Predicting the risk of cucurbit downy mildew in the eastern United States using an integrated aerobiological model.

Cucurbit downy mildew caused by the obligate oomycete, Pseudoperonospora cubensis, is considered one of the most economically important diseases of cucurbits worldwide. In the continental United States, the pathogen overwinters in southern Florida and along the coast of the Gulf of Mexico. Outbreaks of the disease in northern states occur annually via long-distance aerial transport of sporangia from infected source fields. An integrated aerobiological modeling system has been developed to predict the risk of disease occurrence and to facilitate timely use of fungicides for disease management. The forecasting system, which combines information on known inoculum sources, long-distance atmospheric spore transport and spore deposition modules, was tested to determine its accuracy in predicting risk of disease outbreak. Rainwater samples at disease monitoring sites in Alabama, Georgia, Louisiana, New York, North Carolina, Ohio, Pennsylvania and South Carolina were collected weekly from planting to the first appearance of symptoms at the field sites during the 2013, 2014, and 2015 growing seasons. A conventional PCR assay with primers specific to P. cubensis was used to detect the presence of sporangia in rain water samples. Disease forecasts were monitored and recorded for each site after each rain event until initial disease symptoms appeared. The pathogen was detected in 38 of the 187 rainwater samples collected during the study period. The forecasting system correctly predicted the risk of disease outbreak based on the presence of sporangia or appearance of initial disease symptoms with an overall accuracy rate of 66 and 75%, respectively. In addition, the probability that the forecasting system correctly classified the presence or absence of disease was ≥ 73%. The true skill statistic calculated based on the appearance of disease symptoms in cucurbit field plantings ranged from 0.42 to 0.58, indicating that the disease forecasting system had an acceptable to good performance in predicting the risk of cucurbit downy mildew outbreak in the eastern United States.

Control of Fusarium Wilt of Watermelon by Grafting onto Bottlegourd or Interspecific Hybrid Squash Despite Colonization of Rootstocks by Fusarium.

Grafting watermelon (Citrullus lanatus var. lanatus) onto rootstocks of interspecific hybrid squash (Cucurbita moschata × C. maxima), bottle gourd (Lagenaria siceraria), or citron (Citrullus lanatus var. citroides) has been used in Asia and Israel to mange Fusarium wilt of watermelon caused by Fusarium oxysporum f. sp. niveum. The objectives of this study were to determine the frequency of infection of six rootstocks by F. oxysporum f. sp. niveum races 1 and 2 and the field performance of grafted rootstocks in Charleston, SC. Grafted and nongrafted watermelon and rootstock plants were inoculated in the greenhouse with race 1, race 2, or water (the control treatment). With both races, the frequency of recovery of F. oxysporum from scion and rootstock portions of inoculated watermelon plants grafted onto 'Ojakkyo' citron was greater than from watermelon plants grafted onto 'Shintosa Camel' and 'Strong Tosa' interspecific hybrid squash, and from plants grafted onto 'Emphasis', 'Macis', and 'WMXP 3945' bottlegourd. For nongrafted plants inoculated with race 1, percent recovery also was greater from Ojakkyo than from interspecific hybrid squash and bottlegourd. For nongrafted plants inoculated with race 2, F. oxysporum was recovered from the base of ≥79% of all inoculated plants. More than two-thirds (15) of 21 isolates recovered from the tops or scions of inoculated plants were pathogenic on watermelon. In spring 2010 and 2011, the six rootstocks were grafted with seedless watermelon 'Tri-X 313', which is susceptible to both races, and transplanted in a field infested with races 1 and 2 of F. oxysporum f. sp. niveum. Disease incidence for nongrafted and self-grafted Tri-X 313 (the control treatments) and Tri-X 313 grafted onto Ojakkyo citron did not differ significantly. Grafted watermelon plants produced greater weights and numbers of fruit than plants of the two control treatments. Nonpathogenic isolates of F. oxysporum and isolates of F. oxysporum f. sp. niveum colonized interspecific hybrid squash, bottlegourd, and grafted watermelon. The rootstocks evaluated, however, restricted movement of F. oxysporum f. sp. niveum into the watermelon scion, suppressed wilt symptoms, and increased fruit yields in an infested field.

First Report of Bacterial Leaf Blight on Mustard Greens (Brassica juncea) Caused by Pseudomonas cannabina pv. alisalensis in Mississippi.

