable over 12 weeks. The characterisation results indicated that KPF-CC-SD exists in an amorphous form. Peroxidation value and acid value of soybean oil showed that the preservation effect of KPF-CC-SD was better than that of KPF, and the inhibition effect of KPF-CC-SD on acid value was better than that of butylated hydroxytoluene. In conclusion, KPF-CC-SD can change the solubility, crystal form and spatial stability of KPF through the carrier, which has a great application prospect in the field of food preservation.

Future Trends in Obolodiplosis robiniae Distribution across Eurasian Continent under Global Climate Change.

Obolodiplosis robiniae was discovered in Eurasia at the beginning of the 21st century. In this study, we explore the present and future (in the years 2050 and 2070) trends in the potential distribution of O. robiniae in Eurasia under diverse climate change scenarios based on a maximum entropy model. Our findings indicated that the current potential distribution area of O. robiniae is within the range of 21°34' and 65°39' N in the Eurasian continent. The primary factor controlling the distribution of O. robiniae is temperature. The highly and moderately suitable areas are mainly distributed in the semi-humid and semi-arid regions, which also happen to be the locations where the host black locust (Robinia pseudoacacia L.) grows at its fastest rate. The forecast of the potential distribution area of O. robiniae revealed that the species would benefit from global warming. The region suitable for the habitat of O. robiniae is characterized by a large-scale northward expansion trend and an increase in temperature. This information would help the forestry quarantine departments of Asian and European countries provide early warnings on the probable distribution areas of O. robiniae and provide a scientific basis for the prevention and control of O. robiniae spread and outbreaks.

Projecting the Potential Distribution of Glossinamorsitans (Diptera: Glossinidae) under Climate Change Using the MaxEnt Model.

Glossina morsitans is a vector for Human African Trypanosomiasis (HAT), which is mainly distributed in sub-Saharan Africa at present. Our objective was to project the historical and future potentially suitable areas globally and explore the influence of climatic factors. The maximum entropy model (MaxEnt) was utilized to evaluate the contribution rates of bio-climatic factors and to project suitable habitats for G. morsitans. We found that Isothermality and Precipitation of Wettest Quarter contributed most to the distribution of G. morsitans. The predicted potentially suitable areas for G. morsitans under historical climate conditions would be 14.5 million km2, including a large area of Africa which is near and below the equator, small equatorial regions of southern Asia, America, and Oceania. Under future climate conditions, the potentially suitable areas are expected to decline by about -5.38 ± 1.00% overall, under all shared socioeconomic pathways, compared with 1970-2000. The potentially suitable habitats of G. morsitans may not be limited to Africa. Necessary surveillance and preventive measures should be taken in high-risk regions.

The Potential Global Distribution of Sirex juvencus (Hymenoptera: Siricidae) under Near Current and Future Climatic Conditions as Predicted by the Maximum Entropy Model.

Wood wasp species in the genus Sirex are known pests of forestry. They cause significant economic losses due to their impacts on plant health and wood quality. S. juvencus (Hymenoptera: Siricidae), widely distributed in Asia, Europe, and North America, is known to negatively impact forestry, infesting Picea, Pinus, Larix, Abies, Cupressus, and Pseudotsuga species. This pest destroys plants by depositing eggs, mucus, and its obligate mutualistic fungus, Amylostereum areolatum. Its obligate mutualistic fungus is to provide nutrition for S. juvencus larva. Despite its extensive distribution range, little is known about which environmental variables significantly impact current and future distribution patterns of S. juvencus for pest control and monitoring. Here we used the maximum entropy model in conjunction with occurrence points of S. juvencus and environmental variables to predict the current and future global potential distribution of S. juvencus. We used the jackknife method and Pearson's correlation analysis to select the environmental variables that influence the geographic distribution of S. juvencus, which resulted in the inclusion of the monthly average maximum temperature in February, the max temperature of warmest month, monthly average minimum temperature in July, monthly total precipitation in June, precipitation of the driest month, monthly total precipitation in September, and the temperature annual range. Temperature and precipitation are mainly likely to drive the distribution enabled by its obligate mutualistic fungus and the potential to co-infect with other Sirex species. The high temperature and low humidity influence S. juvencus eggs and larvae directly and indirectly via fungus-growth, which enables the larvae to survive. Furthermore, S. juvencus may increase its distribution to moderately suitable areas due to competition or dependency on other Sirex species during the infestation. Under the future climatic conditions, the highly suitable area increased by 32.79%, while the moderately suitable area, low suitable area, and unsuitable area increased by 28.14%, 3.30%, and 2.15%. Under climate changes, S. juvencus may spread in previously unsuitable areas rapidly.

