Perinatal sleep disruption and postpartum psychosis in bipolar disorder: Findings from the UK BDRN Pregnancy Study.

BACKGROUND: Women with bipolar disorder (BD) are at high risk of postpartum psychosis (PP). The factors that increase risk of PP among women with BD are not fully understood. Here, we examine whether sleep disruption in the perinatal period (poor sleep quality in late pregnancy and sleep deprivation related to childbirth) is associated with PP in a longitudinal study of pregnant women with BD. METHODS: Participants were 76 pregnant women with lifetime DSM-5 bipolar I disorder or schizoaffective-BD, followed from week 12 of pregnancy to 12 weeks postpartum. Demographics and lifetime psychopathology were assessed at baseline via semi-structured interview (Schedules for Clinical Assessment in Neuropsychiatry). Psychopathology and sleep disruption within the current perinatal period were assessed in the third trimester and at 12 weeks postpartum. Data were supplemented by clinician questionnaires and case-note review. RESULTS: After controlling for prophylactic use of mood stabilising medication, the loss of at least one complete night of sleep across labour/delivery was associated with five times the odds of experiencing PP compared to no or less than one night of sleep loss across labour/delivery (OR 5.19, 95 % CI 1.45-18.54; p = 0.011). Sleep quality in late pregnancy was not associated with PP, and perinatal sleep disruption was not associated with postpartum depression. LIMITATIONS: Lack of objective measures of sleep factors. CONCLUSIONS: In the context of other aetiological factors, severe sleep loss associated with childbirth/the immediate postpartum may act as a final trigger of PP. These findings could have important clinical implications for risk prediction and prevention of PP.

The dynamic interplay between sleep and mood: an intensive longitudinal study of individuals with bipolar disorder.

BACKGROUND: Sleep disturbances are important symptoms to monitor in people with bipolar disorder (BD) but the precise longitudinal relationships between sleep and mood remain unclear. We aimed to examine associations between stable and dynamic aspects of sleep and mood in people with BD, and assess individual differences in the strength of these associations. METHODS: Participants (N = 649) with BD-I (N = 400) and BD-II (N = 249) provided weekly self-reports of insomnia, depression and (hypo)mania symptoms using the True Colours online monitoring tool for 21 months. Dynamic structural equation models were used to examine the interplay between weekly reports of insomnia and mood. The effects of clinical and demographic characteristics on associations were also assessed. RESULTS: Increased variability in insomnia symptoms was associated with increased mood variability. In the sample as a whole, we found strong evidence of bidirectional relationships between insomnia and depressive symptoms but only weak support for bidirectional relationships between insomnia and (hypo)manic symptoms. We found substantial variability between participants in the strength of prospective associations between insomnia and mood, which depended on age, gender, bipolar subtype, and a history of rapid cycling. CONCLUSIONS: Our results highlight the importance of monitoring sleep in people with BD. However, researchers and clinicians investigating the association between sleep and mood should consider subgroup differences in this relationship. Advances in digital technology mean that intensive longitudinal data on sleep and mood are becoming increasingly available. Novel methods to analyse these data present an exciting opportunity for furthering our understanding of BD.

A New Report of Xanthomonas cucurbitae Causing Bacterial Leaf Spot of Watermelon in Georgia, USA.

