Virome Analysis of Aconitum carmichaelii Reveals Infection by Eleven Viruses, including Two Potentially New Species.

Aconitum carmichaelii is a herbaceous herb indigenous to China that has been cultivated for traditional medicine for centuries. Virus-like symptoms of A. carmichaelii plants were observed on leaves in some A. carmichaelii plantations in Zhanyi and Wuding Counties, Yunnan Province, southwest China. High-throughput sequencing (HTS) was performed on 28 symptomatic plants, and the results revealed infection with 11 viruses, including 2 novel viruses and 9 previously described viruses: Aconitum amalgavirus 1 (AcoAV-1), aconite virus A (AcVA), cucumber mosaic virus (CMV), currant latent virus (CuLV), apple stem grooving virus (ASGV), chilli veinal mottle virus (ChiVMV), tomato spotted wilt orthotospovirus (TSWV), tobacco vein distorting virus (TVDV), and potato leafroll virus (PLRV). Two novel viruses tentatively named Aconitum potyvirus 1 and Aconitum betapartitivirus 1, were supported by sequence and phylogenetic analysis results of their genomes. We proposed the names Potyvirus aconiti and Betapartitivirus aconiti. RT-PCR assays of 142 plants revealed the predominance and widespread distribution of CMV, AcVA, and AcoPV-1 in plantations. The detection of isolates of CuLV, ASGV, ChiVMV, TSWV, TVDV, and PLRV infections for the first time in A. carmichaelii expands their known host ranges.

First Report of Tobacco Mosaic Virus Infecting Bidens pilosa in China.

Bidens pilosa is an annual weed in family Asteraceae widely distributed in tropical and subtropical regions worldwide. It is also a natural host for at least five viruses including tomato spotted wilt orthotospovirus, tomato zonate spot orthotospovirus, pepper chlorotic spot orthotospovirus, Bidens mottle virus and Bidens mosaic virus, and therefore serve as a virus reservoir for various field crops (Yin et al. 2013; Xu et al. 2022; Wang et al. 2009). In August 2021, plants of B. pilosa displaying symptoms of chlorosis, mosaic and necrosis were observed surrounding a tobacco field in Kunming, Yunnan Province, China. Leaf samples were collected from four diseased B. pilosa plants and total nucleic acids were extracted using a CTAB based method (Li, R., et al. 2008). RT-PCR was carried out using virus-specific primers designed for the aforementioned five viruses as well as tobacco mosaic virus (TMV). The results indicated that none of the four samples tested positive for the 5 viruses, excepted for one sample, which produced an amplicon of the expected size (700 bp) with the TMV-specific primer pair of TMVF (CGGTCAGTGCCGAACAAGAA) and TMVR (TACGTGCCTGCGGATGTATATG). Cloning and sequencing the amplicon revealed a 717 nt fragment (accession no. OR136480) in the core cp region of TMV, showed the highest nt sequence identity of 99.6% with other TMV isolates (HE818450) in GenBank. TMV infection was also verified by dot-enzyme linked immunosorbent assay (DOT-ELISA) using antisera of TMV (Beijing Green Castle Agricultural Technology Co., Ltd.). To further confirm the TMV infection in B. pilosa plants, a TMV infectious clone (kindly provided by Dr. Fei Yan at Ningbo University, China) was inoculated into twelve healthy 3-week-old B. pilosa seedlings using Agrobacterium-mediated delivery. None of the inoculated B. pilosa plants exhibited distinct symptoms even at 30 days post-inoculation (dpi). Nevertheless, RT-PCR and Sanger sequencing results revealed that 2 of the inoculated B. pilosa plants were infected by TMV. The above results collectively indicate that TMV can infect B. pilosa under both natural and artificial conditions. However, it is possible that the symptoms observed on the diseased B. pilosa plants in the field may not be solely attributed to TMV but rather to the co-infection of TMV with other unidentified virus(es), which were not characterized in this study. TMV is considered one of the economically significant pathogens affecting crops such as tobacco (Nicotiana tabacum), pepper (Capsicum spp.), and tomato (Solanum lycopersicum). It is highly contagious and can be transmitted through various means, including seeds, soil and agricultural practice. B. pilosa is considered one of the most significant alien invasive weeds in China, mainly owing to its robust reproductive capacity. Furthermore, B. pilosa has the potential to act as a reservoir for various viruses that may affect field crops. The presence of TMV on B. pilosa plants may enhance the transmission efficiency of the virus in the field. Although TMV does not induce noticeable symptoms in B. pilosa, its presence on these plants could potentially increase the transmission efficiency of the virus in the field, posing a significant risk to field crops. Therefore, effective weed management and the diligent monitoring of TMV in B. pilosa should be recognized as essential sanitary practices for controlling viral diseases in field crops. To the best of our knowledge, this is the first report of TMV infecting B. pilosa in China.