Jurassic scorpionflies (Mecoptera) with swollen first metatarsal segments suggesting sexual dimorphism.

BACKGROUND: Sexual dimorphism is widespread in insects. The certain specialized structures may be used as weapons in male-male combats or as ornaments to enhance mating opportunities. RESULTS: We report striking swollen first tarsal segments in two families, four genera and six species of scorpionflies from the Middle Jurassic Yanliao Biota of Northeastern China. Swollen tarsal segments are restricted to male specimens and to hind leg tarsi. The geometric morphometric analyses reveal that the degree of swelling within the orthophlebiid species possessing swollen first metatarsal segments is species-specific, which can be used as a diagnostic character for taxonomic and phylogenetic studies. CONCLUSIONS: The new findings indicate that swollen first metatarsal segments are relatively common in the family Orthophlebiidae during the Middle Jurassic. The tarsal swellings are considered to be sexually dimorphic, potentially associated with sexually display by males and/or camouflage of a "nuptial gift" in the mating process.

A new contrast-to-noise ratio for image quality characterization of a coded-aperture γ camera.

The gamma-ray imaging technique was developed and is widely used in several nuclear engineering fields. Specifically, compared with the traditional point-by-point radiation detector, the coded-aperture gamma camera has advantages of a wide field of view, high angular resolution, and high efficiency. Several methods for characterizing image quality, including the figure of merit (FOM) method and the contrast-to-noise ratio (CNR) method, were assessed and developed. These methods have their respective drawbacks depending on the circumstances. The FOM lacks reliability in exhibiting the impact of background noise fluctuation on the purity of a real image. The CNR characterizes image quality with inconsistent sensitivity while the source moves along the X and Y directions. Therefore, a new CNR method was proposed to achieve better performance and greater consistency in real imaging. With our coded-aperture imaging system developed in the laboratory, we performed simulations within the MATLAB and Geant4 platforms and real imaging experiments to analyze and compare images and the results of these three characterization methods. The results show that the new CNR method is reliable and practical in regard to real imaging performance.

Single-Molecule MicroRNA Electrochemiluminescence Detection Using Cyclometalated Dinuclear Ir(III) Complex with Synergistic Effect.

The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir(III) complex [Ir2(dfppy)4(imiphenH)]PF6 (1·PF6, PF6- = hexafluorophosphate) in which two {Ir(dfppy)2}+ units are bridged by an imiphenH- ligand. The ECL intensity from complex 1·PF6 is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2 and 3·PF6, respectively. Theoretical calculation reveals that the S0 to S1 excitation is a local excitation in 1·PF6 with two electron-coupled Ir(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1·PF6 can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level.

Hypoxia-induced shedding of MICA and HIF1A-mediated immune escape of pancreatic cancer cells from NK cells: role of circ_0000977/miR-153 axis.

One key to malignant progression of pancreatic cancer (PC) is the acquired ability of tumour cells to escape immune-mediated lysis. Hypoxic microenvironment plays a causal role in PC metastasis. According to previous studies, hypoxia could induce the upregulation of HIF1A, ADAM10 and sMICA, leading to decreased NKG2D in NK cells and tumour cells escape from immune surveillance and NK cell-mediated lysis. In the present study, in NK cells derived from high-HIF1A expression patients, the levels of internalization of MICA/B and NKG2D were obviously higher than those in low-HIF1A expression group; hypoxia dramatically upregulated the levels of sMICA culture supernatant of Panc-1 cells. Regarding the molecular mechanism, dysregulated circRNAs and miRNAs that might modulate HIF1A-mediated immune escape were selected and examined for detailed functions. The expression of circ_0000977 could be induced by hypoxia, and circ_0000977 knockdown enhanced the killing effect of NK cells on PC cells under hypoxia through HIF1A and ADAM10. HIF1 and ADAM10 were direct downstream targets of miR-153; circ_0000977 served as a sponge for miR-153 to counteract miR-153-mediated repression of HIF1 and ADAM10 mRNA through direct targeting in both 293T cells and Panc-1 cells. miR-153 inhibition exerted an opposing effect on HIF1A-mediated immune escape of PC cells to circ_0000977 knockdown; the effect of circ_0000977 knockdown were partially attenuated by miR-153 inhibition. In summary, circ_0000977/miR-153 axis modulates HIF1A-mediated immune escape of PC cells through miR-153 downstream targets HIF1A and ADAM10. We provided a novel mechanism of HIF1A-mediated immune escape of PC cells from the perspective of circRNAs-miRNA-mRNA axis. Abbreviations: Pancreatic cancer (PC); peripheral blood lymphocytes (PBLs); A Disintegrin and Metalloproteinase Domain 10 (ADAM10); MHC class I-related molecule A (MICA); soluble MICA (sMICA); membrane MICA (mMICA); Hypoxia-inducible factor 1-alpha (HI1FA); long non-coding RNAs (lncRNAs); non-coding RNAs (ncRNAs); natural killer (NK); Haematoxylin and eosin (H&E); Immunohistochemistry (IHC); natural killer group 2 member D (NKG2D).

