The emerging role of extracellular vesicles in the diagnosis and treatment of autism spectrum disorders.

Autism spectrum disorders (ASD) are neurodevelopmental conditions characterized by restricted, repetitive behavioral patterns and deficits in social interactions. The prevalence of ASD has continued to rise in recent years. However, the etiology and pathophysiology of ASD remain largely unknown. Currently, the diagnosis of ASD relies on behavior measures, and there is a lack of reliable and objective biomarkers. In addition, there are still no effective pharmacologic therapies for the core symptoms of ASD. Extracellular vesicles (EVs) are lipid bilayer nanovesicles secreted by almost all types of cells. EVs play a vital role in cell-cell communications and are known to bear various biological functions. Emerging evidence demonstrated that EVs are involved in many physiological and pathological processes throughout the body and the content in EVs can reflect the status of the originating cells. EVs have demonstrated the potential of broad applications for the diagnosis and treatment of various brain diseases, suggesting that EVs may have also played a role in the pathological process of ASD. Besides, EVs can be utilized as therapeutic agents for their endogenous substances and biological functions. Additionally, EVs can serve as drug delivery tools as nano-sized vesicles with inherent targeting ability. Here, we discuss the potential of EVs to be considered as promising diagnostic biomarkers and their potential therapeutic applications for ASD.

Green and Efficient Extraction of Phenolic Components from Plants with Supramolecular Solvents: Experimental and Theoretical Studies.

The supramolecular solvent (SUPRAS) has garnered significant attention as an innovative, efficient, and environmentally friendly solvent for the effective extraction and separation of bioactive compounds from natural resources. However, research on the use of a SUPRAS for the extraction of phenolic compounds from plants, which are highly valued in food products due to their exceptional antioxidant properties, remains scarce. The present study developed a green, ultra-sound-assisted SUPRAS method for the simultaneous determination of three phenolic acids in Prunella vulgaris using high-performance liquid chromatography (HPLC). The experimental parameters were meticulously optimized. The efficiency and antioxidant properties of the phenolic compounds obtained using different extraction methods were also compared. Under optimal conditions, the extraction efficiency of the SUPRAS, prepared with octanoic acid reverse micelles dispersed in ethanol-water, significantly exceeded that of conventional organic solvents. Moreover, the SUPRAS method demonstrated greater antioxidant capacity. Confocal laser scanning microscopy (CLSM) images revealed the spherical droplet structure of the SUPRAS, characterized by a well-defined circular fluorescence position, which coincided with the position of the phenolic acids. The phenolic acids were encapsulated within the SUPRAS droplets, indicating their efficient extraction capacity. Furthermore, molecular dynamics simulations combined with CLSM supported the proposed method's mechanism and theoretically demonstrated the superior extraction performance of the SUPRAS. In contrast to conventional methods, the higher extraction efficiency of the SUPRAS can be attributed to the larger solvent contact surface area, the formation of more types of hydrogen bonds between the extractants and the supramolecular solvents, and stronger, more stable interaction forces. The results of the theoretical studies corroborate the experimental outcomes.

Synthesis, DNA binding of bis-naphthyl ferrocene derivatives and the application as new electroactive indicators for DNA biosensor.

A series of bis-naphthyl ferrocene derivatives were synthesized and characterized. Based on the results obtained from UV-visible absorption titration and ethidium bromide (EB) displacement experiments, it was observed that the synthesized compounds exhibited a strong binding ability to dsDNA. In comparison to the viscosity curve of EB, the tested compounds demonstrated a bisintercalation binding mode when interacting with CT-DNA. Differential pulse voltammetry (DPV) was employed to assess the binding specificity of these indicators towards ssDNA and dsDNA. All tested indicators displayed more pronounced signal differences before and after hybridization between probe nucleic acids and target nucleic acids compared to Methylene Blue (MB). Among the evaluated compounds, compound 3j containing an ether chain showed superior performance as an indicator, making it suitable for constructing DNA-based biosensors. Under optimized conditions including probe ssDNA concentration and indicator concentration, this biosensor exhibited good sensitivity, reproducibility, stability, and selectivity. The limit of detection was calculated as 4.53 × 10-11 mol/L. Furthermore, when utilizing 3j as the indicator in serum samples, the biosensor achieved satisfactory recovery rates for detecting the BRCA1 gene.

NLRP4E regulates actin cap formation through SRC and CDC42 during oocyte meiosis.