In 2010, a brassica leafy greens grower in Sunflower County, MS, observed scattered outbreaks of a leaf blight on mustard greens (Brassica juncea) in a 180-ha field. A severe outbreak of leaf blight occurred on mustard greens and turnip greens (B. rapa) in the same field in 2011 with more than 80 ha affected. The affected field, established in 2010, had no prior history of being cropped to brassica leafy greens. Symptoms appeared on the 6-week-old transplants as brown to tan necrotic spots with faint chlorotic borders and associated water-soaking. Lesions varied from 4 mm to 3 cm in diameter and often coalesced to cover >90% of older leaves. Whole plants of the mustard greens cv. Florida Broadleaf were collected in 2011 from the symptomatic field. Leaves were surface-disinfested with 0.5% NaOCl for 5 min, rinsed twice in sterilized distilled water [(sd)H2O], macerated in sdH2O, then streaked onto nutrient agar (NA), pseudomonas agar F (PAF), and potato dextrose agar (PDA). Little or no bacterial growth was observed on PDA, while on NA and PAF the majority of bacterial growth appeared to be a single colony type. All strains collected (25 total, one per plant) were gram-negative and fluoresced blue-green under UV light after 48 h at 28°C on PAF. All 25 strains were identified as belonging to Pseudomonas group 1a using Lelliot's determinative assay (2). Ten of the 25 strains were tested for pathogenicity on Florida Broadleaf, and turnip greens cv. Alamo. Bacteria were grown on PAF for 48 h, and a bacterial suspension was prepared and adjusted to an optical density of 0.1 at 600 nm. Three-week-old plants (three plants per cultivar) were sprayed with the appropriate bacterial suspension to runoff, placed at 100% relative humidity for 48 h, and then put in a growth chamber at 28°C with a 16-h diurnal light cycle for 14 days. Additionally, three plants each of Florida Broadleaf and Alamo were either sprayed with H2O or inoculated with Pseudomonas cannabina pv. alisalensis (Pca) pathotype strain BS91 (1). All 10 strains, as well as the Pca pathotype strain, were pathogenic on both cultivars and caused symptoms similar to those observed in the field. Symptoms were not observed on H2O-sprayed plants. Comparative rep-PCR analysis using the BOXA1R primer showed the 10 strains had identical DNA-banding profiles and were identical to that of Pca BS91 (5). Five strains tested using a Pca-specific, 'light-tagged' reporter bacteriophage gave a strong positive reaction, while a negative control strain, P. syringae pv. maculicola, gave no signal (3). From these tests, the isolated bacteria were determined to be Pca. Bacteria re-isolated on PAF from the inoculated Florida Broadleaf plants had identical rep-PCR profiles with those of the strains used for inoculations. Over the past 10 years, Pca has been found in numerous states in the United States, as well as in Europe, Australia, and Japan (4). As brassica leafy greens production expands to new fields and new states, leaf blight caused by Pca appears to become a problem rapidly. Since resistant cultivars and highly effective bactericides are lacking, growers are extremely concerned about the rapid spread of this disease into existing and new brassica leafy greens regions. References: (1) N. A. Cintas et al. Plant Dis. 86:992, 2002. (2) R. Lelliott. J. Appl. Bacteriol. 29:470, 1066. (3) D. Schofield et al. Appl. Environ. Microbiol. 78:3592, 2012. (4) F. Takahashi et al. J. Gen. Plant Pathol. 79:260, 2013. (5) J. Versalovic et al. Methods Mol. Cell Biol 5:25, 1994.

Development and Field Evaluation of Multiple Virus-Resistant Bottle Gourd (Lagenaria siceraria).

In an effort to develop bottle gourd (Lagenaria siceraria) as a widely adapted rootstock for watermelon grafting, we sought to identify lines with broad resistance to several cucurbit viruses that are economically important in the United States. Preliminary analysis under greenhouse conditions indicated that the currently available commercial watermelon rootstocks were either highly susceptible or somewhat tolerant to one or more viruses. However, in greenhouse screening, several breeding lines of bottle gourd displayed broad-spectrum resistance to four viruses tested, including Zucchini yellow mosaic virus, Watermelon mosaic virus (WMV), Papaya ringspot virus watermelon strain (PRSV-W), and Squash vein yellowing virus. Resistance to PRSV-W and WMV was confirmed through field trials in two consecutive years at two different locations in South Carolina. Two breeding lines (USVL#1-8 and USVL#5-5) with broad-spectrum virus resistance could be useful materials for watermelon rootstock development.

Expression of Bacterial Blight Resistance in Brassica Leafy Greens Under Field Conditions and Inheritance of Resistance in a Brassica juncea Source.