The earliest Timematids in Burmese amber reveal diverse tarsal pads of stick insects in the mid-Cretaceous.

Many extant insects have developed pad structures, euplantulae or arolia on their tarsi to increase friction or enhance adhesion for better mobility. Many polyneopteran insects with euplantulae, for example, Grylloblattodea, Mantophasmatodea and Orthoptera, have been described from the Mesozoic. However, the origin and evolution of stick insects' euplantulae are poorly understood due to rare fossil records. Here, we report the earliest fossil records of Timematodea hitherto, Tumefactipes prolongates gen. et sp. nov. and Granosicorpes lirates gen. et sp. nov., based on three specimens from mid-Cretaceous Burmese amber. Specimens of Tumefactipes prolongates gen. et sp. nov. have extremely specialized and expanded euplantulae on their tarsomere II. These new findings are the first known and the earliest fossil records about euplantula structure within Phasmatodea, demonstrating the diversity of euplantulae in Polyneoptera during the Mesozoic. Such tarsal pads might have increased friction and helped these mid-Cretaceous stick insects to climb more firmly on various surfaces, such as broad leaves, wetted tree branches or ground. These specimens provide more morphological data for us to understand the relationships of Timematodea, Euphasmatodea, Orthoptera and Embioptera, suggesting that Timematodea might be monophyletic with Euphasmatodea rather than Embioptera and Phasmatodea should have a closer relationship with Orthoptera rather than Embioptera.

Cyclometalated Ir(iii) complexes [Ir(tpy)(bbibH2)Cl][PF6] and [Ir(tpy)(bmbib)Cl][PF6]: intramolecular ππ interactions leading to facile synthesis and enhanced luminescence.

Cyclometalated Ir(iii) complexes [Ir(tpy)(bbibH2)Cl][PF6] (1·PF6) and [Ir(tpy)(bmbib)Cl][PF6] (2·PF6), and the control complex [Ir(tpy)(mbib)Cl][PF6] (3·PF6) were synthesized at 135 °C for 10 hours for the former two complexes, while at 190 °C for 24 hours for the latter complex, in which the cyclometalated ligands bbibH2-, bmbib- and mbib- incorporate one or two N-methylbenzoimidazole/benzimidazole units in order to explore the influence of the molecular structures of these complexes on their synthesis conditions and luminescence behaviors. The 1H NMR and crystal structure measurements indicate that both 1·PF6 and 2·PF6 contain intramolecular ππ stacking interactions between the non-coordinated N-methylbenzoimidazole/benzimidazole unit and the tpy ligand, but there are no such ππ interactions in 3·PF6. At room temperature, these complexes in CH3CN reveal an emission with a combination of 3MLCT and 3LC characteristics, occurring at 534 nm with a quantum yield Φ = 39.5% and a lifetime τ = 2.39 µs for 1·PF6, 536 nm with Φ = 66.4% and τ = 2.94 µs for 2·PF6, and 558 nm with Φ = 27.0% and τ = 1.75 µs for 3·PF6. Moreover, both 1·PF6 and 2·PF6 exhibit a TFA-induced luminescence decrease. Based on the comparison among 1·PF6, 2·PF6 and 3·PF6, we discuss the influence of intramolecular ππ interactions and Nimidazole-H/Nimidazole-CH3 units in 1·PF6 and 2·PF6 on their syntheses and luminescence.

Aggregation-Induced Electrochemiluminescence from a Cyclometalated Iridium(III) Complex.