Complete genome sequence of Aconitum amalgavirus 1, a distinct member of the genus Amalgavirus.

A novel virus named Aconitum amalgavirus 1 (AcoAV-1) was identified in Chinese aconite (Aconitum carmichaelii) plants. The complete genome of AcoAV-1 is 3,370 nucleotides long, containing two partially overlapping open reading frames encoding a putative coat protein and a RNA-dependent RNA polymerase, respectively. Its fusion protein shares 34.9%-50.7% amino acid sequence identity with other amalgaviruses. Phylogenetic analysis showed that this virus formed a clade with blueberry latent virus and four other related viruses, suggesting that it belongs to the genus Amalgavirus in the family Amalgaviridae.

Synergism Among the Four Tobacco Bushy Top Disease Casual Agents in Symptom Induction and Aphid Transmission.

Tobacco bushy top disease (TBTD), caused by multiple pathogens including tobacco bushy top virus (TBTV), tobacco vein distorting virus (TVDV), TBTV satellite RNA (TBTVsatRNA), and TVDV-associated RNA (TVDVaRNA), is a destructive disease in tobacco fields. To date, how these causal agents are co-transmitted by aphid vectors in field and their roles in disease symptom induction remain largely unknown, due mainly to the lack of purified causal agents. In this study, we have constructed four full-length infectious clones, representing the Yunnan Kunming isolates of TVDV, TBTV, TBTVsatRNA, and TVDVaRNA (TVDV-YK, TBTV-YK, TBTVsatRNA-YK, and TVDVaRNA-YK), respectively. Co-inoculation of these four causal agents to tobacco K326 plants caused typical TBTD symptoms, including smaller leaves, necrosis, and plant stunting. In addition, inoculation of tobacco K326 plants with TBTV alone caused necrosis in systemic leaves by 7 dpi. Tobacco K326 and Nicotiana benthamiana plants infected by single virus or multiple viruses showed very different disease symptoms at various dpi. RT-PCR results indicated that co-infection of TVDVaRNA-YK could increase TVDV-YK or TBTV-YK accumulation in N. benthamiana plants, suggesting that TVDVaRNA-YK can facilitate TVDV-YK and TBTV-YK replication and/or movement in the infected plants. Aphid transmission assays showed that the successful transmission of TBTV-YK, TBTVsatRNA-YK, and TVDVaRNA-YK by Myzus persicae depended on the presence of TVDV-YK, while the presence of TBTVsatRNA-YK increased the aphid transmission efficiency of TBTV and TVDV. We consider that these four new infectious clones will allow us to further dissect the roles of these four causal agents in TBTD induction as well as aphid transmission.

Genomic characterization of a new enamovirus infecting common bean.

A novel enamovirus was identified in common bean plants with disease symptoms. Its genome of 5,781 nucleotides (nt) contains five open reading frames. This virus and other members of the genus Enamovirus share 50.4-68.4% nucleotide sequence identity in the complete genome and 19.9-51.9% amino acid sequence identity in the P0 protein, 24.9-52.5% in P1, 33.4-62.9% in P1-P2, 30.6-81.1% in P3, and 32.3-74.2% in P3-P5. Phylogenetic analysis showed that the virus is most closely related to alfalfa enamovirus 1 and pea enation mosaic virus 1 in the genus Enamovirus of the family Solemoviridae. These results suggest that this virus, tentatively named "bean enamovirus 1", should be classified as a member of a new species in the genus Enamovirus.

High-throughput sequencing reveals the presence of novel and known viruses in diseased Paris yunnanensis.