BACKGROUND: Members of the nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing (NLRP) family regulate various physiological and pathological processes. However, none have been shown to regulate actin cap formation or spindle translocation during the asymmetric division of oocyte meiosis I. NLRP4E has been reported as a candidate protein in female fertility, but its function is unknown. METHODS: Immunofluorescence, reverse transcription polymerase chain reaction (RT-PCR), and western blotting were employed to examine the localization and expression levels of NLRP4E and related proteins in mouse oocytes. small interfering RNA (siRNA) and antibody transfection were used to knock down NLRP4E and other proteins. Immunoprecipitation (IP)-mass spectrometry was used to identify the potential proteins interacting with NLRP4E. Coimmunoprecipitation (Co-IP) was used to verify the protein interactions. Wild type (WT) or mutant NLRP4E messenger RNA (mRNA) was injected into oocytes for rescue experiments. In vitro phosphorylation was employed to examine the activation of steroid receptor coactivator (SRC) by NLRP4E. RESULTS: NLRP4E was more predominant within oocytes compared with other NLRP4 members. NLRP4E knockdown significantly inhibited actin cap formation and spindle translocation toward the cap region, resulting in the failure of polar body extrusion at the end of meiosis I. Mechanistically, GRIN1, and GANO1 activated NLRP4E by phosphorylation at Ser429 and Thr430; p-NLRP4E is translocated and is accumulated in the actin cap region during spindle translocation. Next, we found that p-NLRP4E directly phosphorylated SRC at Tyr418, while p-SRC negatively regulated p-CDC42-S71, an inactive form of CDC42 that promotes actin cap formation and spindle translocation in the GTP-bound form. CONCLUSIONS: NLRP4E activated by GRIN1 and GANO1 regulates actin cap formation and spindle translocation toward the cap region through upregulation of p-SRC-Tyr418 and downregulation of p-CDC42-S71 during meiosis I.

The Role of SLIT3-ROBO4 Signaling in Endoplasmic Reticulum Stress-Induced Delayed Corneal Epithelial and Nerve Regeneration.

Purpose: In the present study, we aim to elucidate the underlying molecular mechanism of endoplasmic reticulum (ER) stress induced delayed corneal epithelial wound healing and nerve regeneration. Methods: Human limbal epithelial cells (HLECs) were treated with thapsigargin to induce excessive ER stress and then RNA sequencing was performed. Immunofluorescence, qPCR, Western blot, and ELISA were used to detect the expression changes of SLIT3 and its receptors ROBO1-4. The role of recombinant SLIT3 protein in corneal epithelial proliferation and migration were assessed by CCK8 and cell scratch assay, respectively. Thapsigargin, exogenous SLIT3 protein, SLIT3-specific siRNA, and ROBO4-specific siRNA was injected subconjunctivally to evaluate the effects of different intervention on corneal epithelial and nerve regeneration. In addition, Ki67 staining was performed to evaluate the proliferation ability of epithelial cells. Results: Thapsigargin suppressed normal corneal epithelial and nerve regeneration significantly. RNA sequencing genes related to development and regeneration revealed that thapsigargin induced ER stress significantly upregulated the expression of SLIT3 and ROBO4 in corneal epithelial cells. Exogenous SLIT3 inhibited normal corneal epithelial injury repair and nerve regeneration, and significantly suppressed the proliferation and migration ability of cultured mouse corneal epithelial cells. SLIT3 siRNA inhibited ROBO4 expression and promoted epithelial wound healing under thapsigargin treatment. ROBO4 siRNA significantly attenuated the delayed corneal epithelial injury repair and nerve regeneration induced by SLIT3 treatment or thapsigargin treatment. Conclusions: ER stress inhibits corneal epithelial injury repair and nerve regeneration may be related with the upregulation of SLIT3-ROBO4 pathway.

Synthesis and characterization of polyaniline-based composites using cellulose nanocrystals as biological templates.

