Helical coil design with controlled dispersion for bunching enhancement of protons generated by the target normal sheath acceleration.

The quality of the proton beam produced by target normal sheath acceleration (TNSA) with high-power lasers can be significantly improved with the use of helical coils. While they showed promising results in terms of focusing, their performances in terms of the of cut-off energy and bunching stay limited due to the dispersive nature of helical coils. A new scheme of helical coil with a tube surrounding the helix is introduced, and the first numerical simulations and an analytical model show a possibility of a drastic reduction of the current pulse dispersion for the parameters of high-power-laser facilities. The helical coils with tube strongly increase bunching, creating two collimated narrow-band proton beams from a broad and divergent TNSA distribution. The analytical model provides scaling of proton parameters as a function of laser facility features.

[NISCH syndrome, a rare cause of neonatal cholestasis: A case report]. / Le syndrome NISCH, une cause rare de cholestase néonatale : à propos d'un cas.

NISCH syndrome is a rare autosomal recessive disease. It is characterized by scalp hypotrichosis, scarring alopecia, ichthyosis, and neonatal sclerosing cholangitis. It is caused by mutations in the CLDN1 gene encoding the claudin-1 protein, which is located at tight junctions. Fifteen cases have been reported to date and three different mutations have been identified. We report on the case of a 2-year-old boy from a consanguineous Moroccan family, presenting with NISCH syndrome and carrying the so-called Moroccan homozygous mutation (c.200-201delTT). The patient presented with the characteristic symptoms of the syndrome and a favorable progression with normalization of hepatic analyses under symptomatic treatment (vitamin supplementation and ursodeoxycholic acid). The currently limited availability of clinical and therapeutic data does not allow accurate prediction of the course of the disease and short- and long-term prognosis. Moreover, substantial interindividual variability has been reported. Description of new cases will provide new insights into the understanding and the overall management of this syndrome, the course of which remains elusive.

[Next-generation DNA sequencing in clinical diagnostics]. / Le séquençage d'ADN à haut débit en pratique clinique.

The advent of next generation sequencing (NGS) technologies is so scale-changing that it modifies molecular diagnostics indications and induces laboratories to rethink their diagnostic strategies, until now based on the Sanger sequencing routine. Several high-throughput approaches are available from the sequencing of a gene panel, to an exome, or even a genome. In all cases, a tremendous amount of data is generated, which has to be filtered, interpreted and analyzed using powerful bioinformatics tools. In parallel, ethical considerations are raised to avoid the potential drifts of these powerful approaches. In all medical fields, and particularly in pediatrics, this new strategy offers better efficacy and faster mutation identification, allowing better support and care for patients and their families and even improving genetic counseling. In the present paper, we discuss the different NGS-based approaches and strategies as well as the issues involved in these new technologies applied to molecular diagnosis of rare diseases. Altogether, rare diseases affect more than 3 million people in France and are responsible for about one-third of childhood deaths.

Is there a justification for hysterectomy in patients with borderline ovarian tumors?

OBJECTIVE: To determine the frequency of uterine involvement in patients with borderline ovarian tumors (BOT) and to evaluate the recurrence risk and survival after hysterectomy. MATERIALS AND METHODS: In two French hospitals: A tertiary referral centre (University hospital centre of Tours, France) and the Alliance community hospital of Tours (France), we reviewed data of consecutive women undergoing surgery for presumed stage I BOT between January 1997 and December 2012. Patients were divided into two groups: patients treated with fertility sparing surgery (group 1) and those treated with radical surgery (group 2). RESULTS: A total of 135 patients were evaluated. 35 had fertility sparing surgery, 81 had radical surgery with hysterectomy and 19 had previous hysterectomy for other reasons. There were more recurrent borderline ovarian disease and more ovarian invasive disease developed in group 1 (p = 0.02, p = 0.04, respectively). Hysterectomy affected favorably borderline disease-free survival, OR = 0.09 95%CI (0.005-0.69), p = 0.04, but perceived benefits may be related to bilateral salpingo-oophorectomy and not hysterectomy directly.

