Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 114
Filter
1.
J Oral Pathol Med ; 53(9): 567-576, 2024 Oct.
Article in English | MEDLINE | ID: mdl-39160673

ABSTRACT

OBJECTIVE: Tumor hypoxia is associated with a poorer prognosis in cancer patients and can diminish the efficacy of radiation therapy (RT). This study investigates the potential of metformin to enhance radiosensitivity in hypoxic cancer cells. METHODS: Preliminary experiments were conducted to validate the impact of hypoxia on radiation response. Reactive oxygen species (ROS) levels, cell migration, and cell death were assessed in hypoxic, radiated cells treated with metformin. Proteomic and ontological analyses were employed to identify molecular targets associated with the radiosensitizing effect of metformin. Proteomic and ontological findings were validated through patient samples and in vitro studies. RESULTS: Metformin amplified cell death, induced DNA fragmentation, decreased cell migration, and elevated ROS levels in hypoxic, radiated cells. Proteomic analyses revealed that GAPDH and TAGLN2 were identified as pivotal targets linked to the radiosensitizing effect of metformin. Oral cancer patients exhibited elevated levels of TAGLN2 and reduced levels of GAPDH. Metformin downregulated TAGLN2 and upregulated GAPDH in hypoxic, radiated cells. Additionally, metformin reduced levels of mutated p53. CONCLUSIONS: This study suggests that metformin can enhance radiosensitivity in hypoxic cells, operating through modulation of GAPDH and TAGLN2. Furthermore, metformin effectively reduces mutated p53 levels in radiated cells under hypoxic conditions.


Subject(s)
Carcinoma, Squamous Cell , Metformin , Mouth Neoplasms , Radiation-Sensitizing Agents , Humans , Metformin/pharmacology , Metformin/therapeutic use , Mouth Neoplasms/radiotherapy , Radiation-Sensitizing Agents/pharmacology , Cell Line, Tumor , Cell Movement/drug effects , Radiation Tolerance/drug effects , Reactive Oxygen Species/metabolism , Proteomics , Glyceraldehyde-3-Phosphate Dehydrogenases , Glyceraldehyde-3-Phosphate Dehydrogenase (Phosphorylating) , Cell Hypoxia/drug effects , Tumor Hypoxia/drug effects
2.
J Cosmet Dermatol ; 2024 Aug 04.
Article in English | MEDLINE | ID: mdl-39099032

ABSTRACT

OBJECTIVE: The current study aims to investigate the safety and efficacy of using calcium hydroxyapatite (CaHA) versus CaHA associated with hyaluronic acid (HA) for forehead volume replacement and contour restoration without forehead irregularities. METHODS: This interventional study involved 132 participants in a two-arm, parallel, double-blind trial for forehead treatment using the supraperiosteal technique. Group A received CaHA, and Group B received a combination of CaHA and HA as filler materials. Follow-up assessments occurred at 30 and 180 days, incorporating the 5-point Global Aesthetic Improvement Scale (GAIS) and photographic analysis for forehead volume replacement, contour restoration, and without forehead irregularities. Safety assessments included monitoring adverse events, particularly nodules. RESULTS: The study included all 132 enrolled patients who completed the trial. Applying CaHA in combination with HA resulted in a statistically significant improvement in both GAIS scale scores and the reduction of forehead irregularities. The total incidence of nodules was 3.7%. Group A had four times more occurrences of nodules than Group B. Furthermore, Group B exhibited lower rates of forehead irregularities following the treatment compared to Group A. CONCLUSION: The supraperiosteal application of CaHA and HA for forehead treatment demonstrates superior efficacy in addressing signs of aging compared to the isolated use of CaHA.

3.
J Nutr Biochem ; 134: 109721, 2024 Aug 10.
Article in English | MEDLINE | ID: mdl-39128608

ABSTRACT

Malnutrition is a complicated illness that affects people worldwide and is linked to higher death rates, a heightened vulnerability to infections, and delayed cognitive development. Experimental models have been constructed to comprehend the mechanisms associated with hunger. In this regard, the current study used two different types of food aiming to validate a murine model of malnutrition based on dietary restriction. The study was conducted with fifty-six Swiss male mice (eight-week-old) divided into eight groups (n=7 each) and fed the following experimental diets (10 weeks): Standard Diet (ST) ad libitum; ST 20% dietary restriction; ST 40% dietary restriction; ST 60% dietary restriction; AIN93-M diet ad libitum; AIN93-M 20% dietary restriction; AIN93-M 40% dietary restriction; AIN93-M 60% dietary restriction. Body, biochemical, and histological parameters were measured, and the restriction effects on genes related to oxidative stress (GPX1 and GPX4) in epididymal adipose tissue were evaluated. The results obtained showed that 20%, 40%, and 60% of dietary restrictions were able to reduce body weight when compared to controls, highlighting the accentuated weight loss in animals with 60% restrictions, especially those fed with AIN-93 M, which showed physical changes such as whitish skin and dull coat, voracious eating, and hunched posture. The present animal model also showed biochemical changes with hypoalbuminemia, as well as histological epididymal adipose tissue modulation. The presence of increased oxidative stress was observed when evaluating the GPX4 gene. Given the results, 60% food restriction using the AIN93-M diet was the best protocol for inducing malnutrition.