Aggregation-induced emission has been extensively found in organic compounds and metal complexes. In contrast, aggregation-induced electrochemiluminescence (AI-ECL) is rarely observed. Here, we employ two tridentate ligands [2,2':6',2″-terpyridine (tpy) and 1,3-bis(1 H-benzimidazol-2-yl)benzene (bbbiH3)] to construct a cyclometalated iridium(III) complex, [Ir(tpy)(bbbi)] (1), showing strong AI-ECL. Its crystal structure indicates that neighboring [Ir(tpy)(bbbi)] molecules are connected through both π-π-stacking interactions and hydrogen bonds. These supramolecular interactions can facilitate the self-assembly of complex 1 into nanoparticles in an aqueous solution. The efficient restriction of molecular vibration in these nanoparticles leads to strong AI-ECL emission of complex 1. In a dimethyl sulfoxide-water (H2O) mixture with a gradual increase in the H2O fraction from 20% to 98%, complex 1 showed a ∼39-fold increase in the electrochemiluminescence (ECL) intensity, which was ∼4.04 times as high as that of [Ru(bpy)3]2+ under the same experimental conditions. Moreover, the binding of bovine serum albumin to the nanoparticles of complex 1 can improve the ECL emission of this complex, facilitating the understanding of the mechanism of AI-ECL for future applications.

Coordination mode-induced isomeric cyclometalated [Ir(tpy)(nbi)Cl](PF6) complexes: distinct luminescence, self-assembly and cellular imaging behaviors.

Two isomeric Ir(iii) complexes Ir-O and Ir-R arising from the different coordination mode of a naphthalene-containing ligand, show distinct luminescence, self-assembly ability and cellular imaging behaviors.

Cyclometalated Ir(iii) complexes incorporating a photoactive anthracene-based ligand: syntheses, crystal structures and luminescence switching by light irradiation.

Two cyclometalated complexes [Ir(dfppy)2(aip)](PF6) (1) and [Ir(ppy)2(aip)](PF6) (2) have been synthesized based on a photoactive anthracene-based ligand aip and cyclometalating ligands dfppyH and ppyH [dfppyH = (2-(2,4-difluorophenyl)-pyridine), ppyH = 2-phenyl-pyridine]. Their crystal structures indicate that an aip ligand uses its phenanthroline moiety to chelate an {Ir(dfppy)2}+ unit in 1, while an {Ir(ppy)2}+ unit in 2. In CH2Cl2, the anthracene units in aip, 1 and 2 underwent photo-oxidation upon irradiation with 365 nm light, forming species aip-O, 1-O and 2-O, respectively. This photo-oxidation resulted in luminescence switching, from a luminescent state (emission at 493 nm) to a non-luminescent state for aip, while from a non-luminescent state to a luminescent state with an emission at 519 nm for 1 and 578 nm for 2. Additionally, the luminescence of aip, 1-O and 2-O in CH2Cl2 can be modulated by using TFA to protonate the imidazole units and/or non-coordinated phenanthroline moiety in these compounds. Upon adding TFA, aip showed luminescence quenching, while species 1-O and 2-O revealed both luminescence-intensity decrease and emission-wavelength increase (Δλ = 9 nm for 1-O, and Δλ = 4 nm for 2-O). In this paper, we discuss the luminescence switching/modulation of aip, 1 and 2 by light-irradiation-induced photo-oxidation of their anthracene units and by TFA treatment.

Cyclometalated Ir(iii) complexes based on 2-(2,4-difluorophenyl)-pyridine and 2,2'-(2-phenyl-1H-imidazole-4,5-diyl)dipyridine: acid/base-induced structural transformation and luminescence switching, and photocatalytic activity for hydrogen evolution.

Based on ligands dfppyH and pidpyH, cyclometalated Ir(iii) complexes [Ir(dfppy)2(pidpyH)](PF6) (1·PF6) and [Ir(dfppy)2(pidpy)] (2) have been synthesized. The crystal structures indicate that each {Ir(dfppy)2}+ unit is coordinated by a neutral ligand pidpyH in 1·PF6, while by a pidpy- anion in 2. The packing structure of 1·PF6 only exhibits electrostatic interactions and van der Waals interactions among [Ir(dfppy)2(pidpyH)]+ cations and PF6- ions. In contrast, the neighboring molecules in 2 are linked into a supramolecular chain structure through aromatic stacking interactions between two dfppy- ligands. In solution, 1·PF6 and 2 show acid/base-induced structural transformation due to the protonation/deprotonation of their pyridyl groups and/or imidazole units, which can be confirmed by their 1H NMR spectra. At room temperature, compounds 1·PF6, 2 and pidpyH in CH2Cl2 reveal TFA-induced luminescence switching behaviors, from a non-luminescence state to a luminescence state with an emission at 582 nm for both 1·PF6 and 2, and emission switching from 392 nm to 502 nm for pidpyH. These switching behaviors are associated with the protonation of pyridyl groups and/or imidazole units in 1·PF6, 2 and pidpyH. Moreover, compounds 1·PF6 and 2 were used as photosensitizers (PS) for reduction of water to hydrogen under the same experimental conditions. It was found that the amount of evolved hydrogen and the PS turnover number are 512 µmol and 102 for 1·PF6, and 131 µmol and 26 for 2, respectively. Thus, compound 1·PF6 has better photocatalytic activity than 2. In this paper, we discuss the modulation of luminescence and photocatalytic activities of 1·PF6 and 2 by varying the coordination mode and/or protonation extent of pidpyH/pidpy- ligands.