[Use of hyaluronidase to correct hyaluronic acid injections in aesthetic medicine]. / Utilisation de la hyaluronidase pour la correction des injections d'acide hyaluronique en médecine esthétique.

Hyaluronic acid (HA) is the most commonly used filler in aesthetic medicine. However, overcorrections are frequent even with experienced practitioner. Hyaluronidase is an enzyme that hydrolyzes HA. Hyaluronidase has been recently proposed to correct unsatisfactory results of HA injections in aesthetic medicine (overcorrection, asymmetry, Tyndall effect) and to treat immediate complications such as arterial or venous thrombosis. The objective of this technical note was to summarize the literature data regarding the efficacy, safety and technique of use of hyaluronidase. Hyaluronidase may be responsible for allergies. The practitioner should take this risk and the possible drug interactions into account before using this antidote in order to weigh up the risk/benefit ratio.

Increased Susceptibility to Aphids of Flowering Wheat Plants Exposed to Low Temperatures.

Frost is known to directly affect flowering wheat plants (Triticum aestivum L.) and lead to reduced grain yield. Additionally, it may increase wheat susceptibility to economically important pests, such as aphids (Hemiptera: Aphididae). Wheat plants at flowering stage were exposed to one of the three temperature treatments: ambient (11-12°C), 0°C, and -3°C for 60 min. Preference (3-choice) and performance (no-choice) bioassays with aphids (Rhopalosiphum padi L.) were conducted 1, 3, 6, and 12 d after temperature treatments to assess effects of temperature-induced stress over time. As an initial feasibility study of using remote sensing technologies to detect frost-induced stress in flowering wheat plants, hyperspectral imaging data were acquired from wheat plants used in preference bioassays. Element analysis of wheat plants was included to determine the effect of temperature-induced stress on the nutritional composition of flowering wheat plants. The results from this study support the following cause-effect scenario: a 60-min exposure to low temperatures caused a significant decrease in potassium and copper content of wheat plants 6 d after temperature exposure, and it coincided with a marked increase in preference by aphids of wheat plants. The preference exhibited by aphids correlated positively with performance of aphids, so the preference-performance hypothesis was confirmed and possibly driven by potassium and copper content of wheat plants. In addition, we demonstrated that hyperspectral imaging data can be used to detect frost-induced susceptibility to aphid infestation in flowering wheat plants. These findings justify further research into airborne remote sensing of frost-induced stress and the possible secondary effects on crop susceptibility to arthropod pests.

The sodium/iodide symporter NIS is a transcriptional target of the p53-family members in liver cancer cells.

Thyroid iodide accumulation via the sodium/iodide symporter (NIS; SLC5A5) has been the basis for the longtime use of radio-iodide in the diagnosis and treatment of thyroid cancers. NIS is also expressed, but poorly functional, in some non-thyroid human cancers. In particular, it is much more strongly expressed in cholangiocarcinoma (CCA) and hepatocellular carcinoma (HCC) cell lines than in primary human hepatocytes (PHH). The transcription factors and signaling pathways that control NIS overexpression in these cancers is largely unknown. We identified two putative regulatory clusters of p53-responsive elements (p53REs) in the NIS core promoter, and investigated the regulation of NIS transcription by p53-family members in liver cancer cells. NIS promoter activity and endogenous NIS mRNA expression are stimulated by exogenously expressed p53-family members and significantly reduced by member-specific siRNAs. Chromatin immunoprecipitation analysis shows that the p53-REs clusters in the NIS promoter are differentially occupied by the p53-family members to regulate basal and DNA damage-induced NIS transcription. Doxorubicin strongly induces p53 and p73 binding to the NIS promoter, leading to an increased expression of endogenous NIS mRNA and protein in HCC and CCA cells, but not in PHH. Silencing NIS expression reduced doxorubicin-induced apoptosis in HCC cells, pointing to a possible role of a p53-family-dependent expression of NIS in apoptotic cell death. Altogether, these results indicate that the NIS gene is a direct target of the p53 family and suggests that the modulation of NIS by DNA-damaging agents is potentially exploitable to boost NIS upregulation in vivo.