Polyaniline (PANI) is considered as an ideal electrode material due to its remarkable Faradaic activity, exceptional conductivity, and ease of processing. However, the agglomeration and poor cycling stability of PANI largely limit its practical utilization in energy storage devices. To address these challenges, PANI was synthesized via a facile one-pot, two-step process using cellulose nanocrystals (CNCs) as bio-templates in this work. Zeta potential and particle size measurements revealed that the CNC template could impart improved dispersion stability to the synthesized PANI, which exhibited a decrease in average particle size from 1100 nm to 300 nm as a function of 10 % CNCs. Furthermore, the effect of CNC loadings on the performance of PANI was systematically investigated. The results showed that the specific capacitance of PANI/CNC increased from 102.52 F·g-1 to 138.12 F·g-1 with the CNC loading increase from 0 to 10 wt%. Particularly, the PANI/CNC composite film with a 1:9 ratio (C-P-10 %) demonstrated a capacity retention of 84.45 % after 6000 cycles and an outstanding conductivity of 526 S·m-1. This work generally offers an effective solution for the preparation of high-performance PANI-based composites, which might hold great promise in energy storage device applications.

Association between daily sitting time and kidney stones based on the National Health and Nutrition Examination Survey (NHANES) 2007-2016: A cross-sectional study.

BACKGROUND: Kidney stones are among the most common urological conditions affecting approximately 9% of the world population. Although some unhealthy diets and unhealthy lifestyles are reportedly risk factors for kidney stone, the association between daily sitting time and kidney stone has not been explored. MATERIALS AND METHODS: This large-scale, cross-sectional study was conducted using data from the National Health and Nutrition Examination Survey (NHANES) database 2007-2016. Kidney stone history and daily sitting time were retrieved from the questionnaire and 24-hour recall interviews. Logistic regression and subgroup analysis were conducted to investigate the association. The analysis was further stratified by vigorous recreational activity. RESULTS: A total of 19188 participants aged ≥20 years with complete information were included in this study. The overall prevalence of kidney stone was 9.6%. Among participants without vigorous recreational activity, a trend towards an increasing prevalence of kidney stone was observed with increased daily sitting time. However, the trend was not observed in individuals who participated in vigorous recreational activity, as they experienced a decreased risk of kidney stone despite having a daily sitting time of 6 to 8 hours (crude model OR=0.659, 95% CI: 0.457 to 0.950, P=0.028), indicating that vigorous recreational activity may partially attenuate the detrimental effect of prolonged sitting time. CONCLUSION: Our study revealed an increasing trend of prevalence of kidney stone with increased daily sitting time among the population not performing vigorous recreational activity despite the difference was nonsignificant. Vigorous recreational activity may modify the association between daily sitting time and kidney stone. More prospective cohort studies are warranted to further examine this association.

Single-atom nickel sites boosting Si nanowires for photoelectrocatalytic CO2 conversion with nearly 100% selectivity.

It is a challenge to design a photocathode with well-defined active sites for efficient photoelectrocatalytic CO2 reduction. Herein, single-atom Ni sites are integrated into Si nanowires to develop a novel photocathode, denoted as Ni-NC/Si. The photocathode demonstrates a stable faradaic efficiency for CO production, approaching nearly 100% at -0.6 V vs. RHE. The introduction of single-atom Ni sites provides sufficient active sites for CO2 reduction, thereby improving the selectivity towards CO formation.

Novel Sulfoximine Derivatives Containing Cyanoguanidine and Nitroguanidine Moieties: Design, Synthesis, and Bioactivities.

A total of 32 novel sulfoximines bearing cyanoguanidine and nitroguanidine moieties were designed and synthesized by a rational molecule design strategy. The bioactivities of the title compounds were evaluated and the results revealed that some of the target compounds possessed excellent antifungal activities against six agricultural fungi, including Sclerotinia sclerotiorum, Fusarium graminearum, Phytophthora capsici, Botrytis cinerea, Rhizoctonia solani, and Pyricularia grisea. Among them, compounds 8e1 and 8e4 exhibited significant efficacy against P. grisea with EC50 values of 2.72 and 2.98 µg/mL, respectively, which were much higher than that of commercial fungicides boscalid (47.95 µg/mL). Interestingly, in vivo assays determined compound 8e1 possessed outstanding activity against S. sclerotiorum with protective and curative effectiveness of 98 and 95.6% at 50 µg/mL, which were comparable to those of boscalid (93.2, 91.9%). The further preliminary mechanism investigation disclosed that compound 8e1 could damage the structure of the cell membrane of S. sclerotiorum, increase its permeability, and suppress its growth. Overall, the findings enhanced that these novel sulfoximine derivatives could be potential lead compounds for the development of new fungicides.

Efficacy and Safety of Acupuncture for Restless Legs Syndrome in Patients with End-Stage Renal Disease: A Randomized-Controlled Trial at Hospital-Based Hemodialysis Center.