In June 2012, watermelon leaves (Citrullus lanatus (Thunb.) Matsum. & Nakai) were observed with angular, necrotic spots with chlorotic halos in a field in Telfair County, GA. The field exhibited 20 to 25% disease incidence with no observable symptoms on fruits. Isolations were made from foliar lesions of 30 leaves onto yeast extract-dextrose-CaCO3 (YDC) agar medium (3). Yellow-pigmented, Xanthomonas-like colonies were observed after 48-h incubation at 28°C from 100% of the samples. Bacteria harvested were gram-negative, oxidase-negative, indole-negative, hydrolyzed starch and esculin, and formed pits on crystal violet pectate and carboxymethyl cellulose media. The bacterial isolates did not produce nitrites from nitrates but produced hypersensitive reactions on tobacco upon inoculation with 1 × 108 colony-forming units (CFU)/ml. These characteristics are typical of members of the Xanthomonas campestris group. The genus Xanthomonas was confirmed using conventional PCR with genus-specific primers RST2 (5'AGGCCCTGGAAGGTGCCCTGGA3') and RST3 (5'ATCGCACTGCGTACCGCGCGCGA3'), which produced an 840-bp band. Universal primers fD1 and rD1 (1) were used to amplify the 16S rRNA gene from four isolates and amplified products were sequenced and BLAST searched in GenBank. The nucleotide sequences of the isolates showed 97 to 98% similarity to X. cucurbitae (Accessions AB680438.1 and Y10760), X. campestris (HQ256868.1), X. arboricola (JF835910.1), X. oryzae pv. oryzicola (CP003057.1) and X. campestris pv. raphani (CP002789.1). PCR amplification and sequencing of the atpD gene (ATP synthase, 720 bp) showed 99% similarity with X. cucurbitae when BLAST searched in GenBank (HM568911.1). X. cucurbitae was not present in the database of BIOLOG (Biolog, Hayward, CA); therefore, substrate utilization tests of three isolates were compared with substrate utilization patterns of Xanthomonas groups reported by Vauterin et al. (4). The watermelon isolates displayed 93.7, 89.5, and 89.5% similarity with the reported BIOLOG metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, none of the isolates were amplified using a conventional PCR assay with X. campestris pv. campestris and X. campestris pv. raphani-specific primers (2), indicating a closer relationship with X. cucurbitae. When 2-week old watermelon seedlings cv. Crimson sweet (n = 4/isolate/experiment) were inoculated by spraying with a suspension of 1 × 108 CFU/ml, 100% of the seedlings developed symptoms (water soaked angular lesions that developed into necrotic spots) 14 days after planting under greenhouse conditions (~30°C and ~70% RH). Ten control plants inoculated with sterile water remained asymptomatic. Bacterial colonies were reisolated from symptomatic seedlings that showed similar characteristics to those described above. The identity of isolated colonies was confirmed by amplifying and sequencing the 16S rRNA gene, which showed 97 to 98% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on watermelon in Georgia since the 1950s. References: (1) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (2) Leu et al. Plant Pathol. Bull. 19:137, 2010. (3) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. APS Press. St. Paul, MN, 2001. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

Sexual reproduction and gene flow in the pine pathogen Dothistroma septosporum in British Columbia.

Dothistroma septosporum has caused a serious needle blight epidemic in the lodgepole pine forests in northwest British Columbia over the past several years. Although ascocarps had been observed in British Columbia, nothing was known about the contribution of sexual reproduction, gene flow and long-distance dispersal to the epidemic. Amplified fragment length polymorphism and mating-type markers in 19 sites were used to generate population and reproductive data. Overall, evidence suggests a mixed mode of reproduction. Haplotypic diversity was high, with 79 unique and 56 shared haplotypes (possible clones) identified from 192 fungal isolates. Overall, mating-type segregation did not differ significantly from 1:1; however, random mating was rejected in most populations in the index of association and parsimony tree-length permutation analyses using the full data set and, when using clone-corrected data sets, more of the smaller populations showed random mating. Two of the smaller populations consistently showed random mating for both tests using both clone-corrected and noncorrected data. High gene flow is suggested by no differentiation between 14 of the 19 sites, several of which came from young plantations where the pathogen was not likely present prior to the current outbreak. The remaining five sites showed some level of divergence, possibly due to historic separation and endemic pathogen populations. Results indicate a high evolutionary potential and long-distance dispersal in this pathogen, important to consider in future forest management.

First Report of Colletotrichum gloeosporioides Causing 'Twister Disease' of Onion (Allium cepa) in Georgia.

