Neoadjuvant Savolitinib targeted therapy stage IIIA-N2 primary lung adenocarcinoma harboring MET Exon 14 skipping mutation: A case report.

MET exon 14 skipping mutation (METex14m) is rare and occurs in approximately 1-4% of all non-small cell lung cancer (NSCLC) patients and approximately 2.8% of resected stage I-III NSCLC patients. Savolitinib is an oral, potent and highly selective type Ib MET inhibitor, which has been shown to be promising activity and acceptable safety profile in patients with advanced NSCLC harboring METex14m. Most recently, many studies have been probing into the feasibility and efficacy of target therapy for perioperative application in NSCLC. Interestingly, there are very few recorded cases of such treatments. Here, we presented that systemic treatment with the MET inhibitor savolitinib before surgery could provide the potential to prolong overall survival (OS) of patients with locally advanced potentially resectable NSCLC. A 49-year-old woman was diagnosed with stage IIIA (T2bN2M0) primary lung adenocarcinoma exhibiting a METex14m by real-time quantitative polymerase chain reaction (RT-qPCR). Given that the tumor load and the size of lymph nodes experienced a significant downstaging after the neoadjuvant treatment of savolitinib with 600mg once a day for 5 weeks, left lower lobectomy and systemic lymphadenectomy were successfully performed. The pathological response was 50% and the final postoperative pathological staging was pT1cN0M0, IA3 (AJCC, 8th edition). The case provides empirical basis for the neoadjuvant treatment with savolitinib in METex14m-positive locally advanced primary lung adenocarcinoma, which will offer some innovative insights and clinical evidence for more effective clinical treatment of neoadjuvant targeted therapy for METex14m-positive NSCLC.

The performance of detecting Mycobacterium tuberculosis complex in lung biopsy tissue by metagenomic next-generation sequencing.

BACKGROUND: Tuberculosis (TB) is a chronic infectious disease caused by the Mycobacterium tuberculosis complex (MTBC), which is the leading cause of death from infectious diseases. The rapid and accurate microbiological detection of the MTBC is crucial for the diagnosis and treatment of TB. Metagenomic next-generation sequencing (mNGS) has been shown to be a promising and satisfying application of detection in infectious diseases. However, relevant research about the difference in MTBC detection by mNGS between bronchoalveolar lavage fluid (BALF) and lung biopsy tissue specimens remains scarce. METHODS: We used mNGS to detect pathogens in BALF and lung biopsy tissue obtained by CT-guide percutaneous lung puncture (CPLP) or radial endobronchial ultrasound transbronchial lung biopsy (R-EBUS-TBLB) from 443 hospitalized patients in mainland China suspected of pulmonary infections between May 1, 2019 and October 31, 2021. Aim to evaluate the diagnostic performance of mNGS for detecting MTBC and explore differences in the microbial composition in the 2 specimen types. RESULTS: Among the 443 patients, 46 patients finally were diagnosed with TB, of which 36 patients were detected as MTBC positive by mNGS (8.93%). Striking differences were noticed in the higher detection efficiency of lung biopsy tissue compared with BALF (P = 0.004). There were no significant differences between the 2 specimen types in the relative abundance among the 27 pathogens detected by mNGS from the 36 patients. CONCLUSIONS: This study demonstrates that mNGS could offer an effective detection method of MTBC in BALF or lung tissue biopsy samples in patients suspected of TB infections. When it comes to the situations that BALF samples have limited value to catch pathogens for special lesion sites or the patients have contraindications to bronchoalveolar lavage (BAL) procedures, lung biopsy tissue is an optional specimen for MTBC detection by mNGS. However, whether lung tissue-mNGS is superior to BALF-mNGS in patients with MTBC infection requires further prospective multicenter randomized controlled studies with more cases.

Acute Respiratory Distress Syndrome Caused by Occupational Exposure to Waterproofing Spray: A Case Report and Literature Review.

