DNA studies are necessary for accurate patient diagnosis in compound heterozygosity for Hb Adana (HBA2:c.179>A) with deletional or nondeletional α-thalassaemia.

Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.

Non-Invasive DNA Sampling for Molecular Analysis of Beta-Thalassemia: Amiable Alternative Sampling Methods with Accurate Results for Pediatric Patients.

BACKGROUND: Beta-thalassemia is the most common genetic disorder in Malaysia. Confirmation of the ß-globin gene mutations involved in thalassemia is usually carried out by molecular analysis of DNA extracted from leukocytes in whole blood. Molecular analysis is generally carried out when affected children are around 1 - 2 years as clinical symptoms are expressed during this period. Blood taking at this age can be distressing for the child. High yield and pure DNA extracted from non-invasive sampling methods can serve as alternative samples in molecular studies for genetic diseases especially in pediatric cases. METHODS: In this study, mouthwash, saliva, and buccal cytobrush samples were collected from ß-thalassemia major patients who had previously been characterized using DNA extracted from peripheral blood. DNA was extracted from mouthwash, saliva, and buccal cytobrush samples using the conventional inexpensive phenol-chloroform method and was measured by spectrophotometry for yield and purity. Molecular characterization of ß-globin gene mutations was carried out using the amplification refractory mutation system (ARMS). RESULTS: DNA extracted from mouthwash, saliva, and buccal cytobrush samples produced high concentration and pure DNA. The purified DNA was successfully amplified using ARMS. Results of the ß-globin gene mutations using DNA from the three non-invasive samples were in 100% concordance with results from DNA extracted from peripheral blood. CONCLUSIONS: The conventional in-house developed methods for non-invasive sample collection and DNA extraction from these samples are effective and negate the use of more expensive commercial kits. In conclusion, DNA extracted from mouthwash, saliva, and buccal cytobrush samples provided sufficiently high amounts of pure DNA suitable for molecular analysis of ß-thalassemia.

A novel gap-PCR with high resolution melting analysis for the detection of α-thalassaemia Southeast Asian and Filipino ß°-thalassaemia deletion.

Homozygosity for the α-thalassaemia Southeast Asian (α-SEA) and Filipino ß°-thalassaemia (ß-FIL) deletions can cause serious complications leading to foetal death or life-long blood transfusions. A rapid and accurate molecular detection assay is essential in populations where the deletions are common. In this study, gap-polymerase chain reaction (PCR) with high resolution melting (HRM) analysis was developed to detect both the large deletions. Melting curves at 86.9 ± 0.1 °C were generated by normal individuals without the α-SEA deletion, 84.7 ± 0.1 °C by homozygous α-SEA deletion individuals and two melting curves at 84.7 ± 0.1 °C and 86.9 ± 0.1 °C by α-SEA deletion carriers. Normal individuals without the ß-FIL deletion produce amplicons with a melting temperature (Tm) at 74.6 ± 0.1 °C, homozygous ß-FIL individuals produce amplicons with Tm at 73.6 ± 0.1 °C and heterozygous ß-FIL individuals generate two amplicons with Tm at 73.6 ± 0.1 °C and 74.6 ± 0.1 °C. Evaluation using blinded tests on 220 DNA samples showed 100% sensitivity and specificity. The developed assays are sensitive and specific for rapid molecular and prenatal diagnosis for the α-SEA and ß-FIL deletions.

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and ß-globin gene mutations were characterized using DNA amplification and genomic sequencing. RESULTS: Ten ß- and 2 previously reported α-globin defects were identified. The Filipino ß-deletion represented the majority of the ß-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The ß-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with ß-thalassemia did not ameliorate the severity of thalassemia major in the patients. CONCLUSION: The Filipino ß-deletion was the most common gene defect observed. Homozygosity for the Filipino ß-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

High throughput molecular confirmation of ß-thalassemia mutations using novel TaqMan probes.

ß-Thalassemia is a public health problem where 4.5% of Malaysians are ß-thalassemia carriers. The genetic disorder is caused by defects in the ß-globin gene complex which lead to reduced or complete absence of ß-globin chain synthesis. Five TaqMan genotyping assays were designed and developed to detect the common ß-thalassemia mutations in Malaysian Malays. The assays were evaluated with 219 "blinded" DNA samples and the results showed 100% sensitivity and specificity. The in-house designed TaqMan genotyping assays were found to be cost- and time-effective for characterization of ß-thalassemia mutations in the Malaysian population.