Uncovering the history of recombination and population structure in western Canadian stripe rust populations through mating type alleles.

BACKGROUND: The population structure of crop pathogens such as Puccinia striiformis f. sp. tritici (Pst), the cause of wheat stripe rust, is of interest to researchers looking to understand these pathogens on a molecular level as well as those with an applied focus such as disease epidemiology. Cereal rusts can reproduce sexually or asexually, and the emergence of novel lineages has the potential to cause serious epidemics such as the one caused by the 'Warrior' lineage in Europe. In a global context, Pst lineages in Canada were not well-characterized and the origin of foreign incursions was not known. Additionally, while some Pst mating type genes have been identified in published genomes, there has been no rigorous assessment of mating type diversity and distribution across the species. RESULTS: We used a whole-genome/transcriptome sequencing approach for the Canadian Pst population to identify lineages in their global context and evidence tracing foreign incursions. More importantly: for the first time ever, we identified nine alleles of the homeodomain mating type locus in the worldwide Pst population and show that previously identified lineages exhibit a single pair of these alleles. Consistently with the literature, we find only two pheromone receptor mating type alleles. We show that the recent population shift from the 'PstS1' lineage to the 'PstS1-related' lineage is also associated with the introduction of a novel mating type allele (Pst-b3-HD) to the Canadian population. We also show evidence for high levels of mating type diversity in samples associated with the Himalayan center of diversity for Pst, including a single Canadian race previously identified as 'PstPr' (probable recombinant) which we identify as a foreign incursion, most closely related to isolates sampled from China circa 2015. CONCLUSIONS: These data describe a recent shift in the population of Canadian Pst field isolates and characterize homeodomain-locus mating type alleles in the global Pst population which can now be utilized in testing several research questions and hypotheses around sexuality and hybridization in rust fungi.

First report of Fusarium graminearum causing Fusarium Head Blight (FHB) of wheat and barley in Lower Mainland of British Columbia, Canada.

Fusarium head blight (FHB), predominantly caused by Fusarium graminearum is one of the most economically important fungal diseases of small-grain cereals. Since the early 1990s, FHB has been a devastating wheat disease in parts of Canada and the United States, causing significant economic impacts on the cereal grain industry through reduced seed quality and yield, and grain contamination with fungal toxins (Brar et al. 2019). Spikes of wheat and barley with bleached spikelets and pinkish coloration were observed with low incidence and high severity in August 2021 field stripe rust nursery at UBC Totem Plant Science Farm in Vancouver, Canada (Supplementary File 1). FHB-like Symptomatic spikes were collected during the growing season. The Fusarium damaged kernels (FDK) were surface-sterilized with 1% sodium hypochlorite (NaOCl) for 1.5 min, rinsed three times in distilled water and dried using sterile filter paper discs in Biological Safety Cabinet. The kernels were placed on Petri dishes containing three layers of moist blotter papers and incubated in the dark at 22-25°C for 24 hours. The Petri dishes were transferred into a -20°C freezer for 24 hours, followed by five days of incubation at 22-25°C under fluorescent light, during which distilled water was added onto blotter papers every day to maintain moisture. After incubation, mycelium growing on kernels was transferred to potato dextrose agar (PDA) media and subcultured based on the colony and conidial morphology of F. graminearum (Leslie and Summerell 2006). The colonies selected grew white mycelia with a pink pigment at the bottom. Macroconidia with five to six septate were produced after seven days and microconidia were absent. Seven isolates derived from different wheat samples were derived from single conidia and identified based on amplicon sequencing using a MinION Flongle flow cell described by Boutigny et al. (2019). Reads which passed the integrated MinKNOW quality control step were mapped to the Partial translation elongation factor 1- α (EF1a) gene, using primers EF1-F2 (5'TCATC GGCCACGTCGACTCT3') and EF1-R3 (5'TACCAGCCTCGAACTCACCA3'). The consensus sequence for each sample was aligned to the reference sequence (JF740867.1) using BLASTn, revealing all the similarities of more than 99.5% (Supplementary File 2). The morphological characteristics (colony, pink pigment, shape of macroconidia, absence of microconidia) (Leslie and Summerell, 2006) and sequencing results indicated that the seven isolates from wheat were F. graminearum of the 3ADON chemotype. Besides, Koch's postulates were performed by spray-inoculating healthy inflorescences of eight wheat plants derived from the cross Avocet/CDC Silex at half anthesis stage (one isolate per plant and one non-inoculated control). Each spike was thoroughly sprayed with 1ml of spore suspension containing 5 × 104 conidia per ml (4-5 spikes per plant). The spikes on one plant were treated with distilled water (1 ml per spike) as a blank control. The inoculated spikes were covered with moist plastic bags for 48 hours, and the plants were placed in a growth chamber under a 12-h photoperiod at 18°C. Seven days later, spikes of the spores-treated plants exhibited bleached spikelets, which is a typical symptom of FHB, and there was no disease on the control plant. F. graminearum was re-isolated from FDK of diseased spikes using the isolation methodology and identified by morphology described above. To our knowledge and based on a literature review, this is the first report of F. graminearum causing FHB on wheat and barley in the Lower Mainland of British Columbia. The reason for the concealment of F. graminearum in BC might be the small acreage of commercially grown small-grain cereals. Further, there is limited cultivation of winter wheat and barley in the region for forage/silage, but the crops are harvested at the soft dough stage leaving limited grain/spike residue for the next crop. While presently there is very low acreage of cereal host crops of F. gramineraum in Lower Mainland, this acreage might increase in future years as winter cereals are slowly expanding in the region as cover crops, forages, and even grain production for sale to forgae producers or for local breweries in case of barley; therefore, finding of F. gramineraum could have economic consequences on cereal production in the region in future. Further investigation is needed to better understand the aggressiveness of the strains and their population structure of the pathogen in the Region.