Background: Acute respiratory distress syndrome (ARDS) is a serious respiratory disease, caused by severe infection, trauma, shock, inhalation of harmful gases and poisons and presented with acute-onset and high mortality. Timely and accurate identification will be helpful to the treatment and prognosis of ARDS cases. Herein, we report a case of ARDS caused by occupational exposure to waterproofing spray. To our knowledge, inhalation of waterproofing spray is an uncommon cause of ARDS, and what makes our case special is that we ruled out concurrent infections with some pathogens by using metagenomic next-generation sequencing (mNGS) as an auxiliary diagnosis, which presents the most comprehensive etiological examination of similar reports. Case Presentation: A previously healthy 25 years old delivery man developed hyperpyrexia, chest tightness, cough and expectoration. The symptoms occurred and gradually exacerbated after exposure to a waterproofing spray. The chest computed tomography (CT) finding showed diffuse ground glass and infiltrative shadows in both lungs. The diagnosis of ARDS related to waterproofing spray was established on the basis of comprehensive differential diagnosis and etiological examination. The patient achieved good curative effect after proper systemic glucocorticoid therapy. Conclusions: The diagnosis and differential diagnosis of acute respiratory failure for outdoor workers, such as delivery drivers or hikers, should be considered whether toxic aerosol exposure exists from daily contacts. The case can educate the public that more attention should be paid to avoid exposure to these chemicals by aerosols/ingestion mode and some preventive strategies should be taken in occupational environment. The treatment effect of glucocorticoids is significant in ARDS patients with general chemical damage caused by inhaling toxic gases and substances.

Chemical compositions and repellent activity of Clerodendrum bungei Steud. essential oil against three stored product insects.

BACKGROUND: Several species of Verbenaceae have been widely used in medicine, and some species of Verbenaceae have been observed good insecticidal activity, such as Lantana camara and Vitex negundo. There is no report about repellent activity of Clerodendrum bungei Steud. (C. bungei) against stored product insects. The chemical composition of C. bungei essential oil (EO) were identified, repellent activity of methanol extract, EO of C. bungei and two main components of EO against T. castaneum, L. serricorne and L. bostrychophila were evaluated for the first time. RESULTS: EO of C. bungei was obtained by hydrodistillation and analyzed by gas chromatography-mass spectrometry (GC-MS) and GC. A total of 25 components of the C. bungei EO were identified. The principal compounds in the EO were myristicin (75.0%), 2,2,7,7-Tetramethyltricyclo[6.2.1.0(1,6)]undec-4-en-3-one (4.1%) and linalool (3.4%). Results of bioassays indicated that C. bungei EO exerted strong repellent activity against three target insects. As main constituents, myristicin and linalool also had certain repellency. CONCLUSION: This work suggests that the EO of C. bungei has promising potential to develop into botanical repellents for the control of pest damage in warehouses and grain stores.

Parasitic insect-derived miRNAs modulate host development.

Parasitic wasps produce several factors including venom, polydnaviruses (PDVs) and specialized wasp cells named teratocytes that benefit the survival of offspring by altering the physiology of hosts. However, the underlying molecular mechanisms for the alterations remain unclear. Here we find that the teratocytes of Cotesia vestalis, an endoparasitoid of the diamondback moth Plutella xylostella, and its associated bracovirus (CvBV) can produce miRNAs and deliver the products into the host via different ways. Certain miRNAs in the parasitized host are mainly produced by teratocytes, while the expression level of miRNAs encoded by CvBV can be 100-fold greater in parasitized hosts than non-parasitized ones. We further show that one teratocyte-produced miRNA (Cve-miR-281-3p) and one CvBV-produced miRNA (Cve-miR-novel22-5p-1) arrest host growth by modulating expression of the host ecdysone receptor (EcR). Altogether, our results show the first evidence of cross-species regulation by miRNAs in animal parasitism and their possible function in the alteration of host physiology during parasitism.

Inhibition of viral replication by small interfering RNA targeting of the foot-and-mouth disease virus receptor integrin ß6.