[Leg ulcer associated with type I cryoglobulinaemia due to incipient B-cell lymphoma]. / Ulcère de jambe lié à une cryoglobulinémie de type 1 révélant un lymphome B « incipiens ¼

BACKGROUND: Skin lesions are frequent in monoclonal cryoglobulinaemia and may be the first sign of B-cell lymphoma, especially multiple myeloma, Waldenström's macroglobulinaemia and B-cell chronic lymphocytic leukaemia. PATIENTS AND METHODS: A 74-year-old woman with no prior medical history presented with necrotic leg ulcer. Skin biopsy showed dermal angiomatosis with numerous PAS+ thromboses, associated with monoclonal intravascular deposits of IgM kappa, indicating monoclonal cryoglobulin, which was confirmed by laboratory tests. Subsequent blood immunophenotyping revealed an inconspicuous circulating monoclonal CD5(+) B-cell population and small B-cell clusters in the bone marrow, while the B-cell count was normal and no lymphadenopathy or splenomegaly were present. Overall, these findings indicated a small B-cell lymphoma, classed as non-MALT marginal zone lymphoma on the WHO classification, at a very early stage of development. The patient was first treated by cyclophosphamide and oral steroids without success. Subsequent administration of six cycles of rituximab, cyclophosphamide, vincristine and prednisone (RCVP) led to remission of her leg ulcer, cryoglobulinaemia and lymphoma. CONCLUSION: Skin biopsies of necrotic ulcers should undergo routine screening for intravascular deposits of type 1 cryoglobulin. Leg ulcers due to monoclonal cryoglobulinaemia may reveal incipient marginal zone B-cell lymphoma at the stage of circulating monoclonal lymphocytosis.

[Acute urinary retention and retroverted uterus during pregnancy]. / Rétention aiguë d'urine et grossesse.

Acute urinary retention at first trimester of pregnancy are uncommon, but have to alert the physician on the possibility of an incarcerated retroverted uterus. Through the management of iterative acute urinary retention before 18weeks of gestation with an incarcerated uterus and a review of the literature, we are going to see the various aetiologies, particularly gravid incarcerated uterus. Acute urinary retention during pregnancy is an emergency. Vaginal operations to open up the uterus should be tried at premature terms, successfully in most of cases.

[Does the use of TachoSil allow to reduce the morbidity of axillary dissection?]. / L'utilisation du TachoSil permet-elle de réduire la morbidité du curage axillaire ?

The lymphocele is the most frequently encountered complication after axillary dissection performed for breast cancer (15-81%). This study compares the efficacy of a lympho-hemostatic combipatch TachoSil(®) versus conventional implementation of a suction drain on the incidence and severity of lymphoceles. This is a case (group TachoSil(®)n=20) control (drainage group) n=40 study. In our study, we demonstrated an increased rate of postoperative complications (<3weeks) in the group TachoSil(®) (P=0.0265) explained by a lymphocele rate significantly higher (P=0.0194). However, no significant difference was demonstrated on the severity of these lymphoceles. Beyond 3weeks postoperatively, the two groups were comparable in terms of postoperative complications. The TachoSil(®) does not prevent the formation of seroma but their severity is not increased. In addition, it reduces of more than 48hours the duration of hospitalization stay (P=0.002).

Molecular screening of MECP2 gene in a cohort of Lebanese patients suspected with Rett syndrome: report on a mild case with a novel indel mutation.

BACKGROUND: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. METHODS: We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. RESULTS: Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. CONCLUSION: Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.

Reliability of a simple fluoroscopic method to study sagittal plane femorotibial contact changes in total knee arthroplasties during flexion.