In the fall of 2007, onion seedlings with twisted and distorted leaves were observed in seedbeds in multiple fields in the Vidalia onion region of Georgia. Tests for viruses and bacteria were negative and chemical injury was deemed improbable because of disease distribution in the fields. Upon further investigation, fungal fruiting bodies were observed on the outside sheath of a few of the seedlings. Symptomatic plants were cut into 1-cm segments and surface sterilized in 70% ethanol for 3 min. After rinsing in sterile water, the segments were placed onto potato dextrose agar amended with tetracycline. The fungus isolated from symptomatic plants fit the description of Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. Conidia were aseptate, cylindrical, and hyaline. Sequencing of the internal transcribed spacer region and a BLAST search in GenBank (99% sequence similarity to C. gloeosporioides accessions) confirmed the identification. Ten onion seedlings were spray inoculated with a suspension of 1 × 107 spores/ml until runoff, and four seedlings were inoculated with water as negative controls. Plants were bagged for 12 h to maintain high relative humidity. Five plants were placed in the greenhouse and five plants placed in a growth chamber at 22°C. All plants inoculated with C. gloeosporioides developed distorted and twisted leaves 3 weeks after inoculation in the growth chamber and 5 weeks after inoculation in the greenhouse. Night time temperatures in the greenhouse (15°C) were lower than those in the growth chamber (22°C). Seedlings inoculated with water showed no symptoms. The fungus was reisolated from symptomatic plants. C. gloeosporioides has been reported to cause a disease called twister on onion in tropical regions (1). The fall of 2007 was unusually warm with maximum temperatures reaching 26°C during the day. The pathogen is present on many crops in the United States, but to our knowledge, this is the first report of C. gloeosporioides causing twister disease of onion in the United States. In Nigeria and Brazil, yield losses as much as 100% were observed in fields with infected onions (1). The impact of infection on the growth of the transplants and subsequent yield in Vidalia onions is currently unknown. References: (1) J. P. Hill. Compendium of Onion and Garlic Diseases. 2nd ed. The American Phytopathological Society, St. Paul, MN, 2008.

Development of a sustained-release biodegradable polymer delivery system for site-specific delivery of oligonucleotides: characterization of P(LA-GA) copolymer microspheres in vitro.

Development of a Sustained-Release Biodegradable Polymer Delivery System for Site-Specific Delivery of Oligonucleotides: Characterization of P(LA-GA) Copolymer Microspheres In Vitro Antisense oligodeoxynucleotides (ODNs) can selectively inhibit individual gene expression provided they gain access to and remain stable at the target site for a sufficient period of time. Biodegradable sustained-release delivery systems may facilitate site-specific delivery and also prevent degradation of ODNs by nucleases whilst delivering the nucleic acid in a controlled manner to the desired site of action. In this study, we have characterized biodegradable poly (lactide-co-glycolide) (P(LA-GA)) 50:50 microspheres for the potential delivery of antisense oligonucleotides in vivo. Phosphodiester (PO) oligonucleotides complementary to either c-myc proto-oncogene or the tat gene in HIV-RNA were adequately incorporated within P(LA-GA) microspheres with entrapment efficiencies up to 60% depending on particles size. In vitro release profiles of antisense nucleic acids from 10-20 microm size microspheres over 56 days in physiological buffer were triphasic. Profiles were characterised by an initial burst effect during the first 48 hours (phase 1) of release followed by a more sustained release (phase 2) with an additional increased release (phase 3) being observed after 25 days which corresponded with bulk degradation of the copolymer matrix. The release profiles were influenced by microsphere size, copolymer molecular weight, ODN loading, ODN length and by the pH of release medium used. The serum stability of PO ODNs was significantly improved when entrapped within P(LA-GA) microspheres and the hybridization capability, as assessed by duplex melting (Tm) measurements, of released ODN was not impaired by the double-emulsion microsphere fabrication procedure used. Thus, P(LA-GA) microspheres appear to be promising candidates for improving site-specific delivery profiles for ODNs and are worthy of further evaluation in vivo.

Estrogen receptor mutations.

The purpose of this paper is to review potential novel functional pathways by which estradiol and estrogenic compounds elicit biological responses in mammals. We will limit our approach to those novel functions suggested by phenotypes associated with estrogen receptor-alpha (ER alpha) gene mutations and polymorphisms. The study of these pathways has been greatly aided by the availability of ER alpha-minus mice, which lack classic biological responses to estradiol. In addition, the availability of an ER alpha-minus human family, aromatase-minus human families, and in the near future an aromatase-minus mouse model will allow correlations of novel phenotypes with the lack of active ER alpha protein. The ER alpha-minus mice can potentially be used to characterize in depth novel clinical phenotypes that link the functions of estrogens with sexual maturation, cardiovascular disease, osteoporosis, diabetes, and cancer.

Evaluation of the therapeutic efficacy of some antimuscarinics against soman in vivo.