Brassica leafy greens are one of the most economically important vegetable commodity groups grown in the southeastern United States, and more than 28,000 metric tons of these crops are harvested in the United States annually. Collard and kale (Brassica oleracea Acephala group), mustard green (B. juncea), and turnip green (B. rapa) are the most commonly planted members of the brassica leafy greens group. In the last 10 years, numerous occurrences of bacterial blight on these leafy vegetables have been reported in several states. One of the pathogens responsible for this blight is designated Pseudomonas cannabina pv. alisalensis. Two B. rapa (G30710 and G30499) and two B. juncea (PI418956 and G30988) plant introductions (PIs) that exhibited moderate to high levels of resistance to this pathogen in greenhouse studies were tested for field resistance in comparison with eight commercial cultivar representatives of turnip green, mustard green, collard, and kale. The two B. juncea PIs and one of the B. rapa PIs (G30499) were found to have significantly less disease than all tested cultivars except 'Southern Curled Giant' mustard green (B. juncea) and 'Blue Knight' kale (B. oleracea). Inheritance of resistance studies performed with populations derived from the resistant G30988 and two susceptible PIs provided some evidence that resistance may be controlled by a single recessive gene.

First Report of Bacterial Leaf Blight on Broccoli and Cabbage Caused by Pseudomonas syringae pv. alisalensis in South Carolina.

In May of 2009, leaf spot and leaf blight symptoms were observed on broccoli (Brassica oleracea var. italica) and cabbage (B. oleracea var. capitata) on several farms in Lexington County, the major brassica-growing region of South Carolina. Affected areas ranged from scattered disease foci within fields to entire fields. Initial infection symptoms on leaves of both crops included circular and irregular-shaped necrotic lesions that were 3 to 10 mm in diameter, often with yellow halos and water soaking. As the disease progressed, the lesions tended to coalesce into a general blight of the entire leaf. Diseased leaves from both broccoli and cabbage were collected from each of four fields at different locations in the county. Leaves were surface disinfested, macerated in sterile distilled water, then aliquots of the suspension were spread on King's medium B (KB) agar. All samples produced large numbers of bacterial colonies that fluoresced blue under UV light after 24 h of growth. In total, 23 isolates (13 from broccoli and 10 from cabbage) were collected. These isolates were gram negative, levan production positive, oxidase negative, pectolytic activity negative, arginine dihydrolase negative, and produced a hypersensitive response on tobacco, thus placing them in the Pseudomonas syringae LOPAT group (2). Two broccoli and two cabbage isolates were selected at random and tested for pathogenicity to cabbage cv. Early Jersey Wakefield, broccoli cv. Decicco, turnip cv. Topper, broccoli raab cv. Spring, collard cv. Hi-Crop, and oat cv. Montezuma in greenhouse tests. Bacteria were grown on KB agar for 24 h and a bacterial suspension was prepared and adjusted to an optical density of 0.1 at 600 nm. Three-week-old plants were spray inoculated to runoff and held at 100% relative humidity for 12 h after inoculation, prior to return to the greenhouse bench (4). P. syringae pv. maculicola strain F18 (4) and the pathotype strain of P. syringae pv. alisalensis BS91 were included as controls, along with a water-inoculated negative control. Plants were evaluated at 14 days postinoculation. The four unknown bacterial isolates and BS91 were pathogenic on all brassica plants tested, as well as on oat. In contrast, the P. syringae pv. maculicola strain F18 was not pathogenic on broccoli raab or oat. Symptoms produced by all isolates and strains tested were similar to those observed in the field. No symptoms were observed on water-inoculated plants. Comparative repetitive sequence-based (rep)-PCR DNA analysis using the BOXA1R primer (3) resulted in a DNA banding pattern of each of the isolates from the South Carolina fields (23 isolates), as well as those reisolated from inoculated plants, that was identical to P. syringae pv. alisalensis BS91 and differed from the P. syringae pv. maculicola F18 strain. On the basis of the rep-PCR assays and the differential host range (1), the current disease outbreak on broccoli and cabbage in South Carolina is caused by the bacterium P. syringae pv. alisalensis. Broccoli is a relatively new, albeit rapidly expanding, production vegetable in South Carolina; this disease may represent a limiting factor to future production. References: (1) N. A. Cintas et al. Plant Dis. 86:992, 2002. (2) R. A. Lelliott et al. J. Appl. Bacteriol. 29:470, 1966. (3) J. Versalovic et al. Methods Mol. Cell. Biol. 5:25, 1994. (4) Y. F. Zhao et al. Plant Dis. 84:1015, 2000.