Clinical interest in sagittal plane kinematic analysis of the knee undergoing total knee replacement fosters the development of simple, reliable methods to estimate femorotibial contact in a regular clinical setting. In this study, the sagittal femorotibial contact was analysed in lateral X-rays and lateral fluoroscopic views, from extension to knee flexion. Quantitative and categorical data were obtained from these views by two different observers, and compared with data from direct views of the components. Interobserver and intermethod errors for quantitative and categorical data were evaluated based on correlation, kappa coefficient, and Bland-Altman graphs. Interobserver reproducibility of quantitative measurement from fluoroscopic views was r=0.96 while categorical assignment exhibited a kappa coefficient of 0.95. Reproducibility from plain radiographs was not so high, with a kappa coefficient of 0.64. High concordance was also obtained when the method was compared with the direct view of the implant, supporting these measurement techniques. Bland-Altman graphs confirmed the absence of bias in the intermethod comparison. Therefore, with the obvious limitation of rotational assessment, lateral fluoroscopic evaluation enhanced by a simple fitting technique can be used as a valuable tool for clinical evaluation of knee kinematics in the sagittal plane.

Mutations in PHD-like domain of the ATRX gene correlate with severe psychomotor impairment and severe urogenital abnormalities in patients with ATRX syndrome.

Mutations in ATRX are associated with a wide and clinically heterogeneous spectrum of X-linked mental retardation syndromes. The ATRX protein, involved in chromatin remodelling, belongs to the family of SWI/SNF DNA helicases and contains a plant homeodomain (PHD)-like domain. To date, more than 60 different mutations have been reported in ATRX. One of them is recurrent and accounts for 20% of all the reported mutations, whereas all others are private. Most mutations are clustered in the two major functional domains, the helicase and the PHD-like domain. So far, no clear genotype-phenotype correlation has been established, with exception to the rare truncating mutations located at the C-terminal part of the protein, which are consistently associated with severe urogenital defects. In this study, we report the molecular analysis performed in 16 families positive for ATRX. Our findings indicate that, in addition to the previously described mutation 'hotspot' in the PHD-like domain, two other protein sections emerge as minor 'hotspots' in the helicase region encoded by exons 18-20 and 26-29, respectively, gathering 33% of all described mutations. Additionally, based on the clinical data collected for 22 patients from the 16 families, we observe that mutations in the PHD-like domain produce severe and permanent psychomotor deficiency, usually preventing patients from walking, as well as constant urogenital abnormalities, while mutations in the helicase domain lead to delayed but correct psychomotor acquisitions together with mild or absent urogenital abnormalities. In summary, mutations in the helicase domain are associated with milder phenotypes than mutations in the PHD-like domain.

[Follow-up of monoclonal gammopathy of undetermined significance in a population of 51 patients older than 70 years ]. / Gammapathie monoclonale de signification indéterminée: suivi évolutif de 51 patients âgés de plus de 70 ans.

UNLABELLED: Monoclonal gammopathy of undetermined significance (MGUS) are very frequent in the elderly. Its incidence is about 3% after 70 years. We have performed a retrospective study of patients aged of more than 70 years who were examined until 1995 for a MGUS. METHODS: The study included 51 patients: 24 men and 27 women. Information about evolution was obtained by medical file or by asking medical practitioner. We know the evolution of all patients until January 1st 2000. The median follow-up is 5.8 years (70 months). RESULTS: The MGUS remained stable for 34 patients (67%) with a median follow-up of 83 months (12 to 180 months). Nine patients (17%) developed malignant transformation of MGUS (6 multiple myeloma, 2 Waldenström macroglobulinemia, 1 malignant lymphoma). Eight (15%) developed a cancer. Twelve died without evidence of multiple myeloma or related disorder. The actuarial probability of malignant transformation at 5 years was 12%. CONCLUSION: The risk of malignant transformation of MGUS doesn't decrease in the elderly. A regular and prolonged follow-up is necessary.