The therapeutic efficacy of tacrine, atropine and glycopyrrolate alone or in combination with the oxime HI-6 against soman was evaluated in anaesthetized rats. Arterial blood pressure, heart rate, respiratory frequency and body temperature were monitored in vivo. Blood cholinesterases were determined after each drug or soman challenge. At the lowest concentration tested (2.5 mg kg-1), tacrine was effective in improving the survivability of the rat by a factor of 2.6 (protection ratio), whereas the protection by atropine or glycopyrrolate was either insignificant or only marginally effective (protection ratio ranged from 1.0 to 1.9). In combination with HI-6, atropine increased the ratio to 4.6. In contrast, tacrine with HI-6 failed to improve the efficacy of the regimen, while glycopyrrolate plus HI-6 showed only slight improvement. The four physiological parameters monitored were relatively constant during the time course of the experiment in both the control and those with drug therapy. The more noticeable changes occurred toward the end of the experiment when sufficient amount of soman was injected to cause lethality. Death of the animal was usually preceded by a surge of arterial blood pressure and heart rate and a decrease in respiratory frequency. These physiological parameters rapidly deteriorated to zero just before the animal died. Blood and plasma cholinesterases were significantly inhibited after the animal received a relatively small dose of soman (20 micrograms kg-1) and were almost completely inactivated after the lethal dose of soman was administered. However, these changes of enzyme activity did not correspond well with the survivability of the rat. The inclusion of HI-6 with the three antimuscarinics appeared to be capable of protecting some cholinesterases against soman.

The lipolytic activity of low concentrations of insulin-like growth factors in ovine adipose tissue.

Insulin-like growth factor I (IGF-I) at concentrations of 40 ng/ml is lipogenic in ovine adipose tissue slices in vitro. Neither human IGF-II (hIGF-II) or rat IGF-II (rIGF-II) [multiplication-stimulating activity (MSA)] is lipogenic at similar concentrations. However, when present at lower concentrations recombinant human IGF-I (rhIGF-I) (400 pg/ml), hIGF-II (0.4 pg/ml), and MSA (40 pg/ml) were lipolytic. As IGF-II appeared more potent than IGF-I in promoting lipolysis, this effect may be mediated via the type 2 IGF receptor. The lipolytic effect of GH may be partly due to the actions of IGFs released locally.

Residual formaldehyde in dialyzers: quantity, location, and the effect of different methods of rinsing.

When formalin-sterilized dialyzers were rinsed by our standard technique (similar to that used in many other dialysis centres) undesirable concentrations of formaldehyde were found in the dialyzers at the start of dialysis. When the technique was modified by passing part of the saline through the blood compartment immediately before connection and discarding the saline left in the dialyzer at the time of connection, the concentration of formaldehyde infused into the patient fell below 2 micrograms/ml. However, the dialyzers still contained up to 13 mg of formaldehyde which leached slowly from the dialyzer during simulated dialysis. Some residual formaldehyde was found in several components of the dialyzer but the great majority was contained in the cellulose membrane.

Formation of anti-N-like antibodies in dialysis patients: effect of different methods of dialyzer rinsing to remove formaldehyde.

Use of formalin to sterilize dialyzers is known to be responsible for the formation of anti-N-like antibody in long-term hemodialysis patients. Patients dialyzed as in-patients using formalin were found to be completely free of anti-N-like antibody, while among those on home dialysis, there was a high prevalence (31%) and incidence. The hospital patients were found to be receiving concentrations of formaldehyde less than 1 microgram/ml while those on home dialysis received 3-13 micrograms/ml. This is offered as an explanation for the absence of anti-N-antibody in patients using formalin-sterilized dialyzers.

Efficacy of trivalent inactivated encephalomyelitis virus vaccine in horses.

Twenty-nine horses were vaccinated with a trivalent (Venezuelan, eastern, and western) inactivated equine encephalomyelitis virus vaccine. The vaccine purchased for this study was the only one licensed and commercially available in May, 1975. Plaque-neutralizing and hemagglutinin-inhibiting antibodies in response to each of the 3 equine encephalomyelitis viruses were determined after vaccination. Horses had rising levels of plaque-neutralizing and hemagglutinin-inhibiting antibodies shortly after injection with the 1st and 2nd doses of the vaccine (given 3 weeks apart) and were refractory to challenge of immunity with virulent homologous virus at 3, 8, and 12 months after vaccination. After 12 months, 8 horses were revaccinated; maximum antigenic stimulation was achieved with the 1st dose of the 2nd series of vaccinations.