4.
Food Res Int ; 189: 114570, 2024 Aug.
Article in English | MEDLINE | ID: mdl-38876598

ABSTRACT

Edible insects are recognized as promising food sources due to their nutritional composition. Some species, such as Gryllus assimilis, contain proteins, lipids, and carbohydrates of high biological value, which regulate several metabolic functions, including the Renin-Angiotensin System (RAS). In this context, the present study aimed to assess the effects of dietary supplementation with whole Gryllus assimilis powder on the metabolism of malnourished mice. Thirty-two male Swiss mice were used and divided into four treatment groups. The groups were identified as (AIN93-M); AIN93-M + Gryllus assimilis diet (AIN93-M + GA); AIN93-M + Renutrition diet (AIN93-M + REN) and AIN93-M + Renutrition diet + Gryllus assimilis (AIN93-M + REN + GA). The results showed that whole Gryllus assimilis powder inclusion promotes recovery from protein-energy malnutrition, reduces adiposity, and improves glucose tolerance and insulin sensitivity. It also reduces total cholesterol, triglycerides, VLDL, and adipocyte area. We also observed a significant increase in the expression of RAS-related genes, such as ACE2 and MasR, followed by a reduction in Angiotensinogen and ACE. The main findings of the present study suggest the use of black cricket as a viable strategy for the prevention and treatment of protein-energy malnutrition, as well as the reduction of adiposity, and improvement of lipid and glycemic parameters, with antihypertensive potential.


Subject(s)
Adipose Tissue , Dietary Supplements , Gryllidae , Protein-Energy Malnutrition , Renin-Angiotensin System , Animals , Renin-Angiotensin System/drug effects , Male , Mice , Protein-Energy Malnutrition/metabolism , Protein-Energy Malnutrition/diet therapy , Adipose Tissue/metabolism , Adiposity , Insulin Resistance
5.
Gene ; 926: 148606, 2024 Oct 30.
Article in English | MEDLINE | ID: mdl-38788813

ABSTRACT

Obesity and overweight are multifactorial diseases affecting more than one-third of the world's population. Physical inactivity contributes to a positive energy balance and the onset of obesity. Exercise combined with a balanced diet is an effective non-pharmacological strategy to improve obesity-related disorders. Gallic acid (GA), is a natural endogenous polyphenol found in a variety of fruits, vegetables, and wines, with beneficial effects on energetic homeostasis. The present study aims to investigate the effects of exercise training on obese mice supplemented with GA. Animal experimentation was performed with male Swiss mice divided into five groups: ST (standard control), HFD (obese control), HFD + GA (GA supplement), HFD + Trained (training), and HFD + GA + Trained (GA and training). The groups are treated for eight weeks with 200 mg/kg/body weight of the feed compound and, if applicable, physical training. The main findings of the present study show that GA supplementation improves liver fat, body weight, adiposity, and plasma insulin levels. In addition, animals treated with the GA and a physical training program demonstrate reduced levels of anxiety. Gene expression analyses show that Sesn2 is activated via PGC-1α independent of the GATOR2 protein, which is activated by GA in the context of physical activity. These data are corroborated by molecular docking analysis, demonstrating the interaction of GA with GATOR2. The present study contributes to understanding the metabolic effects of GA and physical training and demonstrates a new hepatic mechanism of action via Sestrin 2 and PGC-1α.


Subject(s)
Gallic Acid , Liver , Mice, Obese , Obesity , Peroxisome Proliferator-Activated Receptor Gamma Coactivator 1-alpha , Physical Conditioning, Animal , Animals , Mice , Gallic Acid/pharmacology , Male , Liver/metabolism , Liver/drug effects , Obesity/metabolism , Obesity/genetics , Obesity/drug therapy , Peroxisome Proliferator-Activated Receptor Gamma Coactivator 1-alpha/metabolism , Peroxisome Proliferator-Activated Receptor Gamma Coactivator 1-alpha/genetics , Anxiety/drug therapy , Nuclear Proteins/metabolism , Nuclear Proteins/genetics , Diet, High-Fat/adverse effects , Gene Expression Regulation/drug effects , Sestrins
6.
Support Care Cancer ; 32(1): 82, 2024 Jan 04.
Article in English | MEDLINE | ID: mdl-38175289