A lineage-specific Exo70 is required for receptor kinase-mediated immunity in barley.

In the evolution of land plants, the plant immune system has experienced expansion in immune receptor and signaling pathways. Lineage-specific expansions have been observed in diverse gene families that are potentially involved in immunity but lack causal association. Here, we show that Rps8-mediated resistance in barley to the pathogen Puccinia striiformis f. sp. tritici (wheat stripe rust) is conferred by a genetic module: Pur1 and Exo70FX12, which are together necessary and sufficient. Pur1 encodes a leucine-rich repeat receptor kinase and is the ortholog of rice Xa21, and Exo70FX12 belongs to the Poales-specific Exo70FX clade. The Exo70FX clade emerged after the divergence of the Bromeliaceae and Poaceae and comprises from 2 to 75 members in sequenced grasses. These results demonstrate the requirement of a lineage-specific Exo70FX12 in Pur1-mediated immunity and suggest that the Exo70FX clade may have evolved a specialized role in receptor kinase signaling.

Multiomics approach reveals a role of translational machinery in shaping maize kernel amino acid composition.

Maize (Zea mays) seeds are a good source of protein, despite being deficient in several essential amino acids. However, eliminating the highly abundant but poorly balanced seed storage proteins has revealed that the regulation of seed amino acids is complex and does not rely on only a handful of proteins. In this study, we used two complementary omics-based approaches to shed light on the genes and biological processes that underlie the regulation of seed amino acid composition. We first conducted a genome-wide association study to identify candidate genes involved in the natural variation of seed protein-bound amino acids. We then used weighted gene correlation network analysis to associate protein expression with seed amino acid composition dynamics during kernel development and maturation. We found that almost half of the proteome was significantly reduced during kernel development and maturation, including several translational machinery components such as ribosomal proteins, which strongly suggests translational reprogramming. The reduction was significantly associated with a decrease in several amino acids, including lysine and methionine, pointing to their role in shaping the seed amino acid composition. When we compared the candidate gene lists generated from both approaches, we found a nonrandom overlap of 80 genes. A functional analysis of these genes showed a tight interconnected cluster dominated by translational machinery genes, especially ribosomal proteins, further supporting the role of translation dynamics in shaping seed amino acid composition. These findings strongly suggest that seed biofortification strategies that target the translation machinery dynamics should be considered and explored further.

Genetic variation, environment and demography intersect to shape Arabidopsis defense metabolite variation across Europe.

Plants produce diverse metabolites to cope with the challenges presented by complex and ever-changing environments. These challenges drive the diversification of specialized metabolites within and between plant species. However, we are just beginning to understand how frequently new alleles arise controlling specialized metabolite diversity and how the geographic distribution of these alleles may be structured by ecological and demographic pressures. Here, we measure the variation in specialized metabolites across a population of 797 natural Arabidopsis thaliana accessions. We show that a combination of geography, environmental parameters, demography and different genetic processes all combine to influence the specific chemotypes and their distribution. This showed that causal loci in specialized metabolism contain frequent independently generated alleles with patterns suggesting potential within-species convergence. This provides a new perspective about the complexity of the selective forces and mechanisms that shape the generation and distribution of allelic variation that may influence local adaptation.