In animals, foot-and-mouth disease (FMD) causes symptoms such as fever, limping and the development of blister spots on the skin and mucous membranes. RNA interference (RNAi) may be a novel way of controlling the FMD virus (FMDV), specifically by targeting its cognate receptor protein integrin ß6. The present study used RNAi technology to construct and screen plasmids that expressed small interfering RNA molecules (siRNAs) specific for the integrin ß6 subunit. Expression of green fluorescence protein from the RNAi plasmids was observed following transfection into porcine embryonic fibroblast (PEF) cells, and RNAi plasmids were screened using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. A fragment (5'AAAGGCCAAGTGGCAAACGGG 3') with marked interference activity was ligated into a PXL-EGFP-NEO integration plasmid and transfected into PEF cells. Transfected cells were selected using G418, and interference of the integrated plasmid was subsequently evaluated by FMDV challenge experiments, in which the levels of viral replication were determined using optical microscopy and RT-qPCR. A total of seven interference plasmids were successfully constructed, including the pGsi-Z4 plasmid, which had a significant interference efficiency of 91.7% in PEF cells (**P<0.01). Upon transfection into PEF cells for 36 h, a Z4 integration plasmid exhibited significant inhibitory effects (**P<0.01) on the integrin ß6 subunit. Subsequent challenge experiments in transfected PEF cells also demonstrated that viral replication was reduced by 24.2 and 12.8% after 24 and 36 h, respectively. These data indicate that RNAi technology may inhibit intracellular viral replication in PEF cells by reducing expression of the FMDV receptor integrin ß6.

A 3D porous polymer monolith-based platform integrated in poly(dimethylsiloxane) microchips for immunoassay.

In this work, we demonstrate the immunocapture and on-line fluorescence immunoassay of protein and virus based on porous polymer monoliths (PPM) in microfluidic devices. Poly(glycidyl methacrylate-co-ethylene glycol dimethacrylate) [poly(GMA-co-EGDMA)] monoliths were successfully synthesized in the polydimethylsiloxane (PDMS) microfluidic channels by in situ UV-initiated free radical polymerization. After surface modification, PPM provides a high-surface area and specific affinity 3D substrate for immunoassays. Combining with well controlled microfluidic devices, the direct immunoassay of IgG and sandwich immunoassay of inactivated H1N1 influenza virus using 5 µL sample has been accomplished, with detection limits of 4 ng mL(-1) and less than 10 pg mL(-1), respectively. The enhanced detection sensitivity is due to both high surface area of PPM and flow-through design. The detection time was obviously decreased mainly due to the shortened diffusion distance and improved convective mass transfer inside the monolith, which accelerates the reaction kinetics between antigen and antibody. This work provides a novel microfluidic immunoassay platform with high efficiency thereby enabling fast and sensitive immunoassay.

Start-up of completely autotrophic nitrogen removal over nitrite enhanced by hydrophilic-modified carbon fiber.

In order to assess the effects of the surface hydrophilicity of supports on the biofilm formation and evaluate the performance of completely autotrophic nitrogen removal over nitrite (CANON) process in a sequencing batch biofilm reactor (SBBR), unmodified activity carbon fibers (ACFs) and ACFs hydrophilic modified by heat treatment were used as supports. CANON process was initiated in a SBBR from conventional activated sludge. An operation temperature of 32 ± 2 °C, dissolved oxygen (DO) level at 1.5 mg L⁻¹ and free ammonia (FA) concentration with 3.98-15.93 mg L⁻¹ were maintained in the SBBR. Fourier transform infrared (FT-IR) spectra and Boehm's neutralizing titration exhibited that modified ACFs had more oxygen-containing groups than unmodified ACFs. Larger biofilm growth on the modified surfaces examined by scanning electron microscopy and biofilm's total dry weight, and the biofilm on the modified surfaces were more active, compared with those on the unmodified surfaces. This study demonstrates the hydrophilic-modified ACFs have better biological affinity than unmodified ACFs. Maximal total nitrogen removal rate of 0.088 k g N m⁻³ day⁻¹ was achieved for the CANON process on day 80, indicating the CANON process was successfully started up. Apart from supports, the strategies of DO supplying and controlling FA concentration were also keys in starting up the CANON process within a shorter period.