ABSTRACT

OBJECTIVE: To identify predictors of sarcopenia (demographical, anthropometric measurements, tumor-related clinical characteristics, performance status, and serum C-reactive protein (CRP) and albumin levels in individuals with head and neck squamous cell carcinoma (HNSCC). MATERIAL AND METHODS: This cross-sectional study selected diagnosed with HNSCC (n = 125). Sarcopenia was defined as low muscle strength and low physical performance. Association between sarcopenia and anthropometric assessments (weight, height, body mass index, triceps skinfold, mid-upper arm circumference [MUAC], mid-upper arm muscle circumference, mid-upper arm fat area [UFA], mid-upper arm bone free muscle area, calf circumference, and appendicular skeletal muscle mass and index), tumor clinical characteristics (anatomical site, tumor size, and cervical metastasis), performance status scale (Eastern Cooperative Oncology Group Performance Status [ECOG-PS]), and CRP and albumin levels was analyzed using binary logistic regression models. RESULTS: The diagnosis of sarcopenia was identified in 28 (22.4%) individuals with HNSCC. Being an older adult increases the odds of association with sarcopenia in individuals with HNSCC (odds ratio [OR] = 1.05). Increments in MUAC measurement reduce the odds of association with sarcopenia (OR = 0.69), while the increase in the UFA measurement increases the odds of association with sarcopenia (OR = 1.33). Poor ECOG-PS scores increase the odds of association with sarcopenia in individuals with HNSCC (OR = 5.54). CONCLUSION: Early identification of easy-to-perform, cost-effective predictors of sarcopenia tends to favor the implementation of personalized therapeutic and supportive interventions in individuals with HNSCC.


Subject(s)
Head and Neck Neoplasms , Sarcopenia , Humans , Aged , Sarcopenia/epidemiology , Sarcopenia/etiology , Squamous Cell Carcinoma of Head and Neck , Cross-Sectional Studies , C-Reactive Protein , Head and Neck Neoplasms/complications
7.
Gene ; 883: 147683, 2023 Oct 20.
Article in English | MEDLINE | ID: mdl-37536400

ABSTRACT

Sestrins (SESNs) are a family of evolutionarily conserved proteins among mammals. They have several body homeostatic functions such as antioxidant, metabolic, and anti-aging, and are required to regenerate hyperoxidized forms of peroxiredoxins and reactive oxygen species. Sestrin 2 has been studied as a therapeutic agent in obesity treatment. Gallic acid (GA) is a triphenolic compound with beneficial biological activities including anti-inflammatory, antidiabetic, antihypertensive, and antioxidant effects. Recent studies demonstrated the GA's ability to reduce body weight gain and improve glycemic parameters. In this sense, the present study aims to investigate the GA activating potential of Sestrin using the molecular docking method. The 3D structure of gallic acid was retrieved from the NCBI PubChem database and the chemical structure of the Sestrin2 protein from the RCSB Protein Data Bank (5DJ4). The docking calculus was performed via UCSF Chimera and AutoDock Vinaprograms. The results showed that amino acids Arg390, Glu451, Trp444, Thr386, Arg448, Thr374, Tyr375, Asn376, Thr377, Leu389, His454, Ser450, His86, and Val455 are very important for GA stabilization, resembling the interactions that permit Leucine to activate SESN2. In this context, the obesity therapeutic property of GA can be understood from a Sestrin activating process through amino acid metabolism.


Subject(s)
Gallic Acid , Sestrins , Animals , Molecular Docking Simulation , Gallic Acid/pharmacology , Gallic Acid/therapeutic use , Obesity/drug therapy , Antioxidants , Mammals
8.
Phytomedicine ; 119: 155000, 2023 Oct.
Article in English | MEDLINE | ID: mdl-37541071

ABSTRACT

BACKGROUND: Lychnophora ericoides Mart, also known as the Brazilian arnica or fake arnica, belongs to the Asteraceae family. Leaves and roots are used in alcoholic and hydroalcoholic preparations for the treatment of wounds, inflammation, and pain. PURPOSE: The present study aimed to investigate the effects of L. ericoides ethanolic extract (EELE) on cutaneous wound healing and the mechanisms of action involved. METHODS: A total of 72 C57BL/6 mice were randomly divided into four groups of six animals each. An excisional wound was made in the dorsal region of each mouse. The test groups were topically treated with the vehicle, a positive control commercial reference drug, EELE ointment (5%), and EELE ointment (10%). The treatments were applied over 14 days. The wound area was measured every two days to verify the wound closure kinetics. On days 3, 7, and 14 the wound tissue samples were processed for Hematoxylin and Eosin, Masson-Trichrome, and Toluidine blue staining. The expression of renin-angiotensin system (RAS) components, the vascular growth factor-A (VEGF-A), the basic fibroblast growth factor (FGF-2), and type I collagen genes were evaluated. Phytochemical analyses were performed using HPLC-DAD and HPLC-MS/MS. RESULTS: The EELE (10%) significantly reduced the wound area compared to the treatments used for the other groups. Histological analysis demonstrated that wounds treated with L. ericoides for 14 days developed improved anatomical skin features, healed with hair follicles and sebaceous glands, increased collagen production and angiogenesis, and decreased the number of mast cells at the injury site. Real-time PCR data demonstrated that groups treated with EELE (10%) showed increased Type I collagen, VEGF-A, FGF-2, and AT1R and decreased ACE II and receptor MAS. The healing action of L. ericoides may be related to the presence of phenolic compounds, such as phenolic acids, chlorogenic acid derivatives, and C-glycoside flavonoids. CONCLUSION: Topical treatment with EELE increases important factors for wound healing: FGF, VEGF, collagen formation, and the expression of the proliferative axis of the renin-angiotensin system. For the first time, the present study shows the healing action of L. ericoides at the molecular level in an animal model. This process can be used as an alternative therapy for wound healing and the development of herbal therapy.


