Telomeric retrotransposons show propensity to form G-quadruplexes in various eukaryotic species.

BACKGROUND: Canonical telomeres (telomerase-synthetised) are readily forming G-quadruplexes (G4) on the G-rich strand. However, there are examples of non-canonical telomeres among eukaryotes where telomeric tandem repeats are invaded by specific retrotransposons. Drosophila melanogaster represents an extreme example with telomeres composed solely by three retrotransposons-Het-A, TAHRE and TART (HTT). Even though non-canonical telomeres often show strand biased G-distribution, the evidence for the G4-forming potential is limited. RESULTS: Using circular dichroism spectroscopy and UV absorption melting assay we have verified in vitro G4-formation in the HTT elements of D. melanogaster. Namely 3 in Het-A, 8 in TART and 2 in TAHRE. All the G4s are asymmetrically distributed as in canonical telomeres. Bioinformatic analysis showed that asymmetric distribution of potential quadruplex sequences (PQS) is common in telomeric retrotransposons in other Drosophila species. Most of the PQS are located in the gag gene where PQS density correlates with higher DNA sequence conservation and codon selection favoring G4-forming potential. The importance of G4s in non-canonical telomeres is further supported by analysis of telomere-associated retrotransposons from various eukaryotic species including green algae, Diplomonadida, fungi, insects and vertebrates. Virtually all analyzed telomere-associated retrotransposons contained PQS, frequently with asymmetric strand distribution. Comparison with non-telomeric elements showed independent selection of PQS-rich elements from four distinct LINE clades. CONCLUSION: Our findings of strand-biased G4-forming motifs in telomere-associated retrotransposons from various eukaryotic species support the G4-formation as one of the prerequisites for the recruitment of specific retrotransposons to chromosome ends and call for further experimental studies.

Variation in G-quadruplex sequence and topology differentially impacts human DNA polymerase fidelity.

G-quadruplexes (G4s), a type of non-B DNA, play important roles in a wide range of molecular processes, including replication, transcription, and translation. Genome integrity relies on efficient and accurate DNA synthesis, and is compromised by various stressors, to which non-B DNA structures such as G4s can be particularly vulnerable. However, the impact of G4 structures on DNA polymerase fidelity is largely unknown. Using an in vitro forward mutation assay, we investigated the fidelity of human DNA polymerases delta (δ4, four-subunit), eta (η), and kappa (κ) during synthesis of G4 motifs representing those in the human genome. The motifs differ in sequence, topology, and stability, features that may affect DNA polymerase errors. Polymerase error rate hierarchy (δ4 < κ < Î·) is largely maintained during G4 synthesis. Importantly, we observed unique polymerase error signatures during synthesis of VEGF G4 motifs, stable G4s which form parallel topologies. These statistically significant errors occurred within, immediately flanking, and encompassing the G4 motif. For pol δ4, the errors were deletions, insertions and complex errors within the G4 or encompassing the G4 motif and surrounding sequence. For pol η, the errors occurred in 3' sequences flanking the G4 motif. For pol κ, the errors were frameshift mutations within G-tracts of the G4. Because these error signatures were not observed during synthesis of an antiparallel G4 and, to a lesser extent, a hybrid G4, we suggest that G4 topology and/or stability could influence polymerase fidelity. Using in silico analyses, we show that most polymerase errors are predicted to have minimal effects on predicted G4 stability. Our results provide a unique view of G4s not previously elucidated, showing that G4 motif heterogeneity differentially influences polymerase fidelity within the motif and flanking sequences. Thus, our study advances the understanding of how DNA polymerase errors contribute to G4 mutagenesis.

Revealing structural peculiarities of homopurine GA repetition stuck by i-motif clip.

Non-canonical forms of nucleic acids represent challenging objects for both structure-determination and investigation of their potential role in living systems. In this work, we uncover a structure adopted by GA repetition locked in a parallel homoduplex by an i-motif. A series of DNA oligonucleotides comprising GAGA segment and C3 clip is analyzed by NMR and CD spectroscopies to understand the sequence-structure-stability relationships. We demonstrate how the relative position of the homopurine GAGA segment and the C3 clip as well as single-base mutations (guanine deamination and cytosine methylation) affect base pairing arrangement of purines, i-motif topology and overall stability. We focus on oligonucleotides C3GAGA and methylated GAGAC3 exhibiting the highest stability and structural uniformity which allowed determination of high-resolution structures further analyzed by unbiased molecular dynamics simulation. We describe sequence-specific supramolecular interactions on the junction between homoduplex and i-motif blocks that contribute to the overall stability of the structures. The results show that the distinct structural motifs can not only coexist in the tight neighborhood within the same molecule but even mutually support their formation. Our findings are expected to have general validity and could serve as guides in future structure and stability investigations of nucleic acids.