Cyclometalated Ir(iii) complexes containing quinoline-benzimidazole-based N

Cyclometalated Ir(iii) complexes [Ir(dfppy)2(qbiH)](PF6) (1), [Ir(dfppy)2(qbim)](PF6)·H2O (2), [Ir(dfppy)2(qbio)](PF6) (3) and [Ir(dfppy)2(qbi)] (4) have been designed and prepared, in which the N^N ligands qbiH, qbim and qbio incorporate different substituent groups R on their imidazole units (H atom, CH3 group and n-C8H17 group, respectively) in order to explore the influence of the substituent groups R and the protonation/deprotonation state of imidazole units in these Ir(iii) complexes on their structures and luminescence behaviors. Crystal structures indicate that an {Ir(dfppy)2}+ unit is coordinated by neutral ligands qbiH in 1, qbim in 2 and qbio in 3, while a qbi- anion in 4. These Ir(iii) complexes show clearly different molecular stacking modes. In compound 1, neighboring [Ir(dfppy)2(qbiH)]+ cations are linked into a supramolecular chain through ππ stacking interactions between adjacent dfppy-/qbiH ligands. In 2 and 4, two neighboring iridium complex units connect each other through ππ stacking interactions between dfppy- ligands in the former, while between qbi- ligands in the latter, forming supramolecular dimers. Compared to 1, 2 and 4, compound 3 only exhibits intermolecular van der Waals interactions. At room temperature, these Ir(iii) complexes in CH2Cl2 reveal phosphorescence with a mixing of 3MLCT and 3LC characters, emissions at 558 and 585 nm for 1, 572 (or 573) and 600 nm for 2 and 3, and 546 nm for 4. Compared to 1-3, compound 4 displays relatively weak luminescence intensity. Interestingly, upon addition of NEt3/TFA, both 1 and 4 in CH2Cl2 can switch their luminescence between strong emission at 558 nm and weak emission at 546 nm, due to their acid-/base-induced structural interconversion between the protonation state and the deprotonation state of the qbiH ligand. The emissions of 1-4 in the solid state reveal different degrees of the red shift compared to their corresponding emissions in CH2Cl2, the broad emission bands at 542, 572 and 611 nm for 1, 553, 581 and 612 nm for 2, 544, 578 and 630 nm for 3, and 595 and 633 nm for 4. Based on the crystal structures of 1-4, this work discusses the luminescence modulation of these Ir(iii) complexes by varying their substituent groups or the protonation/deprotonation state of the imidazole units.

EZH2 promotes metabolic reprogramming in glioblastomas through epigenetic repression of EAF2-HIF1α signaling.

Cancer cells prefer glycolysis for energy metabolism, even when there is sufficient oxygen to make it unnecessary. This is called the Warburg effect, and it promotes tumorigenesis and malignant progression. In this study, we demonstrated that EZH2, a multifaceted oncogenic protein involved in tumor proliferation, invasion and metastasis, promotes glioblastoma tumorigenesis and malignant progression through activation of the Warburg effect. We observed that HIF1α is a target of EZH2 whose activation is necessary for EZH2-mediated metabolic adaption, and that HIF1α is activated upon EZH2 overexpression. EZH2 suppressed expression of EAF2, which in turn upregulated HIF1α levels. We conclude from these results that EZH2 promotes tumorigenesis and malignant progression in part by activating glycolysis through an EAF2-HIF1α signaling axis.

[Characteristics of Microbial Nitrogen Degradation in Fluvo-aquic Soil of Hebei Plain].