Paris spp. are important medicinal plant and main raw material for many Chinese patent medicines, but viral diseases have became serious problems in cultivation of this group of important medicinal plants in China. In this study, eight viruses were identified in the diseased plants of Paris yunnanensis by high-throughput sequencing (HTS) and RT-PCR. These viruses include three novel viruses (two potyviruses and one nepovirus), Hippeastrum chlorotic ringspot virus (HCRV), Lychnis mottle virus (LycMoV), Paris mosaic necrosis virus (PMNV), Paris virus 1 and pepper mild mottle virus. The three new viruses were tentatively named Paris potyvirus 3 (ParPV-3), Paris potyvirus 4 (ParPV-4), Paris nepovirus 1 (ParNV-1) and their complete genome sequences were determined. Sequence analyses showed ParPV-3 and ParPV-4 shared the highest amino acid (aa) sequence identities of 54.3% to each other and 53.0-57.8% to other known potyviruses. ParNV-1 had aa sequence identities of 28.8-63.7% at protease-polymerase (Pro-Pol) with other nepoviruses. Phylogenetic analyses further support that the three viruses are new members of their corresponding genera. Analyses of the partial sequences of HCRV and LycMoV infecting P. yunnanensis revealed they diverged from existing isolates by aa sequence identities of 97.1% at glycoprotein precursor of HCRV and 93.3% at polyprotein of LycMoV. These two viruses are reported for the first time in Paris spp. A total of 123 field samples collected from P. yunnanensis in four counties of Yunnan, Southwest China were tested by RT-PCR for detecting each of the eight viruses. Results showed that nearly half of the samples were positive for at least one of the eight viruses. Two potyviruses, ParPV-3 (26.8%) and PMNV (24.4%), were predominant and widely distributed in the fields, while other viruses occurred in low rates and/or had limited distribution. This study insights into the virome infecting P. yunnanensis and provides valuable information for diagnosis and control of viral diseases in P. yunnanensis.

Identification of two novel poleroviruses and the occurrence of Tobacco bushy top disease causal agents in natural plants.

Tobacco bushy top disease (TBTD) is a devastating tobacco disease in the southwestern region of China. TBTD in the Yunnan Province is often caused by co-infections of several plant viruses: tobacco bushy top virus (TBTV), tobacco vein distorting virus (TVDV), tobacco bushy top virus satellite RNA (TBTVsatRNA) and tobacco vein distorting virus-associated RNA (TVDVaRNA). Through this study, two new poleroviruses were identified in two TBTD symptomatic tobacco plants and these two novel viruses are tentatively named as tobacco polerovirus 1 (TPV1) and tobacco polerovirus 2 (TPV2), respectively. Analyses of 244 tobacco samples collected from tobacco fields in the Yunnan Province through RT-PCR showed that a total of 80 samples were infected with TPV1 and/or TPV2, and the infection rates of TPV1 and TPV2 were 8.61% and 29.51%, respectively. Thirty-three TPV1 and/or TPV2-infected tobacco samples were selected for further test for TBTV, TVDV, TBTVsatRNA and TVDVaRNA infections. The results showed that many TPV1 and/or TPV2-infected plants were also infected with two or more other assayed viruses. In this study, we also surveyed TBTV, TVDV, TBTVsatRNA and TVDVaRNA infections in a total of 1713 leaf samples collected from field plants belonging to 29 plant species in 13 plant families and from 11 provinces/autonomous regions in China. TVDV had the highest infection rates of 37.5%, while TVDVaRNA, TBTV and TBTVsatRNA were found to be at 23.0%, 12.4% and 8.1%, respectively. In addition, TVDV, TBTV, TBTVsatRNA and TVDVaRNA were firstly detected of co-infection on 10 plants such as broad bean, pea, oilseed rape, pumpkin, tomato, crofton weed etc., and 1 to 4 of the TBTD causal agents were present in the samples collected from Guizhou, Hainan, Henan, Liaoning, Inner mongolia and Tibet autonomous regions. The results indicated that TBTD causal agents are expanding its host range and posing a risk to other crop in the field.

A Multiyear Survey and Identification of Pepper- and Tomato-Infecting Viruses in Yunnan Province, China.

During pepper and tomato production seasons in 2013-2017, large-scale virus disease surveys were conducted in different regions of Yunnan Province, China. A total of 1,267 pepper and tomato samples with various virus-like symptoms were collected and analyzed for virus infections through dot enzyme-linked immunosorbent assay (dot-ELISA), polymerase chain reaction (PCR), and reverse-transcription (RT)-PCR. The detection results showed that 19 different viruses were present in about 50.9% of the assayed samples, and among these viruses, seven viruses were found in both pepper and tomato samples. Mixed infections with two to three of the 15 identified mixed infection types were found in the pepper samples and 10 identified mixed infection types were found in the tomato samples. Among the infected samples, Tomato spotted wilt orthotospovirus (TSWV) was the most common virus, with a detection rate of about 20.0% followed by Pepper vein yellows virus (PeVYV, 13.0%). This survey revealed for the first time that pepper is a natural host of Tobacco vein distorting virus (TVDV) worldwide and tomato is a natural host of Potato leafroll virus (PLRV) in China. PeVYV, Tobacco mild green mosaic virus (TMGMV) and Wild tomato mosaic virus (WTMV) were first time found in pepper and Tomato mottle mosaic virus (ToMMV) and Chilli veinal mottle virus (ChiVMV) were first time found in tomato in Yunnan Province. Finally, the virus incidences were higher in Kunming, Yuxi, Chuxiong, and Honghe region than other regions.