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly.

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

Quadruplex-Forming Motif Inserted into 3'UTR of Ty1his3-AI Retrotransposon Inhibits Retrotransposition in Yeast.

Guanine quadruplexes (G4s) serve as regulators of replication, recombination and gene expression. G4 motifs have been recently identified in LTR retrotransposons, but their role in the retrotransposon life-cycle is yet to be understood. Therefore, we inserted G4s into the 3'UTR of Ty1his3-AI retrotransposon and measured the frequency of retrotransposition in yeast strains BY4741, Y00509 (without Pif1 helicase) and with G4-stabilization by N-methyl mesoporphyrin IX (NMM) treatment. We evaluated the impact of G4s on mRNA levels by RT-qPCR and products of reverse transcription by Southern blot analysis. We found that the presence of G4 inhibited Ty1his3-AI retrotransposition. The effect was stronger when G4s were on a transcription template strand which leads to reverse transcription interruption. Both NMM and Pif1p deficiency reduced the retrotransposition irrespective of the presence of a G4 motif in the Ty1his3-AI element. Quantity of mRNA and products of reverse transcription did not fully explain the impact of G4s on Ty1his3-AI retrotransposition indicating that G4s probably affect some other steps of the retrotransposon life-cycle (e.g., translation, VLP formation, integration). Our results suggest that G4 DNA conformation can tune the activity of mobile genetic elements that in turn contribute to shaping the eukaryotic genomes.

Guanine Substitutions Prevent Conformational Switch from Antiparallel to Parallel G-Quadruplex.

Guanine quadruplexes, recently reported to form in vivo, represent a broad spectrum of non-canonical conformations of nucleic acids. The actual conformation might differ between water solutions and crowding or dehydrating solutions that better reflect the conditions in the cell. Here we show, using spectroscopic techniques, that most guanine substitutions prevent the conformational switch from antiparallel or hybrid forms to parallel ones when induced by dehydrating agents. The inhibitory effect does not depend on the position of the substitution, but, interestingly, on the type of substitution and, to some extent, on its destabilising potential. A parallel form might be induced in some cases by ligands such as N-methyl mesoporphyrin IX and even this ligand-induced switch is inhibited by guanine substitution. The ability or inability to have a conformation switch, based on actual conditions, might significantly influence potential conformation-dependent quadruplex interactions.

CD Study of the G-Quadruplex Conformation.

Circular Dichroic (CD) spectroscopy is one of the most frequently used methods for guanine quadruplex studies and in general for studies of conformational properties of nucleic acids. The reason is its high sensitivity to even slight changes in mutual orientation of absorbing bases of DNA. CD can reveal formation of particular structural DNA arrangements and can be used to search for the conditions stabilizing the structures, to follow the transitions between various structural states, to explore kinetics of their appearance, to determine thermodynamic parameters, and also to detect formation of higher order structures. CD spectroscopy is an important complementary technique to NMR spectroscopy and X-ray diffraction in quadruplex studies due to its sensitivity, easy manipulation of studied samples, and relative inexpensiveness. In this part, we present the protocol for the use of CD spectroscopy in the study of guanine quadruplexes, together with practical advice and cautions about various, particularly interpretation, difficulties.

Systematic investigation of sequence requirements for DNA i-motif formation.

The formation of intercalated motifs (iMs) - secondary DNA structures based on hemiprotonated C.C+ pairs in suitable cytosine-rich DNA sequences, is reflected by typical changes in CD and UV absorption spectra. By means of spectroscopic methods, electrophoresis, chemical modifications and other procedures, we characterized iM formation and stability in sequences with different cytosine block lengths interrupted by various numbers and types of nucleotides. Particular attention was paid to the formation of iMs at pH conditions close to neutral. We identified the optimal conditions and minimal requirements for iM formation in DNA sequences, and addressed gaps and inaccurate data interpretations in existing studies to specify principles of iM formation and modes of their folding.

Long-read sequencing technology indicates genome-wide effects of non-B DNA on polymerization speed and error rate.