Simultaneous detection of Acidovorax avenae subsp. citrulli and Didymella bryoniae in cucurbit seedlots using magnetic capture hybridization and real-time polymerase chain reaction.

To improve the simultaneous detection of two pathogens in cucurbit seed, a combination of magnetic capture hybridization (MCH) and multiplex real-time polymerase chain reaction (PCR) was developed. Single-stranded DNA hybridization capture probes targeting DNA of Acidovorax avenae subsp. citrulli, causal agent of bacterial fruit blotch, and Didymella bryoniae, causal agent of gummy stem blight, were covalently attached to magnetic particles and used to selectively concentrate template DNA from cucurbit seed samples. Sequestered template DNAs were subsequently amplified by multiplex real-time PCR using pathogen-specific TaqMan PCR assays. The MCH multiplex real-time PCR assay displayed a detection threshold of A. avenae subsp. citrulli at 10 CFU/ml and D. bryoniae at 10(5) conidia/ml in mixtures of pure cultures of the two pathogens, which was 10-fold more sensitive than the direct real-time PCR assays for the two pathogens separately. Although the direct real-time PCR assay displayed a detection threshold for A. avenae subsp. citrulli DNA of 100 fg/microl in 25% (1/4 samples) of the samples assayed, MCH real-time PCR demonstrated 100% detection frequency (4/4 samples) at the same DNA concentration. MCH did not improve detection sensitivity for D. bryoniae relative to direct real-time PCR using conidial suspensions or seed washes from D. bryoniae-infested cucurbit seed. However, MCH real-time PCR facilitated detection of both target pathogens in watermelon and melon seed samples (n = 5,000 seeds/sample) in which 0.02% of the seed were infested with A. avenae subsp. citrulli and 0.02% were infested with D. bryoniae.

First Report of Severe Outbreaks of Bacterial Leaf Spot of Leafy Brassica Greens Caused by Xanthomonas campestris pv. campestris in South Carolina.

Severe outbreaks of leaf spot disease of leafy vegetable brassica crops have occurred from early spring to late fall for at least the past 7 years in Lexington County, South Carolina, the major growing region for leafy greens in the state. Significant economic losses to this disease totaling $1.7 million have been incurred by large and small growers. In 2005, Pseudomonas syringae pv. maculicola was reported as one of the causal organisms of leaf spot disease in South Carolina (2). Investigations during 2006 and 2007 have led to the isolation of another bacterium causing leaf spotting of brassica crops. Symptoms in the field were nearly identical to symptoms caused by P syringae pv. maculicola, i.e., small, brown necrotic spots, often with chlorotic halos that expand and coalesce to cover the leaves. Colonies recovered from diseased tissues were xanthomonad like, nonfluorescent on Pseudomonas Agar F, mucoid on yeast extract dextrose chalk medium, grew at 35°C, hydrolyzed starch, positive for protein digestion, alkaline in litmus milk, and produce acid from arabinose. Sequence data from the 16S rDNA and fatty acid methyl ester analysis gave the best homology to Xanthomonas campestris pv. campestris with a similarity score index of >0.98 and >0.70, respectively, confirming genus and species. Excised-cotyledon assays, used to differentiate between pathovars campestris and armoraciae, confirmed the pathovar as campestris (1). Pathogenicity assays with spray inoculations (1 × 107 CFU/ml) (3) on eight plants each of 'Topper' and 'Alamo' turnip, 'Early Jersey Wakefield' cabbage, and 'Money maker' tomato produced leaf-spot symptoms within 10 days in the greenhouse and growth chamber on the turnip and cabbage plants, but not the tomato. X. campestris pv. campestris, which is common throughout the world, also is the causal agent of black rot in brassica. Typical black rot symptoms are seen often in Lexington County fields in summer and are quite different from the leaf spot symptoms observed. Leaf-spotting X. campestris pv. campestris (LS) strains and black rot (BR) strains, recovered from black rot-symptomatic plants lacking leaf spots, from the same fields were compared in greenhouse pathogenicity assays on six plants each of 'Topper' turnip and 'Early Jersey Wakefield' cabbage. Spray inoculations with 20 individual LS strains and 10 individual BR strains, collected from 2005 to 2007, produced symptoms unique to each group. These symptoms included chlorotic 'V'-shaped lesions initiating from the leaf margins with black veining when plants were inoculated with BR strains, versus rapid and severe leaf spotting followed by chlorotic 'V'-shaped lesions typically lacking black-veining 10 to 16 days postinoculation associated with LS strains. Additional inoculation tests gave similar results. To our knowledge, this is the first report of a severe leaf spotting disease of field-grown brassica leafy greens caused by X. campestris pv. campestris in South Carolina. These findings may have importance in differentiation of bacterial leaf spot pathogens in brassica crops. References: (1) A. M. Alvarez et al. Phytopathology 84:1449, 1994. (2) A. P. Keinath et al. Plant Dis. 90:683, 2006. (3) W. P. Wechter et al. Hortic Sci. 42:1140, 2007.