Subject(s)
Arnica , Asteraceae , Mice , Animals , Arnica/metabolism , Ethanol/chemistry , Collagen Type I/metabolism , Brazil , Tandem Mass Spectrometry , Ointments/metabolism , Ointments/pharmacology , Vascular Endothelial Growth Factor A/metabolism , Fibroblast Growth Factor 2/metabolism , Fibroblast Growth Factor 2/pharmacology , Mice, Inbred C57BL , Plant Extracts/chemistry , Asteraceae/chemistry , Wound Healing , Skin , Collagen/metabolism
9.
Lasers Med Sci ; 38(1): 85, 2023 Mar 15.
Article in English | MEDLINE | ID: mdl-36920639

ABSTRACT

To evaluate the effects of Light-Emitting Diode (LED) irradiation on the expression of thermogenesis and lipogenesis-associated markers in adipose tissue and metabolic parameters of obese mice. Twenty-four male mice were divided into four groups: i) ST fed standard diet; ii) HCD fed hyperglycemic diet; iii) LED + I fed hyperglycemic diet and irradiated with LED in the interscapular region; iv) LED + A fed hyperglycemic diet and irradiated with LED in the abdominal region. The first phase of the study comprehended the induction of obesity for 12 weeks. Next, the animals were submitted to six irradiation sessions (days 1, 3, 7, 10, 14, and 21) using a 660-nm LED (5.77 J/cm2 at 48,1 mW/cm2). Anthropometric, biochemical, and histological parameters and the expression of thermogenesis and lipogenesis-associated markers were assessed in adipose tissue. There was diminished weight gain between the HCD and LED + A groups (ST: 0.37 ± 0.65; HCD: 3.10 ± 0.89; LED + I: -1.26 ± 0.83; LED + A: -2.07 ± 1.27 g; p < 0.018). There was a 33.3% and 23.8% reduction in epidydimal adipose tissue weight and a 25% and 10.7% in the visceral adiposity for the LED + I and LED + A groups, respectively, when compared with HCD. There was a decreased accumulation of fat droplets in adipose tissue in LED + A and LED + I groups. Additionally, LED irradiation was associated with increased mRNA expression of uncoupling protein 1 (UCP1) in the brown adipose tissue (ST: 2.27 ± 0.19; HCD: 1.54 ± 0.12; LED + I: 2.44 ± 0.22; p = 0.014) and decreased fatty acid synthetase (FAS) expression in epidydimal adipose tissue (ST: 0.79 ± 0.13; HCD: 1.59 ± 0.13; LED + A: 0.85 ± 0.04; p = 0.0008). LED treatment improved anthropometric parameters, possibly associated with the histological alterations, thermogenesis and lipogenesis markers in white adipose tissue, and expression modulation in brown adipose tissue.


Subject(s)
Diet, High-Fat , Lipogenesis , Male , Animals , Mice , Lipogenesis/genetics , Mice, Obese , Adipose Tissue/metabolism , Adipose Tissue, Brown/metabolism , Adipose Tissue, Brown/pathology , Thermogenesis , Mice, Inbred C57BL
10.
Mol Cell Endocrinol ; 563: 111840, 2023 03 01.
Article in English | MEDLINE | ID: mdl-36592923