DNA conformation may deviate from the classical B-form in ∼13% of the human genome. Non-B DNA regulates many cellular processes; however, its effects on DNA polymerization speed and accuracy have not been investigated genome-wide. Such an inquiry is critical for understanding neurological diseases and cancer genome instability. Here, we present the first simultaneous examination of DNA polymerization kinetics and errors in the human genome sequenced with Single-Molecule Real-Time (SMRT) technology. We show that polymerization speed differs between non-B and B-DNA: It decelerates at G-quadruplexes and fluctuates periodically at disease-causing tandem repeats. Analyzing polymerization kinetics profiles, we predict and validate experimentally non-B DNA formation for a novel motif. We demonstrate that several non-B motifs affect sequencing errors (e.g., G-quadruplexes increase error rates), and that sequencing errors are positively associated with polymerase slowdown. Finally, we show that highly divergent G4 motifs have pronounced polymerization slowdown and high sequencing error rates, suggesting similar mechanisms for sequencing errors and germline mutations.

i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions.

i-Motif (iM) is a four stranded DNA structure formed by cytosine-rich sequences, which are often present in functionally important parts of the genome such as promoters of genes and telomeres. Using electronic circular dichroism and UV absorption spectroscopies and electrophoretic methods, we examined the effect of four naturally occurring DNA base lesions on the folding and stability of the iM formed by the human telomere DNA sequence (C3TAA)3C3T. The results demonstrate that the TAA loop lesions, the apurinic site and 8-oxoadenine substituting for adenine, and the 5-hydroxymethyluracil substituting for thymine only marginally disturb the formation of iM. The presence of uracil, which is formed by enzymatic or spontaneous deamination of cytosine, shifts iM formation towards substantially more acidic pH values and simultaneously distinctly reduces iM stability. This effect depends on the position of the damage sites in the sequence. The results have enabled us to formulate additional rules for iM formation.

Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes.

Ionizing radiation produces clustered damage to DNA which is difficult to repair and thus more harmful than single lesions. Clustered lesions have only been investigated in dsDNA models. Introducing the term 'clustered damage to G-quadruplexes' we report here on the structural effects of multiple tetrahydrofuranyl abasic sites replacing loop adenines (A/AP) and tetrad guanines (G/AP) in quadruplexes formed by the human telomere d[AG3(TTAG3)3] (htel-22) and d[TAG3(TTAG3)3TT] (htel-25) in K+ solutions. Single to triple A/APs increased the population of parallel strands in their structures by stabilizing propeller type loops, shifting the antiparallel htel-22 into hybrid or parallel quadruplexes. In htel-25, the G/APs inhibited the formation of parallel strands and these adopted antiparallel topologies. Clustered G/AP and A/APs reduced the thermal stability of the wild-type htel-25. Depending on position, A/APs diminished or intensified the damaging effect of the G/APs. Taken together, clustered lesions can disrupt the topology and stability of the htel quadruplexes and restrict their conformational space. These in vitro results suggest that formation of clustered lesions in the chromosome capping structure can result in the unfolding of existing G-quadruplexes which can lead to telomere shortening.

G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression.

The Oct4 gene codes for a transcription factor that plays a critical role in the maintenance of pluripotency in embryonic and cancer stem cells. Its expression thus has to be tightly regulated. We performed biophysical characterization of the promoter region using a combination of UV absorption, CD, and NMR spectroscopies, native PAGE and chemical probing, which was followed by functional studies involving luciferase reporter assays performed in osteosarcoma and human embryonic stem cell lines. We have shown that the evolutionarily conserved G-rich region close to the Oct4 transcription start site in the non-template strand forms a parallel G-quadruplex structure. We characterized its structure and stability upon point mutations in its primary structure. Functional studies then revealed that whereas the wild type quadruplex sequence ensures high reporter gene expression, the expression of mutated variants is significantly decreased proportionally to the destabilizing effect of the mutations on the quadruplex. A ligand, N-methyl mesoporphyrin IX that increases the stability of formed quadruplex rescued the reporter expression of single-mutated variants to the level of wild-type, but it has no effect on a mutated variant that cannot form quadruplex. These data indicate that the quadruplex acts as a strong, positive regulator of Oct4 expression and as such it might serve as a potential target for therapeutic intervention.

Wild-type p53 binds to MYC promoter G-quadruplex.