First Report of Southern Blight on Bottle Gourd (Lagenaria siceraria) Caused by Sclerotium rolfsii in South Carolina.

Bottle gourd (Lagenaria siceraria (Mol.) Standl.) is an important rootstock in watermelon production in several countries such as Japan, China, and Israel where 60 to 70% of watermelons are grafted (2). We are evaluating bottle gourds for their ability to improve disease resistance when used as rootstock for watermelon (3). In the summer of 2007, symptoms of wilting and crown necrosis appeared on bottle gourd seedlings 1 month after transplanting in a field in Charleston, SC. Infection was observed on commercial cv. Emphasis and four advanced breeding lines. In October of 2007, 35 of 85 plants examined (41%) had stem rot at the crown area just above the soil line where coarse, white mycelia and abundant sclerotia were observed. The fungus tentatively identified as Sclerotium rolfsii produced sclerotia that were white or light to dark brown and measured 0.6 to 2.5 mm in diameter (mean = 1.1 mm). Diseased tissues with sclerotia from four plants were disinfested for 1 min in 0.5% sodium hypochlorite and plated on acidified potato dextrose agar (APDA). Fungal colonies that produced white mycelia and tan-to-brown sclerotia were isolated from four wilted plants. A single PCR product of approximately 680 bp was amplified from DNA extracted from two isolates using the primers ITS1 and ITS4 (4). One PCR product was cloned into the TOPO TA cloning vector (Invitrogen, Carlsbad, CA) and sequenced (GenBank Accession No. EU338381). BLASTN analysis of the sequence in the NCBI databases revealed 99% similarity to the internal transcribed spacer (ITS) sequences of S. rolfsii and Athelia rolfsii (perfect stage of S. rolfsii), confirming that the pathogen was indeed S. rolfsii. Two S. rolfsii isolates were used to test pathogenicity. Each isolate was used to inoculate five young seedlings and five adult (10-week-old) bottle gourd plants. For inoculation, 10 sclerotia obtained from the APDA plates were placed on the surface of the potting soil 0.5 to 1 cm from the collar region of each bottle gourd plant growing in 10-cm pots. Inoculations were done carefully to ensure that the plants were not injured. After inoculation, the plants were maintained at high humidity and 25°C for 3 days and then transferred to laboratory benches. Four young seedlings and three adult noninoculated plants kept under the same conditions served as controls. The pathogenicity test was repeated once with similar results. All inoculated plants developed symptoms of southern blight. The inoculated plants developed symptoms of wilting 4 to 5 days after inoculation and completely wilted within 7 to 10 days. Symptoms of wilting were soon followed by the appearance of white-to-light brown sclerotia on the collar region. No symptoms were observed on the noninoculated plants. S. rolfsii was reisolated from the inoculated plants on APDA. Although southern blight caused by S. rolfsii has been reported on many crop plants in the southern United States, to our knowledge, this disease has not been reported previously on bottle gourd in North America. However, the disease has been reported on bottle gourd in India (1). Identifying sources of resistance to southern blight in bottle gourds may be necessary to make them suitable as rootstocks in areas where S. rolfsii is present. References: (1) K. S. Amin. Indian Phytopathol. 34:253, 1981. (2) R. Cohen et al. Plant Dis. 91:916, 2007. (3) K. S. Ling and A. Levi. HortScience 42:1124, 2007. (4) T. J. White et al. PCR Protocols: A Guide to Methods and Amplifications. Academic Press, San Diego, 1990.

First Report of Insensitivity to Cyazofamid Among Isolates of Phytophthora capsici from the Southeastern United States.