ABSTRACT

Maternal obesity and dietary style in the pregnancy-lactation period may result in long-term effects on the metabolic health of the offspring, thus increasing the risk of diseases, such as obesity, diabetes, and cardiovascular diseases. Curcumin is a natural polyphenolic compound that has beneficial properties on metabolism. Accordingly, this study is intended to evaluate the effects of curcumin supplementation in pregnant and lactating female mice on the anthropometric, metabolic and molecular parameters of the offspring fed a hyperglycemic diet. The study was conducted with 24 male mice randomized into three groups: i) control group (SD) originating from dams fed a standard diet; ii) hyperglycemic group (HGD) originating from dams fed a hyperglycemic diet; iii) curcumin group (CUR) originating from dams fed a hyperglycemic diet and supplemented with curcumin in the pregnancy-lactation period. All offspring groups were fed a hyperglycemic diet for 12 weeks. Anthropometricand biochemical parameters were measured, as well as the expression of thermogenesis-associated markers in the interscapular brown and inguinal white adipose tissues. The results showed less weight gain in the CUR group, with a concomitant reduction in food consumption compared to the HGD group. Biochemical parameters indicated lower levels of total cholesterol, glucose, and insulin for the CUR group, in addition to improved glucose tolerance and insulin sensitivity. The molecular evaluation indicated increased mRNA expression levels of UCP1 and PRDM16 in the brown and white adipose tissues. It is concluded that curcumin supplementation in the pregnancy-lactation period in dams with diet-induced obesity may lead to improvements in the offspring's metabolic phenotype, even if they are submitted to an obesogenic environment, possibly via thermogenesis activation.


Subject(s)
Curcumin , Animals , Female , Humans , Male , Mice , Pregnancy , Adipose Tissue/metabolism , Curcumin/pharmacology , Diet, High-Fat , Glucose/metabolism , Lactation , Obesity/metabolism , Thermogenesis
11.
Arch Physiol Biochem ; 129(2): 449-459, 2023 Apr.
Article in English | MEDLINE | ID: mdl-33176505

ABSTRACT

BACKGROUND: Diet macronutrient heterogeneity hinders animal studies' data extrapolation from metabolic disorders to human diseases. OBJECTIVE: The present study aimed to evaluate different fat-diet compositions' effect on inducing lipid/glucose metabolism alterations in mice. METHODS: Swiss male mice were fed for 12 weeks with five different diets: Standard Diet (ST), American Institute of Nutrition 93 for growth (AIN93G) high-butter/high-sugar (HBHS), high-lard/high-sugar (HLHS), and high-oil/high-sugar diet (soybean oil) (HOHS). Several parameters, such as serum biochemistry, histology, and liver mRNA expression, were accessed. RESULTS: The main findings revealed that the HLHS diet dramatically altered liver metabolism inducing hepatic steatosis and increased total cholesterol, triglycerides, VLDL, increasing liver CCAAT/enhancer binding protein (CEBP-α), Acetyl-CoA carboxylase (ACC) and Catalase (CAT) mRNA expression. Moreover, the HLHS diet increased glucose intolerance and reduced insulin sensitivity. CONCLUSIONS: High-fat/high-sugar diets are efficient to induce obesity and metabolic syndrome-associated alterations, and diets enriched with lard and sugar showed more effective results.


Subject(s)
Metabolic Syndrome , Animals , Humans , Male , Mice , Diet, High-Fat , Dietary Fats/metabolism , Liver/metabolism , Metabolic Syndrome/etiology , Metabolic Syndrome/metabolism , Obesity/etiology , Obesity/metabolism , RNA, Messenger/genetics , RNA, Messenger/metabolism , Sugars/metabolism
12.
Toxicon ; 221: 106965, 2023 Jan 01.
Article in English | MEDLINE | ID: mdl-36370827

ABSTRACT

This study investigated the antineoplastic effects of crotoxin isolated from snake venom of the South American Crotalus durissus terrificus in oral cancer cell lines and in an animal model of chemically induced oral cancer. We analyzed cell viability and death, clonogenic formation, DNA fragmentation, migration assay, and gene expression of MMP2, MMP9, COL1A1, and CASP3. In the animal model, after induction of oral cancer by 4-nitroquinoline-1-oxide carcinogen, mice were treated with crotoxin to investigate its effects on tumor development in tongue and oral mucosa. Crotoxin inhibited cell proliferation, viability, colony formation, and migration, favoring cell death. Furthermore, crotoxin increased caspase-3 expression, decreased Ki-67 protein and mRNA expression of MMP2, MMP9, and COL1A1. Mice treated with crotoxin at 10 µg/kg did not alter biochemical parameters total cholesterol, very-low-density lipoprotein, high-density lipoprotein, liver transaminases, glycemia, creatinine, and urea. Crotoxin treatment significantly reduced the frequency of oral squamous cell carcinoma lesions by 50%. Thus, this study highlights crotoxin as a promising chemotherapeutic substance, considering its effects on controlling the neoplastic cell population, reducing cell migration, and inhibiting tumor development. Clinical studies are necessary to understand better the impact of crotoxin as a potential adjuvant therapeutic agent for oral cancer patients.