G-quadruplexes are four-stranded nucleic acid structures that are implicated in the regulation of transcription, translation and replication. Genome regions enriched in putative G-quadruplex motifs include telomeres and gene promoters. Tumour suppressor p53 plays a critical role in regulatory pathways leading to cell cycle arrest, DNA repair and apoptosis. In addition to transcriptional regulation mediated via sequence-specific DNA binding, p53 can selectively bind various non-B DNA structures. In the present study, wild-type p53 (wtp53) binding to G-quadruplex formed by MYC promoter nuclease hypersensitive element (NHE) III1 region was investigated. Wtp53 binding to MYC G-quadruplex is comparable to interaction with specific p53 consensus sequence (p53CON). Apart from the full-length wtp53, its isolated C-terminal region (aa 320-393) as well, is capable of high-affinity MYC G-quadruplex binding, suggesting its critical role in this type of interaction. Moreover, wtp53 binds to MYC promoter region containing putative G-quadruplex motif in two wtp53-expressing cell lines. The results suggest that wtp53 binding to G-quadruplexes can take part in transcriptional regulation of its target genes.

p53 binds human telomeric G-quadruplex in vitro.

The tumor suppressor protein p53 is a key factor in genome stability and one of the most studied of DNA binding proteins. This is the first study on the interaction of wild-type p53 with guanine quadruplexes formed by the human telomere sequence. Using electromobility shift assay and ELISA, we show that p53 binding to telomeric G-quadruplexes increases with the number of telomeric repeats. Further, p53 strongly favors G-quadruplexes folded in potassium over those formed in sodium, thus indicating the telomeric G-quadruplex conformational selectivity of p53. The presence of the quadruplex-stabilizing ligand, N-methyl mesoporphyrin IX (NMM), increases p53 recognition of G-quadruplexes in potassium. Using deletion mutants and selective p53 core domain oxidation, both p53 DNA binding domains are shown to be crucial for telomeric G-quadruplex recognition.

IFI16 Preferentially Binds to DNA with Quadruplex Structure and Enhances DNA Quadruplex Formation.

Interferon-inducible protein 16 (IFI16) is a member of the HIN-200 protein family, containing two HIN domains and one PYRIN domain. IFI16 acts as a sensor of viral and bacterial DNA and is important for innate immune responses. IFI16 binds DNA and binding has been described to be DNA length-dependent, but a preference for supercoiled DNA has also been demonstrated. Here we report a specific preference of IFI16 for binding to quadruplex DNA compared to other DNA structures. IFI16 binds to quadruplex DNA with significantly higher affinity than to the same sequence in double stranded DNA. By circular dichroism (CD) spectroscopy we also demonstrated the ability of IFI16 to stabilize quadruplex structures with quadruplex-forming oligonucleotides derived from human telomere (HTEL) sequences and the MYC promotor. A novel H/D exchange mass spectrometry approach was developed to assess protein interactions with quadruplex DNA. Quadruplex DNA changed the IFI16 deuteration profile in parts of the PYRIN domain (aa 0-80) and in structurally identical parts of both HIN domains (aa 271-302 and aa 586-617) compared to single stranded or double stranded DNAs, supporting the preferential affinity of IFI16 for structured DNA. Our results reveal the importance of quadruplex DNA structure in IFI16 binding and improve our understanding of how IFI16 senses DNA. IFI16 selectivity for quadruplex structure provides a mechanistic framework for IFI16 in immunity and cellular processes including DNA damage responses and cell proliferation.

Diverse effects of naturally occurring base lesions on the structure and stability of the human telomere DNA quadruplex.

Various base lesions continuously form in cellular nucleic acids and the unrepaired lesions are promutagenic and procarcinogenic. Though natural base lesions have been extensively studied in double-stranded DNA models, these studies are only less than a decade old for non-canonical DNA models, such as quadruplexes. Here we present a report on the effects of three frequently occurring natural lesions that can form in the TTA loops on the structure of the human telomere quadruplex d[AG3(TTAG3)3]. We compared the effect of the abasic site and 8-oxoadenine replacing adenine and 5-hydroxymethyluracil substituting for thymine. The results showed that the three lesions impacted the stability and quadruplex folding in markedly different ways. The effects depended on the type of lesion and the position in the sequence. Analogous lesions of guanine in the G-tetrads extensively destabilized the quadruplex and the effects depended more on the position than on the type of lesion. The distinct effects of the loop substitutions as well as comparison of the modifications of the loops and the quadruplex tetrads are discussed in this communication.

G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques.