Understanding the law of soil microbial degradation of nitrogen is of great practical significance for the remediation of soil nitrogen pollution. From fluvo-aquic soil of Hebei plain, 8 kinds of bacteria,including nitrification bacteria, ammonification bacteria, heterotrophic nitrification to aerobic denitrification bacteria were isolated and analyzed by 16S rDNA identification, and the most suitable strains were selected to prepare bacterial agents with optimized carrier materials. The effects of the screened strains of bacteria or antagonistic fungus to Chinese cabbage in the process of drip irrigation on nitrogen and PLFA (Phospholipid Fatty Acids) values in the soils were discussed. The results showed that by using diatomite as a carrier, the ammonia nitrogen degradation rate was 38% and the synthetic rate of nitrate was 205% with ammonibacteria, the synthetic rate of ammonia nitrogen was 1711% with ammonibacteria, the degradation rate of nitrate nitrogen was 367% with heterotrophic nitrification to aerobic denitrification bacteria. In drip irrigation experiment, total nitrogen and ammonia nitrogen in soil were better degraded and nitrification was stronger in the soil, meanwhile, PLFA in the soil increased and content of microbes reached the peak in shorter time, the soil biological environment was better after irrigation with screened bacteria.

[The Application of the L-Curve Method in the Retrieval of Temperature Profiles Using Ground-Based Hyper-Spectral Infrared Radiance].

The thermodynamic profiles of Planetary Boundary Layer could be retrieved by using ground-based hyper-spectral infrared radiance. The AERIoe algorithm has a better performance at the dependency of initial profiles than the "onion peeling" method which was originally applied in the Atmospheric Emitted Radiance Interferometer. The regularization parameter is the key to the AERIoe algorithm, and the strategy for choosing the regularization parameter in the retrieval algorithm is based on the empirical method, which requires too much time for computation while the empirical method needs many iteration steps. A L-curve criterion is proposed to calculate the regularization parameter in AERIoe algorithm. The L-curve criterion is based on a log-log plot of corresponding values of the residual and solution norms, and the optimal regularization parameter corresponds to a point on the curve near the "corner" of the L-shaped region. Therefore, the L-curve criterion has better theoretical basis than the traditional empirical method. The result of retrieval experiment using the observed data collected at the SGP site of the year 2011 shows that, the L-curve method has a good performance in terms of stability, convergence and accuracy of the retrieval. Compared with empirical method, L-curve algorithm converges more quickly which saves much computation time when retrieving the temperature profiles. When considering the retrieval accuracy, the L-curve method has a better behavior at the middle and top of the boundary layer, with an improvement of 0.2 K of RMSE at the altitude of 1～3 km than the empirical method. Therefore, the L-curve algorithm has a better performance compared with the empirical method when choosing the regularization parameter in the retrieval of temperature profiles using the ground-based hyper-spectral infrared radiance.

[Research on the Noise Reduction with Hyper-Resolution Infrared Spectrum Based on Improved PCV Method].

The noise reduction with observed high resolution infrared radiance is crucial to improve the accuracy and stability of the retrieval of thermodynamic profiles. When applying the principal component analysis noise filter algorithm to the observed radiance, the optimal number k of principal components that used in the algorithm was mostly calculated with the statistical and empirical method. The percent cumulative variance method is one of the statistical methods that have been commonly used to calculate k, however, the threshold of the percent cumulative variance was determined subjectively and arbitrarily, which limits the application of this method. While the empirical method need the real-time Noise-Equivalent Spectral Radiance (NESR) to normalize non uniform noise in the observed data, but the real-time NESR needs the raw data of complex spectrum which is not easy to obtain in most cases. Aiming at the solving the problems above, a PCA noise filter based on the Improved PCV algorithm is proposed, of which the threshold is determined by iteratively calculating the difference between the simulated and reconstructed spectrum using different principal components, whereby k is determined such that the PCV is larger than the threshold. The new method solves the problem of arbitrary of the determination of k, and at the same time it doesn't need the real-time NESR to normalize the observed radiance. First, the impact of normalization on the noise reduction is analyzed using physical retrieval of temperature profiles; the result shows that the impact is very small, which less than the impact of calculation error of k is caused by normalization on the retrieval of temperature profiles. Then, the noise reduction of the representative radiance data which covers four quarters of 2011 shows that, the RMSE of the retrieved temperature profile using the Improved PCV method is improved by 0.1 K compared to the factor indicator function method when the real-time NESR is not available, and it is almost the same with the latter when the normalization is done. Under the condition that the NESR is not available, the method proposed in this article could objectively and reasonably reduce the noise level of the ground-based high resolution infrared radiance.