Subject(s)
Antineoplastic Agents , Crotalid Venoms , Crotoxin , Mouth Neoplasms , Squamous Cell Carcinoma of Head and Neck , Animals , Mice , Antineoplastic Agents/pharmacology , Crotalid Venoms/chemistry , Crotalus , Crotoxin/pharmacology , Matrix Metalloproteinase 2 , Matrix Metalloproteinase 9 , Mouth Neoplasms/chemically induced , Mouth Neoplasms/drug therapy , Squamous Cell Carcinoma of Head and Neck/chemically induced , Squamous Cell Carcinoma of Head and Neck/drug therapy
13.
Gene ; 851: 147041, 2023 Jan 30.
Article in English | MEDLINE | ID: mdl-36375658

ABSTRACT

Differences in the features of aggressiveness of non-melanoma skin cancer (NMSC) subtypes, between basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) are relevant characteristics. Comparing the characteristics between NMSC subtypes might help identify molecules associated with cancer metastasis and invasion. Considering these facts, the current study aimed to identify a molecular target for inhibiting skin cancer metastasis and invasion. Proteomic analysis suggested that heat shock protein 90 kDa, alpha, class B member 1 (HSP90AB1), pentaxin (PTX3), caspase-14 (CASP14), S100, actin-1, and profilin were the primary targets related to metastasis and invasion. However, after a differential expression comparison between BCC and SCC, HSP90AB1 was identified as the best target to repress metastasis and invasion. Based on molecular docking results, gallic acid (GA) was selected to inhibit HSP90AB1. A specific Hsp90ab1 siRNA targeting was designed and compared to GA. Interestingly, GA was more efficient in silencing HSP90AB1 than siRNAhsp90ab1. Hence, our data suggest that HSP90AB1 is a crucial biomarker for identifying invasion and metastasis and that its inhibition may be a viable strategy for treating skin cancer.


Subject(s)
Carcinoma, Basal Cell , Carcinoma, Squamous Cell , Skin Neoplasms , Humans , Heat-Shock Proteins , Gallic Acid/pharmacology , Proteomics , Molecular Docking Simulation , Carcinoma, Basal Cell/metabolism , Carcinoma, Squamous Cell/pathology , Skin Neoplasms/drug therapy , Skin Neoplasms/genetics , Skin Neoplasms/metabolism , HSP90 Heat-Shock Proteins/genetics
14.
Oral Dis ; 29(7): 2658-2666, 2023 Oct.
Article in English | MEDLINE | ID: mdl-35796645

ABSTRACT

OBJECTIVE: Oral squamous cell carcinoma (OSCC) is one of the most common neoplasms worldwide. The current study aimed to identify potential biomarkers associated with OSCC survival. MATERIALS AND METHODS: Differentially expressed genes (DEGs) in atypical OSCC cases were identified using two public datasets: The Cancer Genome Atlas and the Gene Expression Omnibus database. Receiver operating characteristic (ROC) analysis was performed to identify the cutoff, and the candidate DEGs related to survival. Kaplan-Meier and Cox regression analysis using the categorized genes were employed to identify genes that impact the overall survival in OSCC. RESULTS: A total of 263 OSCC samples and 105 healthy tissues were used to identify 295 upregulated and 131 downregulated genes expressed only in non-smokers. ROC analyses identified 25 candidate genes associated with death. Survival analyses demonstrated that the following DEGs, namely CSTA, FGFR2, MMP19, OLR1, PCSK1, RAMP2, and CGB5, are potential OSCC prognostic factors. CONCLUSION: We found that CSTA, FGFR2, MMP19, OLR1, PCSK1, RAMP2, and CGB5 are associated with a low survival rate in OSCC. However, further studies are needed to validate our findings and facilitate the development of these factors as potential biomarkers for OSCC survival.


Subject(s)
Carcinoma, Squamous Cell , Head and Neck Neoplasms , Mouth Neoplasms , Humans , Squamous Cell Carcinoma of Head and Neck/genetics , Carcinoma, Squamous Cell/pathology , Transcriptome , Mouth Neoplasms/metabolism , Gene Expression Regulation, Neoplastic , Survival Analysis , Biomarkers, Tumor/genetics , Head and Neck Neoplasms/genetics , Prognosis
15.
Lasers Med Sci ; 37(9): 3527-3536, 2022 Dec.
Article in English | MEDLINE | ID: mdl-36001245

ABSTRACT

Radiation therapy for head and neck squamous cell carcinoma (HNSCC) is associated with several complications. Although photobiomodulation (PBM) has radioprotective effects in normal tissue, it could also enhance the growth of neoplastic cells. Thus, the present study aimed to investigate the cellular response of oral squamous cell carcinoma with pre-exposure to low-level phototherapy before radiotherapy. SCC9, Cal-27, A431, and HaCaT cell lines were subjected to low-level light therapy and radiotherapy. The cells were treated with a single energy density (300 J/cm2) of a light-emitting diode (660 nm) prior to ionizing radiation at different doses (0, 2, 4, and 6 Gy). After 24 h, wound scratch, proliferation, clonogenic cell survival, cell death, and reactive oxygen species (ROS) analyses were performed to evaluate cell response. The cell lines pre-exposed to PBM at the analyzed dosage were radiosensitive. The treatment significantly reduced cell proliferation and clonogenic cell survival. Migration and cell death assays also revealed positive results, with the treatment group showing lower rate of migration and higher cell death than did the control group. Moreover, PBM effectively increased the intracellular levels of ROS. PBM at 300 J/cm2 is a promising radiosensitizing modality to reduce the radiation dose and avoid the intolerable side effects of radiotherapy for HNSCC, thus increasing the probability of successful treatment. However, further studies are needed to support and confirm the results.