Electrochemical methods, particularly when applied in connection with mercury-containing electrodes, are excellent tools for studying nucleic acids structure and monitoring structural transitions. We studied the effect of the length of the central (dG) n stretch (varying from 0 to 15 guanine residues) in 15-mer oligodeoxynucleotides (ODN, G0 to G15) on their electrochemical and interfacial behavior at mercury and carbon electrodes. The intensity of guanine oxidation signal at the carbon electrode (peak G(ox)) was observed to increase continuously with number of guanines between 0 and 15, with only a slight positive shift for ODNs with seven or more guanines in the central segment. Very different effects were observed when the peak G(HMDE) was measured at the mercury electrode. Intensity of the latter signal increased with number of guanines up to G5, and decreased sharply with further elongation of the (dG) n stretch. CD spectroscopy and electrophoresis experiments revealed formation of parallel intermolecular quadruplex structures for ODNs containing five or more G residues. Further measurements made by cyclic and alternating-current voltammetry revealed a strong influence of the ODN structure on their behavior at electrically charged surfaces.

Novel biophysical determination of miRNAs related to prostate and head and neck cancers.

In this study we have chosen a new approach and characterized three miRNAs (miR-23a, miR-34a and miR-320a) related to prostate cancer and head and neck cancer by spectral (circular dichroic and UV-absorption spectra) and electrochemical (voltammetry at graphite and mercury electrodes) methods. The spectral and voltammetric results, reflecting different nucleotide sequences of miRNAs, were complemented by the results of DNAs(U) having the same oligonucleotide sequences as miRNAs. The effect of the substitution of ribose for deoxyribose was shown and structural diversity was confirmed. The stability of RNA and DNA(U) was studied using CD and UV-absorption spectroscopy and melting points were calculated. MiRNA-320a with the highest content of guanine provided the highest melting point. With respect to the rapid progress of miRNA electrochemical sensors, our results will be useful for the research and development of sensitive, portable and time-efficient miRNA sensors, which will be able to diagnose cancer and other diseases.

Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding.

Abasic (AP) lesions are the most frequent type of damages occurring in cellular DNA. Here we describe the conformational effects of AP sites substituted for 2'-deoxyadenosine in the first (ap7), second (ap13) or third (ap19) loop of the quadruplex formed in K(+) by the human telomere DNA 5'-d[AG3(TTAG3)3]. CD spectra and electrophoresis reveal that the presence of AP sites does not hinder the formation of intramolecular quadruplexes. NMR spectra show that the structural heterogeneity is substantially reduced in ap7 and ap19 as compared to that in the wild-type. These two (ap7 and ap19) sequences are shown to adopt the hybrid-1 and hybrid-2 quadruplex topology, respectively, with AP site located in a propeller-like loop. All three studied sequences transform easily into parallel quadruplex in dehydrating ethanol solution. Thus, the AP site in any loop region facilitates the formation of the propeller loop. Substitution of all adenines by AP sites stabilizes the parallel quadruplex even in the absence of ethanol. Whereas guanines are the major determinants of quadruplex stability, the presence or absence of loop adenines substantially influences quadruplex folding. The naturally occurring adenine-lacking sites in the human telomere DNA can change the quadruplex topology in vivo with potentially vital biological consequences.

Stability of human telomere quadruplexes at high DNA concentrations.

For mimicking macromolecular crowding of DNA quadruplexes, various crowding agents have been used, typically PEG, with quadruplexes of micromolar strand concentrations. Thermal and thermodynamic stabilities of these quadruplexes increased with the concentration of the agents, the rise depended on the crowder used. A different phenomenon was observed, and is presented in this article, when the crowder was the quadruplex itself. With DNA strand concentrations ranging from 3 µM to 9 mM, the thermostability did not change up to ∼2 mM, above which it increased, indicating that the unfolding quadruplex units were not monomolecular above ∼2 mM. The results are explained by self-association of the G-quadruplexes above this concentration. The ΔG(°) 37 values, evaluated only below 2 mM, did not become more negative, as with the non-DNA crowders, instead, slightly increased. Folding topology changed from antiparallel to hybrid above 2 mM, and then to parallel quadruplexes at high, 6-9 mM strand concentrations. In this range, the concentration of the DNA phosphate anions approached the concentration of the K(+) counterions used. Volume exclusion is assumed to promote the topological changes of quadruplexes toward the parallel, and the decreased screening of anions could affect their stability.