Novel anther-specific myb genes from tobacco as putative regulators of phenylalanine ammonia-lyase expression.

Two cDNA clones (NtmybAS1 and NtmybAS2) encoding MYB-related proteins with strong sequence similarity to petunia (Petunia hybrida) PhMYB3 were isolated from a tobacco (Nicotiana tabacum cv Samsun) pollen cDNA library. Northern blot and in situ hybridization revealed that NtmybAS transcripts are specifically expressed in both sporophytic and gametophytic tissues of the anther including tapetum, stomium, vascular tissue, and developing pollen. Random binding site selection assays revealed that NtMYBAS1 bound to DNA sequences closely resembling consensus MYB binding sites MBSI and MBSIIG, with a higher affinity for MBSI. Transient expression analyses of the N-terminal MYB domain demonstrated the presence of functional nuclear localization signals, and full-length NtMYBAS1 was able to activate two different phenylalanine ammonia-lyase promoters (PALA and gPAL1) in tobacco leaf protoplasts. Similar analysis of truncated NtmybAS1 cDNAs identified an essential, C-terminal trans-activation domain. Further in situ hybridization analyses demonstrated strict co-expression of NtmybAS and gPAL1 in the tapetum and stomium. Despite abundant expression of NtmybAS transcripts in mature pollen, gPAL1 transcripts were not detectable in pollen. Our data demonstrate that NtMYBAS1 is a functional anther-specific transcription factor, which is likely to be a positive regulator of gPAL1 expression and phenylpropanoid synthesis in sporophytic, but not in gametophytic, tissues of the anther.

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.

The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

Functional analysis of linker insertions and point mutations in the alpha-Amy2/54 GA-regulated promoter.

Functional analysis of a gibberellin-regulated wheat alpha-amylase promoter, alpha-Amy2/54, has indicated that three regions were essential for expression. By studying the ability of mutant promoters, containing a randomly inserted 22 bp excision linker, to direct expression in oat aleurone protoplasts we have refined the positions and extents of these three cis elements and also demonstrated the presence of two additional elements. By converting the linker insertions to either single base point mutations or deletions using the class IIS restriction endonuclease BsmI we have shown that nucleotides -119 and -109 within the GARE -121GTAACAGAGTCTGG-108 and nucleotide -152 within the proposed element -156GATTGACTTGACC-144 are essential for high level expression from this promoter.

Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.

Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.

Gibberellin-regulated expression in oat aleurone cells of two kinases that show homology to MAP kinase and a ribosomal protein kinase.

cDNA fragments from ten different protein kinases expressed in Avena sativa aleurone cells were amplified from mRNA by RT-PCR with degenerate primers. These could be classified into five groups: Aspk1-3 showed homology to the Snf1-related protein kinases, Aspk4-5 to a wheat ABA up-regulated protein kinase, Aspk6-8 to the Ca-dependent, calmodulin-independent protein kinase family, Aspk9 encoded a MAP kinase and Aspk10 was closely related to a novel Arabidopsis ribosomal protein kinase. GA caused a rapid increase in transcripts hybridising to Aspk10, while inhibiting the dramatic accumulation of transcripts hybridising to Aspk9 that occurred in the absence of GA.

Cloning of two gibberellin-regulated cDNAs from Arabidopsis thaliana by subtractive hybridization: expression of the tonoplast water channel, gamma-TIP, is increased by GA3.

The Arabidopsis ga1 mutant has very low levels of endogenous, active gibberellins and thus has an extreme dwarf phenotype; application of GA3 induces stem elongation and flower development. To test the hypothesis that GA action in this system involves changes in gene expression, we have cloned mRNAs whose abundance changes following GA application. A subtraction cloning scheme for the isolation of differentially regulated cDNAs was established, involving hybridization of single-stranded cDNA to biotinylated mRNA. cDNA populations enriched up to 150-fold in GA-regulated sequences were produced and cDNA libraries generated. Screening of these libraries has isolated two clones that identify mRNAs of ca. 1100 and 750 bases whose abundance is markedly increased 24 h after GA application. One of these clones encodes the vegetative form of the Arabidopsis tonoplast intrinsic protein (gamma-TIP), a water channel protein, the expression of which has recently been shown to be correlated with regions of cell expansion. The second clone is expressed only in the inflorescence and encodes a proline- and glycine-rich protein that may be a cell wall component.