Molecular characterization of a novel potyvirus infecting noni.

The complete genomic sequence of a novel potyvirus from a noni plant in China (Morinda citrifolia) with foliar mosaic and chlorotic symptoms was determined. The genomic RNA consists of 9645 nucleotides (nt) excluding the poly(A) tail, containing the typical open reading frame (ORF) of potyviruses and encoding a large putative polyprotein of 3077 amino acids (aa). Pairwise comparisons showed that the virus shares 48.8%-58.5% sequence identity at the genome sequence level, and 38.5%-53.4% identity at the polyprotein sequence level with other members of the genus Potyvirus. Phylogenetic analysis indicated that the virus is most closely related to jasmine virus T and plum pox virus in the genus Potyvirus. These results suggest that this virus should be considered a distinct member of the genus Potyvirus, and it was tentatively named "noni mosaic virus" (NoMV).

Detection of tobamoviruses by RT-PCR using a novel pair of degenerate primers.

A generic RT-PCR assay was developed for the universal detection of viruses of the genus Tobamovirus using a novel pair of degenerate primers designed based on conserved regions on replicase genes of 32 tobamoviruses. The assay detected nine tobamoviruses, including six Solanaceae-infecting subgroup tobamoviruses of Tobacco mosaic virus (TMV), Tomato mosaic virus (ToMV), Tomato mottle mosaic virus (ToMMV), Tobacco mottle green mosaic virus (TMGMV), Pepper mild mottle virus (PMMoV), Paprika mild mottle virus (PaMMV), one Orchidaceae-infecting tobamovirus of Odontoglossum ringspot virus (ORSV) and two Cucurbitaceae-infecting subgroup tobamoviruses of Cucumber green mottle mosaic virus (CGMMV) and Zucchini green mottle mosaic virus (ZGMMV), with high amplification efficiency, specificity and sensitivity. The assay was applied to detect tobamoviruses in pepper and tomato fields. Five tobamoviruses, PMMoV, TMV, ToMV, ToMMV and TMGMV, were detected from the pepper fields in single and mixed infections. Single infections of PMMoV, ToMV and ToMMV and mix-infection of ToMV + PMMoV were detected from the tomato fields. Among these viruses, PMMoV was first detected from tomato worldwide, while ToMMV was first detected from tomato plants in China. This generic assay is simple, cost-effective and has great potential to detect more tobamoviruses in the field.

Complete genome sequence of yam chlorotic necrosis virus, a novel macluravirus infecting yam.

The complete genome sequence of a novel member of the genus Macluravirus was determined from yam plants with chlorotic and necrotic symptoms in China. The genomic RNA consists of 8,261 nucleotides (nt) excluding the 3'-terminal poly(A) tail, containing one long open reading frame (ORF) encoding a large putative polyprotein of 2,627 amino acids. Its genomic structure is typical of macluraviruses, which lack the P1 protein, N-terminal HC-Pro, and D-A-G motif for aphid transmission that are found in potyviruses. The virus shares 56.3-63.8% sequence identity at the genome sequence level and 49.7-63.9% at the polyprotein sequence level with other members of the genus Macluravirus. Phylogenetic analysis based on the complete polyprotein sequence of representative members of the family Potyviridae clearly places the virus within the genus Macluravirus. These results suggest that the virus, tentatively named "yam chlorotic necrosis virus" (YCNV), should be considered a member of a novel species in the genus Macluravirus.

Simultaneous detection and differentiation of three Potyviridae viruses in sweet potato by a multiplex TaqMan real time RT-PCR assay.

A multiplex TaqMan real time RT-PCR was developed for detection and differentiation of Sweet potato virus G, Sweet potato latent virus and Sweet potato mild mottle virus in one tube. Amplification and detection of a fluorogenic cytochrome oxidase gene was included as an internal control. The assay was compared with a multiplex RT-PCR developed in the initial study for the detection and differentiation of the three viruses and host 18S rRNA. Primers and/or probes of the two assays were designed from conserved regions of each virus. The two assays were optimized for primers/probes and primer concentrations and thermal cycling conditions. Sensitivity and specificity of the assays were compared each other and with other assay. Both assays were evaluated by 74 field samples original from five different provinces of China. RESULTS: showed that the TaqMan real time RT-PCR offered rapid, sensitive, effective and reliable for the simultaneous detection and differentiation of the three viruses in sweet potato plants. The assay will be useful to quarantine and certification programs and virus surveys when large numbers of samples are tested.