Phytophthora capsici is rapidly becoming an important limiting factor in vegetable production in the southeastern United States, particularly on cucurbits as fruit rots. One of the strategies used to manage diseases caused by P. capsici is the regular application of fungicides. Recently the new fungicide cyazofamid (trade name Ranman, FRAC Group 21, FMC Corporation, EPA Reg. No. 71512-3-279) was registered for management of P. capsici on cucurbits. Cyazofamid has been reported to be very effective against P. capsici on peppers (1). In a recent evaluation, we observed that cyazofamid was not very effective on fruit rot of watermelon in a field artificially infested with P. capsici (3). Hence, we evaluated our collection of isolates for sensitivity to cyazofamid. We confirmed our isolates as P. capsici based on morphology of colonies and sporangia and amplification of internal transcribed spacer regions using specific PCR primers (4). Mycelial growth of 28 isolates from the southeastern United States including North (NC) and South Carolina (SC), Georgia (GA), and Florida (FL) was evaluated on Ranman amended (0, 25, 100, 310, 518, and 1,000 mg/liter of the active ingredient cyazofamid) V8 juice agar using similar techniques as described before (2). The EC50 (50% effective concentration) values ranged from 3.8 to 535 mg/liter. Thirteen isolates (8 GA, 3 SC, 1 NC, and 1 FL) had EC50 >100 mg/liter. Similar results were obtained when technical grade cyazofamid was used. The same 28 isolates were evaluated on media amended with technical grade cyazofamid (0, 1, 10, and 100 mg/liter) and 100 mg/liter of salicylhydroxaymic acid, which was added to inhibit the alternative oxidase enzyme. The EC50 values ranged from <1 to >100 mg/liter. Six isolates (5 GA and 1 NC) had EC50 >100 mg/liter. Three isolates, one sensitive and two insensitive, were used to inoculate cucumber (Cucumis sativus) fruits treated with commercial Ranman at 0, 10, 100, 300, and 1,000 mg/liter of cyazofamid plus the surfactant Silwett L-77 (0.52 ml/liter). Mycelial plugs (7-mm diameter) were placed on nonwounded fruits. Fruits were kept under high humidity at 25 ± 1°C in an incubator for 3 days. Two measurements of each lesion at right angles were averaged to get the lesion diameter. The EC50 value for lesion diameter on fruits varied from 13 mg/liter for the sensitive isolate to >233 mg/liter for the insensitive isolates. EC50 values for diameter of the lesion with sporulation ranged from 3 to 107 mg/liter. Relative lesion diameters of the insensitive isolates at 100 mg/liter treatment compared with nonsprayed check were 70 to 93%, and at 300 mg/liter, it was 38 to 80%. Similarly in another experiment, watermelon (Citrullus lanatus var. lanatus) fruits were sprayed with a recommended field rate of Ranman (284 mg of cyazofamid/liter) plus Silwett L-77 (0.52 ml/liter) till runoff and inoculated with four isolates. The relative lesion diameter for insensitive isolates on Ranman treated watermelon fruits were 76 to 100% of nonsprayed fruits. To our knowledge, these insensitive isolates were collected from fields that were never sprayed with Ranman. Because of the existence of cyazofamid insensitive P. capsici isolates, it should be rotated with fungicides from other chemical classes to prevent extensive selection of insensitive isolates. References: (1) K. L. Ivors et al. Plant Dis. Manage. Rep. 1:V088, 2007. (2) A. P. Keinath. Plant Dis. 91:743, 2007. (3) C. S. Kousik and R. Hassell. Plant Dis. Manage. Rep. 1:V010, 2007. (4) J. B. Ristaino et al. Appl. Environ. Microbiol. 64:948, 1998.

First Report of Bacterial Leaf Spot on Leafy Brassica Greens Caused by Pseudomonas syringae pv. maculicola in South Carolina.