Since plants cannot move, they have evolved chemical defenses to help them respond to changes in their surroundings. For example, where animals run from predators, plants may produce toxins to put predators off. This approach is why plants are such a rich source of drugs, poisons, dyes and other useful substances. The chemicals plants produce are known as specialized metabolites, and they can change a lot between, and even within, plant species. The variety of specialized metabolites is a result of genetic changes and evolution over millions of years. Evolution is a slow process, yet plants are able to rapidly develop new specialized metabolites to protect them from new threats. Even different populations of the same species produce many distinct metabolites that help them survive in their surroundings. However, the factors that lead plants to produce new metabolites are not well understood, and it is not known how this affects genetic variation. To gain a better understanding of this process, Katz et al. studied 797 European variants of a common weed species called Arabidopsis thaliana, which is widely studied. The investigation found that many factors affect the range of specialized metabolites in each variant. These included local geography and environment, as well as genetics and population history (demography). Katz et al. revealed a pattern of relationships between the variants that could mirror their evolutionary history as the species spread and adapted to new locations. These results highlight the complex network of factors that affect plant evolution. Rapid diversification is key to plant survival in new and changing environments and has resulted in a wide range of specialized metabolites. As such they are of interest both for studying plant evolution and for understanding their ecology. Expanding similar work to more populations and other species will broaden the scope of our ability to understand how plants adapt to their surroundings.

Long-read sequence assembly: a technical evaluation in barley.

Sequence assembly of large and repeat-rich plant genomes has been challenging, requiring substantial computational resources and often several complementary sequence assembly and genome mapping approaches. The recent development of fast and accurate long-read sequencing by circular consensus sequencing (CCS) on the PacBio platform may greatly increase the scope of plant pan-genome projects. Here, we compare current long-read sequencing platforms regarding their ability to rapidly generate contiguous sequence assemblies in pan-genome studies of barley (Hordeum vulgare). Most long-read assemblies are clearly superior to the current barley reference sequence based on short-reads. Assemblies derived from accurate long reads excel in most metrics, but the CCS approach was the most cost-effective strategy for assembling tens of barley genomes. A downsampling analysis indicated that 20-fold CCS coverage can yield very good sequence assemblies, while even five-fold CCS data may capture the complete sequence of most genes. We present an updated reference genome assembly for barley with near-complete representation of the repeat-rich intergenic space. Long-read assembly can underpin the construction of accurate and complete sequences of multiple genomes of a species to build pan-genome infrastructures in Triticeae crops and their wild relatives.

mGWAS Uncovers Gln-Glucosinolate Seed-Specific Interaction and its Role in Metabolic Homeostasis.

Gln is a key player in plant metabolism. It is one of the major free amino acids that is transported into the developing seed and is central for nitrogen metabolism. However, Gln natural variation and its regulation and interaction with other metabolic processes in seeds remain poorly understood. To investigate the latter, we performed a metabolic genome-wide association study (mGWAS) of Gln-related traits measured from the dry seeds of the Arabidopsis (Arabidopsis thaliana) diversity panel using all potential ratios between Gln and the other members of the Glu family as traits. This semicombinatorial approach yielded multiple candidate genes that, upon further analysis, revealed an unexpected association between the aliphatic glucosinolates (GLS) and the Gln-related traits. This finding was confirmed by an independent quantitative trait loci mapping and statistical analysis of the relationships between the Gln-related traits and the presence of specific GLS in seeds. Moreover, an analysis of Arabidopsis mutants lacking GLS showed an extensive seed-specific impact on Gln levels and composition that manifested early in seed development. The elimination of GLS in seeds was associated with a large effect on seed nitrogen and sulfur homeostasis, which conceivably led to the Gln response. This finding indicates that both Gln and GLS play key roles in shaping the seed metabolic homeostasis. It also implies that select secondary metabolites might have key functions in primary seed metabolism. Finally, our study shows that an mGWAS performed on dry seeds can uncover key metabolic interactions that occur early in seed development.

The complex response of free and bound amino acids to water stress during the seed setting stage in Arabidopsis.

Free amino acids (FAAs) and protein-bound amino acids (PBAAs) in seeds play an important role in seed desiccation, longevity, and germination. However, the effect that water stress has on these two functional pools, especially when imposed during the crucial seed setting stage is unclear. To better understand these effects, we exposed Arabidopsis plants at the seed setting stage to a range of water limitation and water deprivation conditions and then evaluated physiological, metabolic, and proteomic parameters, with special focus on FAAs and PBAAs. We found that in response to severe water limitation, seed yield decreased, while seed weight, FAA, and PBAA content per seed increased. Nevertheless, the composition of FAAs and PBAAs remained unaltered. In response to severe water deprivation, however, both seed yield and weight were reduced. In addition, major alterations were observed in both FAA and proteome compositions, which indicated that both osmotic adjustment and proteomic reprogramming occurred in these naturally desiccation-tolerant organs. However, despite the major proteomic alteration, the PBAA composition did not change, suggesting that the proteomic reprogramming was followed by a proteomic rebalancing. Proteomic rebalancing has not been observed previously in response to stress, but its occurrence under stress strongly suggests its natural function. Together, our data show that the dry seed PBAA composition plays a key role in seed fitness and therefore is rigorously maintained even under severe water stress, while the FAA composition is more plastic and adaptable to changing environments, and that both functional pools are distinctly regulated.