Complete genome sequence of Paris mosaic necrosis virus, a distinct member of the genus Potyvirus.

The complete genomic sequence of a novel potyvirus was determined from Paris polyphylla var. yunnanensis. Its genomic RNA consists of 9,660 nucleotides (nt) excluding the 3'-terminal poly (A) tail, containing the typical open reading frame (ORF) of potyviruses and encoding a putative large polyprotein of 3030 amino acids. The virus shares 53.9-70.1% nt sequence identity and 43.9-73.2% amino acid sequence identity with other viruses classified within the genus Potyvirus. Proteolytic cleavage sites and conserved motifs of the potyviruses were identified in the polyprotein and within individual proteins. Phylogenetic analysis indicated that the virus is most closely related to members of the BCMV subgroup. The results suggest that the virus should be classified as a novel species within the genus Potyvirus, which we tentatively name "Paris mosaic necrosis virus".

Genome characterization of sweet potato symptomless virus 1: a mastrevirus with an unusual nonanucleotide sequence.

Complete genomic sequences of nine isolates of sweet potato symptomless virus 1 (SPSMV-1), a virus of the genus Mastrevirus in the family Geminiviridae, were determined from sweet potato accessions from different countries and found to be 2,559-2,602 nucleotides in length. These isolates shared 97-100% genome sequence identity and had an unusual nonanucleotide sequence (TAAGATTCC) in a large intergenic region as well as an additional open reading frame, C3, which is conserved in dicot-infecting mastreviruses.

The complete genome sequence, occurrence and host range of Tomato mottle mosaic virus Chinese isolate.

BACKGROUND: Tomato mottle mosaic virus (ToMMV) is a recently identified species in the genus Tobamovirus and was first reported from a greenhouse tomato sample collected in Mexico in 2013. In August 2013, ToMMV was detected on peppers (Capsicum spp.) in China. However, little is known about the molecular and biological characteristics of ToMMV. METHODS: Reverse transcription-polymerase chain reaction (RT-PCR) and rapid identification of cDNA ends (RACE) were carried out to obtain the complete genomic sequences of ToMMV. Sap transmission was used to test the host range and pathogenicity of ToMMV. RESULTS: The full-length genomes of two ToMMV isolates infecting peppers in Yunnan Province and Tibet Autonomous Region of China were determined and analyzed. The complete genomic sequences of both ToMMV isolates consisted of 6399 nucleotides and contained four open reading frames (ORFs) encoding 126, 183, 30 and 18 kDa proteins from the 5' to 3' end, respectively. Overall similarities of the ToMMV genome sequence to those of the other tobamoviruses available in GenBank ranged from 49.6% to 84.3%. Phylogenetic analyses of the sequences of full-genome nucleotide and the amino acids of its four proteins confirmed that ToMMV was most closely related to Tomato mosaic virus (ToMV). According to the genetic structure, host of origin and phylogenetic relationships, the available 32 tobamoviruses could be divided into at least eight subgroups based on the host plant family they infect: Solanaceae-, Brassicaceae-, Cactaceae-, Apocynaceae-, Cucurbitaceae-, Malvaceae-, Leguminosae-, and Passifloraceae-infecting subgroups. The detection of ToMMV on some solanaceous, cucurbitaceous, brassicaceous and leguminous plants in Yunnan Province and other few parts of China revealed ToMMV only occurred on peppers so far. However, the host range test results showed ToMMV could infect most of the tested solanaceous and cruciferous plants, and had a high affinity for the solanaceous plants. CONCLUSIONS: The complete nucleotide sequences of two Chinese ToMMV isolates from naturally infected peppers were verified. The tobamoviruses were divided into at least eight subgroups, with ToMMV belonging to the subgroup that infected plants in the Solanaceae. In China, ToMMV only occurred on peppers in the fields till now. ToMMV could infect the plants in family Solanaceae and Cucurbitaceae by sap transmission.

Complete genome sequence of a divergent strain of Japanese yam mosaic virus from China.

A novel strain of Japanese yam mosaic virus (JYMV-CN) was identified in a yam plant with foliar mottle symptoms in China. The complete genomic sequence of JYMV-CN was determined. Its genomic sequence of 9701 nucleotides encodes a polyprotein of 3247 amino acids. Its organization is virtually identical to that of two JYMV isolates from Japan. With the latter, it shares nucleotide sequence identities of only 74.7-74.8 %, indicating it might be a member of a new species. However, sequence analysis of the polyprotein and individual proteins suggested that the Chinese isolate is a divergent JYMV strain in the process of speciation.