As of 2001, South Carolina ranked second in the United States in acreage of turnip greens (Brassica rapa) and collard (B. oleracea) and third in acreage of mustard (B. juncea). In June 2001, a leaf disease was found on turnip greens (cv. Alamo), mustard (cvs. Southern Giant Curled and Florida Broadleaf), and rape salad greens (B. napus var. napus cv. Essex) on a commercial farm in Lexington County, South Carolina. Symptoms appeared after a heavy rainstorm that included blowing sand. The disease was found in May and June 2002 on three additional farms in the same county on turnip greens cv. Topper and Royal Crown and collard cv. Top Bunch. Symptoms included small tan spots, water soaking, yellowing, and brown necrosis of leaves after spots coalesced on the lower halves of plants. Yellowing was more prevalent on older than on younger leaves. Leaf samples were collected in 2001 and 2002 from the affected hosts on the four farms. Bacterial streaming was evident from these samples and 27 strains were isolated on nutrient agar or King's medium B (KMB). All strains were gram negative and fluoresced bluegreen or yellow under UV light after 48-h growth at 28°C on Pseudomonas agar F (PAF). On the basis of LOPAT tests, the strains were identified as P. syringae (2). All 27 strains were tested for pathogenicity to rape salad greens cv. Essex and then to turnip greens cv. Topper. Plants were grown in peat-vermiculite potting mix in 10-cm-diameter pots in a greenhouse. P. syringae pv. maculicola F41, isolated from turnip in Oklahoma, and P. syringae pv. tomato F33, isolated from tomato in Oklahoma, were included as positive and negative controls along with a noninoculated control. Bacteria were grown on KMB for 48 h at 24°C, and bacterial suspensions were prepared and adjusted to 0.1 optical density at 600 nm. Three-week-old plants were held at 95 to 100% relative humidity (RH) for 48 h before they were sprayed just to runoff with inoculum and then held at 95 to 100% RH for 48 h after inoculation (4). After an additional 5 to 8 days in a greenhouse, nine strains and F41 caused symptoms on both Topper and Essex similar to symptoms observed in the field. No symptoms were observed on noninoculated plants or plants inoculated with F33. On the basis of repetitive sequence-based polymerase chain reactions with the BOXA1R primer, the DNA fingerprint of each of the nine pathogenic strains from South Carolina was nearly identical to that of F41. Bacteria isolated from inoculated, symptomatic turnip leaves had identical LOPAT and BOXA1R profiles to the corresponding original strains. Pathogenic strains had bluegreen fluorescence on PAF, whereas nonpathogenic strains fluoresced yellow. Five pathogenic strains, as well as F41, were further identified to species and pathovar with fatty acid methyl ester profiles as P. syringae pv. maculicola. To our knowledge, this is the first report of P. syringae pv. maculicola from South Carolina. Over the past 10 years, P. syringae pv. maculicola has been found in Oklahoma (4), California (1), and Ohio (3). Bacterial leaf spot has occurred yearly in South Carolina since the initial outbreaks. Currently, it is the disease that causes the greatest yield losses of leafy brassica greens in the state. References: (1) N. A. Cintas et al. Plant Dis. 85:1207, 2001. (2) R. A. Lelliott et al. J. Appl. Bacteriol. 29:470, 1966. (3) M. L. Lewis Ivey et al. Plant Dis. 86:186, 2002. (4) Y. F. Zhao et al. Plant Dis. 84:1015, 2000.

First Report of Tomato yellow leaf curl virus in South Carolina.

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5'GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5'GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of "across-state" distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

First Report of White Rust Caused by Albugo bliti on Seabeach Amaranth in the United States.

Seabeach amaranth (Amaranthus pumilus Raf.), a threatened annual marine plant, is a primary colonizer of the windward side of Atlantic coastal dunes. It serves an important ecological role in dune accumulation and stabilization. Because Hurricane Floyd eliminated all native seabeach amaranth in South Carolina in 1999, experimental reestablishment plantings have been attempted. In August 2000, seabeach amaranth on Dewees and Cape Island in Charleston County, Huntington Beach in Georgetown County, and Otter Island in Colleton County, South Carolina were stunted and senesced prematurely. Leaves on affected plants were only one-half of the normal size and internodes were shortened. Most plants (>90%) at each location were affected. Diseased leaves had small, pale green-to-tan spots above hypophyllous pustules that contained numerous, dry, hyaline, subglobose conidia. Conidia measured 13.5 (10 to 17) × 15.0 (11 to 18) µm. Based on morphological characters and the host, the pathogen was identified as Albugo bliti (Biv.-Bern.) Kuntze (1,2). No oospores were observed. Diseased plants were collected from Dewees and Otter Islands and kept frozen for use as a source of inoculum. Six A. pumilus plants each of six Plant Introductions (PI), 553080 through 553085, that had been grown from seed were sprayed with a suspension of 4.7 × 105 conidia per ml. One plant of each PI was sprayed with sterile distilled water as a noninoculated control. All plants were placed in a humidity chamber for 48 h and then moved to a greenhouse bench. Thirteen days after inoculation, all inoculated plants had pustules of white rust. Diseased plants had a mean of 42 pustules per plant and PI's did not differ in susceptibility. Five of six noninoculated plants also had white rust pustules, but only a mean of 2.3 (range 1 to 5) pustules each. White rust likely appeared on noninoculated plants because plants were spaced closely together in the chamber. Pustules and conidia on inoculated plants were identical to those on plants collected originally. Albugo bliti has been reported on 19 other Amaranthus species (1), but to our knowledge, this is the first report of white rust on seabeach amaranth in the United States. White rust reduced the biomass of infected plants and, hence, their ability to trap sand. White rust was not observed on subsequent plantings in 2001 and 2002 at any location. References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory, On-line publication. ARS USDA, 2002. (2) G. W. Wilson. Bull. Torrey Bot. Club 34:61, 1907.