Localisation of cis elements in the promoter of a wheat alpha-Amy2 gene.

A functional analysis of the promoter from the wheat alpha-amylase gene alpha-Amy2/54 is described. Mutant alpha-Amy2/54 promoters containing replacements or deletions were constructed and their ability to direct expression of the reporter gene beta-glucuronidase (GUS) in gibberellin-responsive oat aleurone protoplasts analysed. Chimaeric promoters using regions of the cauliflower mosaic virus (CaMV) 35S and alpha-Amy2/54 promoters were also analysed. The results suggest that at least three regions within the alpha-Amy2/54 promoter contain cis elements that are necessary for high-level gibberellin-regulated transcription. Fusion of 1.8 kb of promoter sequence upstream from -117 bp to a minimal (-55 CaMV 35S) promoter gave rise to hormone-independent expression implying that the region 3' to -117 bp contains an element which represses transcription in the absence of gibberellin or presence of abscisic acid.

Nucleotide sequence and transcripts of the pea chloroplast gene encoding CFo subunit III of ATP synthase.

The structure and expression of the pea chloroplast atpH gene, encoding ATP synthase CFo subunit III, have been investigated. The atpH gene is situated between the atpI and atpF genes for CFo subunits IV and I, and encodes a hydrophobic polypeptide of 81 amino acid residues which is very similar to subunit III from other species. Analysis of transcripts from the region of chloroplast DNA encoding ATP synthase subunits IV-III-I-alpha shows a complex pattern of transcription, with large transcripts potentially coding for several subunits and also smaller gene-specific transcripts. Two abundant transcripts of 660 nucleotides (nt) and 980 nt specific for atpH were identified. Primer extension and S1 nuclease protection mapping suggested that the 660-nt transcripts were produced by endonucleolytic processing at the sequence, 5'-UGGAAU.

A wheat alpha-Amy2 promoter is regulated by gibberellin in transformed oat aleurone protoplasts.

Gibberellin (GA(3))-responsive aleurone protoplasts isolated from Avena sativa have been successfully used as a transient expression system to analyse promoter fusions between the wheat alpha-amylase gene alpha-Amy2/54 and the reporter gene GUS. Following PEG-mediated uptake of plasmid DNA, transient expression directed by the alpha-Amy2/54 promoter was found to be regulated in the same way as the endogenous oat alpha-amylase genes. Expression was thus dependent on the inclusion of GA(3) in the protoplast incubation media, could not be detected before a lag phase of 2 days following transformation and was inhibited by simultaneous addition of abscisic acid (ABA) with GA(3) to the media. In contrast, expression from the CaMV 35S promoter in the same system was not affected by GA(3) or ABA and could be detected 1 day after transformation. Introduction of a further three different promoters into the aleurone protoplasts confirmed that GA(3) specifically controlled transient expression from the alpha-Amy2/54 promoter only. Promoter deletions of the alpha-Amy2/54: GUS fusion demonstrated that sequences within 300 bp of the start of transcription of the gene were sufficient to direct high-level expression that was regulated by GA(3) and ABA.

Sequence heterogeneity and differential expression of the alpha-Amy2 gene family in wheat.

The alpha-Amy2 genes of wheat are a multigene family which is expressed in the aleurone cells of germinating grain under control of the plant hormone gibberellin. A subset of the genes are also expressed in developing grain. Comparison of five genomic clones containing alpha-Amy2 genes, using DNA sequence analysis and Southern hybridisation, showed that the extent of similarity between genes differed. Two of the most heterogeneous genes compared were located to the same group 7 chromosome while the most similar genes alpha-Amy2/54 and alpha-Amy2/8 were located to different ones; hence sequence variation could not be correlated to the ancestry of the alpha-Amy2 genes during the separate existence of the constituent genomes of hexaploid wheat. Expression of the cloned genes was measured using an S1 nuclease protection assay and this identified alpha-Amy2/54 and alpha-Amy2/8 as part of the subset of alpha-Amy2 genes expressed in both the developing grain and in aleurone cells. Comparison of the 5' upstream regions of all five genes showed high similarity, with the exception of one gene, up to -280 nucleotides from the transcriptional start, while similarity between alpha-Amy2/54 and alpha-Amy2/8 extended a further 90 bp upstream of this point. It is suggested that regulatory elements responsible for tissue specificity and gibberellin regulation may be located within these regions of similarity.