Subject(s)
Carcinoma, Squamous Cell , Head and Neck Neoplasms , Low-Level Light Therapy , Mouth Neoplasms , Humans , Squamous Cell Carcinoma of Head and Neck/radiotherapy , Squamous Cell Carcinoma of Head and Neck/etiology , Mouth Neoplasms/radiotherapy , Mouth Neoplasms/pathology , Carcinoma, Squamous Cell/radiotherapy , Carcinoma, Squamous Cell/pathology , Low-Level Light Therapy/methods , Reactive Oxygen Species , Head and Neck Neoplasms/radiotherapy
16.
Photodiagnosis Photodyn Ther ; 39: 102983, 2022 Sep.
Article in English | MEDLINE | ID: mdl-35772622

ABSTRACT

Purpose This study aimed to compare the efficacy of Antimicrobial Photodynamic Therapy (aPDT) with 300 µmol/L of methylene blue and 8 µmol/L of curcumin on oral candidiasis patients with HNSCC undergoing treatment. Methods A two-arm, single-blind clinical trial was performed. Following verification for eligibility (n = 447), 108 patients were included in the study. The study consisted of a group that received aPDT with methylene blue (n = 57) and another that received aPDT with curcumin (n = 51). The patients rinsed their mouths with an aqueous solution of 300 µmol/L of methylene blue and 8 µmol/L of curcumin in four sessions, and then the lesion was scraped for the subsequent RT-qPCR. The primary outcome was that no cure was presented for oral candidiasis after treatment. The secondary result was reducing the number of sites affected by oral candidiasis. Results There was no difference in treatment failure evaluated by the necessity of drug prescription or Candida sp DNA quantification. However, clinically the methylene blue protocol reduced the number of infected anatomical sites compared to the curcumin protocol. Conclusion Methylene blue aPDT reduced the number of infected anatomical sites compared to curcumin.


Subject(s)
Anti-Infective Agents , Candidiasis, Oral , Curcumin , Head and Neck Neoplasms , Photochemotherapy , Anti-Bacterial Agents/therapeutic use , Anti-Infective Agents/therapeutic use , Candidiasis, Oral/drug therapy , Curcumin/therapeutic use , Head and Neck Neoplasms/drug therapy , Humans , Methylene Blue/therapeutic use , Photochemotherapy/methods , Photosensitizing Agents/therapeutic use , Single-Blind Method
17.
Lasers Med Sci ; 37(5): 2509-2516, 2022 Jul.
Article in English | MEDLINE | ID: mdl-35119554

ABSTRACT

The aim of this study is to investigate the antineoplastic potential of photodynamic therapy (PDT) mediated by an aluminum-phthalocyanine chloride nanoemulsion (AlPc-NE), against an oral squamous cell carcinoma (OSCC) cell line in vitro. Both OSCC (SCC9) and A431 cell lines were studied in vitro. Four study groups were used: Group 1 (phosphate-buffered saline [PBS]), Group 2 (PBS + 28.3 J/cm2 irradiation), Group 3 (AlPc-NE alone), and Group 4 (AlPc-NE + 28.3 J/cm2 irradiation). To test the effect of PDT with AlPc-NE, cell viability, migration, and cell death assays were performed. Moreover, the expressions of Ki-67 and TP53 were evaluated using immunoassays. The results showed that PDT mediated by all AlPc-NE concentrations evaluated (i.e., 0.7, 0.35, and 0.17 nM AlPc) significantly reduced the viability of SCC9 cells. Migration and cell death assays also revealed that PDT with AlPc-NE significantly reduced the rate of migration and increased cell death compared to the control groups. In addition, it was found that PDT with AlPc-NE reduced Ki-67 and mutated TP53 immunoexpression. PDT with AlPc-NE is effective in reducing the viability and migration of SCC9. Moreover, PDT with AlPc-NE nanoemulsions reduces the cell proliferation and expression of mutant TP53.