Development of PCR-ELISA for Detection and Differentiation of Didymella bryoniae from Related Phoma species.

The causal agent of gummy stem blight, Didymella bryoniae, often is isolated from infected cucurbits together with other Phoma spp. Polymerase chain reaction (PCR) primers specific to D. bryoniae and Phoma were used to develop and evaluate a microtiter-based PCR-enzyme-linked immunosorbent assay (ELISA) technique. Primers were modified by addition of a fluorescein and a biotin label to the 5' ends of the forward and reverse primers, respectively. After amplification, PCR products were detected in an ELISA using horseradish peroxidase-conjugated antifluorescein antibody and three substrates that yielded three colored products, one for each fungal group. The most sensitive substrate (highest signal:noise ratio) was 2,2' -azino-bis[3-ethylbenz-thiazoline-6-sulfonic acid]. PCR-ELISA successfully detected 45 of 46 D. bryoniae and all 13 Phoma isolates that were used. Results were comparable to those obtained with gel electrophoresis. Only one D. bryoniae isolate could not be detected with PCR-ELISA; this isolate also produced a fragment larger than other D. bryoniae isolates on agarose gels. PCR-ELISA was used successfully on crude extracts of "blind" fungal samples and identified seven of seven isolates as D. bryoniae or Phoma. Although less sensitive than gel electrophoresis, PCR-ELISA was a highly specific, yet simple, rapid and convenient assay for detection of D. bryoniae and Phoma sp.

Viability and stability of biological control agents on cotton and snap bean seeds.

Cotton and snap bean were selected for a multi-year, multi-state regional (south-eastern USA) research project to evaluate the efficacy of both commercial and experimental bacterial and fungal biological control agents for the management of damping-off diseases. The goal for this portion of the project was to determine the viability and stability of biological agents after application to seed. The biological seed treatments used included: (1) Bacillaceae bacteria, (2) non-Bacillaceae bacteria, (3) the fungus Trichoderma and (4) the fungus Beauveria bassiana. Seed assays were conducted to evaluate the following application factors: short-term (< or = 3 months) stability after seed treatment; quality (i.e. isolate purity); compatibility with chemical pesticides and other biocontrol agents; application uniformity between years and plant species. For the bacterial treatments, the Bacillaceae genera (Bacillus and Paenibacillus) maintained the greatest population of bacteria per seed, the best viability over time and the best application uniformity across years and seed type. The non-Bacillaceae genera Burkholderia and Pseudomonas had the least viability and uniformity. Although Beauveria bassiana was only evaluated one year, the seed fungal populations were high and uniform. The seed fungal populations and uniformity for the Trichoderma isolates were more variable, except for the commercial product T-22. However, this product was contaminated with a Streptomyces isolate in both the years that it was evaluated. The study demonstrated that Bacillaceae can be mixed with Trichoderma isolates or with numerous pesticides to provide an integrated pest control/growth enhancement package.

First Report of Southern Blight Caused by Sclerotium rolfsii on St.-John's-Wort.

Interest in commercial production of common St.-John's-wort (Hypericum perforatum L.), an herb that is dried, processed, and used as an anti-depressant medication, is increasing. In August 1998, St.-John's-wort growing in the field at Charleston, SC, showed blight symptoms. Leaves on prostrate branches turned reddish-yellow, then brown, and then abscised. As the disease progressed, branches and approximately 10% of the plants were killed. Coarse, white mycelia were present on the bases of dead branches. Segments cut from symptomatic branches were disinfested in 0.5% sodium hypochlorite and placed on potato dextrose agar (PDA) at 25°C. Sclerotium rolfsii Sacc. was isolated from one of 12 branches with discolored leaves and six of six dead branches. For pathogenicity tests, sclerotia were harvested from 6-week-old cultures on PDA. Ten-week-old St.-John's-wort plants, growing in potting mix in 10-cm pots, were inoculated by placing four sclerotia on the soil surface 1 to 1.5 cm from the main stem of each plant. Plants were grown in a greenhouse at 90% relative humidity and 25 to 35°C. Single blighted branches were observed on three plants 12 days after inoculation and all plants were blighted 28 days after inoculation. S. rolfsii was recovered from 10 and 9 of 10 plants inoculated with isolates of S. rolfsii from St.-John's-wort and tomato, respectively. All 10 noninoculated plants remained symptomless. The pathogenicity test was repeated and the results were similar. This is the first report of S. rolfsii causing Southern blight on St.-John's-wort in the United States.