A novel wheat alpha-amylase gene (alpha-Amy3).

A genomic clone of a wheat alpha-amylase gene (lambdaAmy3/33) was identified, on the basis of hybridisation properties, as different from alpha-Amy1 and alpha-Amy2 genes which had been characterised previously. The nucleotide sequence revealed that this gene has the normal sequence motifs of an active gene and an open reading frame interrupted by two introns. The protein sequence encoded by this open reading frame is recognisably similar to that of alpha-amylase from the alpha-Amy1 and alpha-Amy2 genes and there is high sequence homology in all three proteins at the putative active sites and Ca++ binding region. In addition, the introns are at positions equivalent to the position of introns in the alpha-Amy1 and alpha-Amy2 genes. However, the sequence was less similar to alpha-Amy1 and alpha-Amy2 than these are to each other. Southern blot analysis showed that the lambdaAmy3/33 DNA is one of a small multigene family carried on a different chromosome (group 5) from either the alpha-Amy1 or alpha-Amy2 genes. A further difference from the alpha-Amy1 and alpha-Amy2 genese was the pattern of expression. lambdaAmy3/33 was expreseed only in immature grains and, unlike the alpha-Amy1 and alpha-Amy2 genes, not at all in germinating aleurones. These data suggested therefore that this gene represents a third type of alpha-amylase gene, not described before, which shares a common evolutionary ancestor with the alpha-Amy1 and alpha-Amy2 genes.

A sixth subunit of ATP synthase, an F(0) component, is encoded in the pea chloroplast genome.

DNA from pea and tobacco chloroplasts hybridizes specifically with probes derived from the gene for a membrane component, the a subunit of ATP synthase of the cyanobacterium, Synechococcus 6301. DNA sequence of the hybridizing region of the pea plastid DNA has revealed that it encodes a protein of 247 amino acids related in sequence to the a subunits of ATP synthase of Escherichia coli, Synechococcus and mitochondria. This is the sixth component of chloroplast ATP synthase that is plastid coded. The gene is located upstream from the genes for three other ATP synthase subunits and a transcript of 6 kb contains coding sequences from each of these genes. Thus the subunit a gene is part of a co-transcribed cluster of four ATP synthase genes arranged in the order a:c(or III):b(or I):alpha. Two other ATP synthase genes, those for beta and epsilon subunits, are known to form a separate cluster. These gene arrangements are most closely related to those found in the cyanobacterium, Synechococcus 6301. Hence, this finding provides strong evidence for a common origin for cyanobacteria and plant chloroplasts.

The wheat chloroplast gene for CF(0) subunit I of ATP synthase contains a large intron.

The gene for CF(0) subunit I of ATP synthase has been located in wheat chloroplast DNA, between the genes for CF(0) subunit III and alpha subunit of CF(1). Nucleotide sequencing and analysis of RNA-DNA hybrids indicated that the gene is interrupted by an 823-bp intron which has boundaries similar to those previously described for the introns in protein-coding chloroplast genes of Euglena gracilis. The deduced amino acid sequence of CF(0) subunit I indicates a polypeptide of 183 amino acid residues. However, N-terminal amino acid sequencing of the mature spinach CF(0) subunit I suggests that the protein is synthesised with a N-terminal extension of 17 amino acid residues and is processed to give a protein of mol. wt. 19 001 of 166 amino acids residues. The mature CF(0) subunit I shows similarities in primary and predicted secondary structure to F(0) subunit b of Escherichia coli ATP synthase. A major transcript of 3.3 kb containing sequences from the genes for CF(0) subunit III, subunit I and CF(1) subunit alpha has been observed by RNA-DNA hybridisation.