Subject(s)
Carcinoma, Squamous Cell , Mouth Neoplasms , Nanoparticles , Organometallic Compounds , Photochemotherapy , Aluminum , Carcinoma, Squamous Cell/drug therapy , Humans , Isoindoles , Ki-67 Antigen , Mouth Neoplasms/drug therapy , Organometallic Compounds/pharmacology , Photochemotherapy/methods , Photosensitizing Agents/pharmacology , Photosensitizing Agents/therapeutic use
18.
Mol Biol Rep ; 49(4): 3225-3236, 2022 Apr.
Article in English | MEDLINE | ID: mdl-35066770

ABSTRACT

BACKGROUND: Neutrophil extracellular traps (NETs) are a recently discovered neutrophil defense mechanism which modulates several inflammatory conditions contributing to metabolic profile alterations. Therefore, the present study aimed to evaluate the production of NETs in obese patients and mice, verifying the possible mechanisms associated with the release of NETs by the adipose tissue. METHODS AND RESULTS: The present study investigated NETs production in human adipose tissue and also showing the neutrophils using intravital microscopy in mouse epididymal adipose tissue. Blood and white adipose tissues were obtained from eutrophic and obese individuals and from mice. Lipid, glycemic and leukocyte profiles were evaluated, as well as the levels of NETs and its markers. Bioinformatics and proteomics analyses were performed and the identified key proteins were measured. The main findings showed that the inflammatory markers interleukin-8 (IL-8), heat shock protein 90 (HSP90) and the E1 heat shock protein family (HSPE1) can be modulated by the NETs levels in obesity. Obesity has also been associated with increased cholesterol, glucose intolerance, ionic calcium and NETs. We also observed an increase in catalase and a decreased superoxide dismutase activity. Bioinformatics and proteomics analyses revealed that IL-8, HSP90 and HSPE1 were associated with obesity, inflammation and NETs release. CONCLUSIONS: In conclusion, the present study shows an increase in NETs production during obesity associated with important inflammatory markers in adipose.


Subject(s)
Extracellular Traps , Adipose Tissue/metabolism , Animals , Extracellular Traps/metabolism , Humans , Inflammation/metabolism , Mice , Neutrophils/metabolism , Obesity/metabolism
19.
Dement. neuropsychol ; 15(4): 464-469, Oct.-Dec. 2021. tab, graf
Article in English | LILACS | ID: biblio-1350684

ABSTRACT

ABSTRACT Institutionalization has been associated with social isolation, psychological and cognitive changes, and decreased levels of physical activity in older adults. Objectives: The aim of this study was to estimate the prevalence of dementia, mild cognitive impairment (MCI), and functional dependence in older adults dwelling in two different Brazilian long-term care facilities (LTCFs). Methods: This is a cross-sectional study with 185 older people of both sexes, aged 60 years or over, residing in two LTCFs in the city of Montes Claros-MG, Brazil. The diagnosis of MCI and dementia was performed using the Diagnostic and Statistical Manual of Mental Disorders. Results: Prevalence rates of dementia, MCI, and functional dependence in institutionalized older participants were 62.3, 15.1, and 78.9%, respectively. There was a significant reduction of the Mini-Mental State Examination scores according to the increase of the institutionalization period in LCTFs and the age of older adults (p<0.001). Conclusions: Prevalence of dementia and functional dependence of older adults residing in LTCFs exhibited higher rates compared to the other older population worldwide. A higher institutionalization period is related to a greater cognitive decline.


RESUMO A institucionalização tem sido associada ao isolamento social, a alterações psicológicas e cognitivas e à diminuição dos níveis de atividade física em idosos. Objetivos: Estimar a prevalência de demência, declínio cognitivo leve (DCL) e dependência funcional em idosos residentes em duas instituições de longa permanência (ILPI) brasileiras. Métodos: Estudo transversal com 185 idosos de ambos os sexos, com 60 anos ou mais, residentes em duas ILPI. O diagnóstico de DCL e demência foi realizado por meio do Manual Diagnóstico e Estatístico de Transtornos Mentais. Resultados: As taxas de prevalência de demência, DCL e dependência funcional em participantes idosos institucionalizados foram 62,3, 15,1 e 78,9%, respectivamente. Houve redução significativa dos escores do miniexame do estado mental de acordo com o aumento do período de institucionalização nas ILPI e a idade dos idosos (p<0,001). Conclusões: A prevalência de demência e dependência funcional de idosos residentes em ILPI foi mais elevada em comparação com outras populações idosas em todo o mundo. Um período maior de institucionalização está relacionado a maior declínio cognitivo.


Subject(s)
Humans , Aged , Dementia , Aged , Long-Term Care , Cognitive Dysfunction
20.
Gene ; 800: 145839, 2021 Oct 20.
Article in English | MEDLINE | ID: mdl-34274470

ABSTRACT

COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® ≫ blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.


Subject(s)
COVID-19/genetics , RNA, Antisense/genetics , SARS-CoV-2/genetics , Algorithms , COVID-19/virology , Computer Simulation , Gene Expression Regulation, Viral , Humans
SELECTION OF CITATIONS
SEARCH DETAIL