Background: Restless legs syndrome (RLS) is frequent in patients with hemodialysis (HD) and occurs predominantly in its most severe forms. The study was conducted to evaluate the efficacy and safety of acupuncture for RLS in patients with end-stage renal disease (ESRD) at hospital-based HD center. Methods: This single-blind, randomized controlled trial was performed on patients with HD and RLS who were randomly assigned to the experimental group and control group. Data were collected using the International Restless Legs Syndrome Rating Scale (IRLSRS), Insomnia Severity Index (ISI), and heart rate variability (HRV) records at baseline, after the therapeutic course (12 times/4 weeks), and 1-week follow-up. Result: A total of 47 patients were evaluated with IRLSRS score from 11 to 30 in this study. There were 41 patients enrolled in the study based on inclusion/exclusion criteria and allocated randomly into two groups. A total of 35 participants completed the trial, including 18 subjects in the experimental group and 17 subjects in the control group. The comparison of IRLSRS and ISI showed a significant reduction between two groups after acupuncture treatment (p = 0.002, p = 0.003). The ISI after 1-week follow-up also revealed significant decrease (p = 0.003). This HRV results showed that high frequency (HF%) increased significantly (p = 0.021) and low frequency (LF%) decreased significantly in the acupuncture group (p = 0.021). The generalized estimating equation showed that the IRLSRS improved by 2.902 points (p < 0.001) in the acupuncture group compared with the control group and by 1.340 points (p = 0.003) after 1-week follow-up. There were no adverse effects observed during HD in this study. Discussion: The authors conclude that acupuncture could effectively improve the symptoms of RLS significantly. The results from this study provide clinical evidence on the efficacy and safety of acupuncture to treat the patients with RLS at the HD center.

Chemoselective Synthesis of α-Halo-α,α-difluoromethyl Ketones from Trimethyl(phenylethynyl)silane.

Here, we describe a novel strategy for chemoselective synthesis of α-halo-α,α-difluoromethyl ketones (-COCF3 and -COClCF2 motifs) from trimethyl(phenylethynyl)silane under catalyst-free and mild conditions. Commercially available Selectfluor or additional NaCl as halogen reagent was employed to complete this transformation, thereby demonstrating the potential synthetic value of this new reaction in organic synthesis.

Exploration and Validation of Ferroptosis-Associated Genes in ADAR1 Deletion-Induced NAFLD through RNA-seq Analysis.

BACKGROUND: Ferroptosis, characterized by excessive iron ions and lipid peroxides accumulation, contributes to Nonalcoholic Fatty Liver Disease (NAFLD) development. The role of ADAR1, crucial for lipid metabolism and immune regulation, in ferroptosis-related NAFLD remains unexplored. METHODS: In this study, we analyzed the expression of ADAR1 in NAFLD patients using the GSE66676 database. Subsequently, We investigated the effects of ADAR1 knockdown on mitochondrial membrane potential (MMP), Fe2+ levels, oxidation products, and ferroptosis in NAFLD cells through in vitro and in vivo experiments. Additionally, RNA-seq analysis was performed following ADAR1 depletion in an NAFLD cell model. Overlapping and ferroptosis-related genes were identified using a Venn diagram, while Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were conducted as well. Furthermore, a protein-protein interaction (PPI) network was constructed to identify hub genes associated with ferroptosis. RESULTS: We found the expression level of ADAR1 was downregulated in NAFLD patients and 22 ferroptosis-associated genes were differentially expressed in a NAFLD cell model upon ADAR1 knockdown. Based on PPI network, we identified NOS2, PTGS2, NOX4, ALB, IL6, and CCL5 as the central genes related to ferroptosis. ADAR1 deletion-related NAFLD was found to be involved in the ferroptosis signaling pathway. NOS2, PTGS2, ALB, and IL6 can serve as potential biomarkers. These findings offer new insights and expanded targets for NAFLD prevention and treatment. CONCLUSION: These findings provide new strategies and potential targets for preventing and treating NAFLD. NOS2, PTGS2, ALB, and IL6 may serve as biomarkers for ADAR1 deletion-related NAFLD, which could help for developing its new diagnostic and therapeutic strategies.

A de novo Mutation (p.Gln277X) of Cyclin D2 is Responsible for a Child with Megalencephaly-Polymicrogyria-Polydactyly-Hydrocephalus Syndrome.

Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome (MPPH), a type of overgrowth syndrome, is characterized by progressive megalencephaly, cortical brain malformations, and distal limb anomalies. Previous studies have revealed that the overactivity of the phosphatidylinositol 3-kinase-Protein kinase B pathway and the increased cyclin D2 (CCND2) expression were the main factors contributing to this disease. Here, we present the case of a patient who exhibited megalencephaly, polymicrogyria, abnormal neuronal migration, and developmental delay. Serum tandem mass spectrometry and chromosome examination did not detect any metabolic abnormalities or copy number variants. However, whole-exome sequencing and Sanger sequencing revealed a de novo nonsense mutation (NM_001759.3: c.829C>T; p.Gln277X) in the CCND2 gene of the patient. Bioinformatics analysis predicted that this mutation may disrupt the structure and surface charge of the CCND2 protein. This disruption could potentially prevent polyubiquitination of CCND2, leading to its resistance against degradation. Consequently, this could drive cell division and growth by altering the activity of key cell cycle regulatory nodes, ultimately contributing to the development of MPPH. This study not only presents a new case of MPPH and expands the mutation spectrum of CCND2 but also enhances our understanding of the mechanisms connecting CCND2 with overgrowth syndromes.

Mechanism of static loading injury in human skeletal muscle cells.

OBJECTIVE: To establish a cellular-level mechanical injury model for human skeletal muscle cells and investigate changes in the mechanical effect mechanism after such injuries. METHODS: The FX-5000™ Compression System was used to apply constant static mechanical pressure to human skeletal muscle cells. A factorial design analysis was conducted to discover the optimal injury model by evaluating the correlation between the amount of pressure, the duration of mechanical stimulation, and the number of days of observation. Skeletal muscle cell injury was evaluated by measuring cell metabolism, morphology, and calcium homeostasis. RESULTS: Mechanical injury was modeled as continuous pressure of 1 MPa for 2 hours with observation for 3 days. The results show that mechanical injury increased creatine kinase, intracellular Ca2+ concentration, and malondialdehyde content, decreased superoxide dismutase, and caused cell swelling and severe cytoplasmic vacuolization (all P < 0.05). CONCLUSION: This model of mechanically-injured human skeletal muscle cells provides an experimental model for the clinically common skeletal muscle injury caused by static loading pressure. It may be used to study the mechanism of action of treatment methods for mechanically injured skeletal muscle.

Carexqingyuanensis (Cyperaceae), a new species from Guangdong, China.

Carexqingyuanensis, a new species of Cyperaceae from Guangdong Province, China, is described and illustrated. The new species is morphologically similar to Carexpeliosanthifolia F. T. Wang & Tang ex P. C. Li, but it can be distinguished by the racemose inflorescence branches appearing single (rarely binate or ternate) (vs. binate or ternate), one (rarely two or three) (vs. 1-3) spiked, male part of linear-cylindrical spikes much longer than the female part (vs. just male part short-cylindrical and slightly longer than female part), style base thickened (vs. not thickened) and perigynium horizontally patent with a short (vs. long and excurved) beak. Phylogenetic analysis, based on the two nuclear DNA regions (ETS 1f and ITS) and three chloroplast DNA regions (matK, ndhF and rps16), suggests that the new species belongs to sect. Siderostictaes.s. of subg. Siderosticta and shows a closer phylogenetic relationship to Carexscaposa C. B. Clarke.

Network and Experimental Pharmacology on Mechanism of Yixintai Regulates the TMAO/PKC/NF-κB Signaling Pathway in Treating Heart Failure.

Objective: This study aims to explore the mechanism of action of Yixintai in treating chronic ischemic heart failure by combining bioinformatics and experimental validation. Materials and Methods: Five potential drugs for treating heart failure were obtained from Yixintai (YXT) through early mass spectrometry detection. The targets of YXT for treating heart failure were obtained by a search of online databases. Gene ontology (GO) functional enrichment analysis and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment analyses were conducted on the common targets using the DAVID database. A rat heart failure model was established by ligating the anterior descending branch of the left coronary artery. A small animal color Doppler ultrasound imaging system detected cardiac function indicators. Hematoxylin-eosin (HE), Masson's, and electron microscopy were used to observe the pathological morphology of the myocardium in rats with heart failure. The network pharmacology analysis results were validated by ELISA, qPCR, and Western blotting. Results: A total of 107 effective targets were obtained by combining compound targets and eliminating duplicate values. PPI analysis showed that inflammation-related proteins (TNF and IL1B) were key targets for treating heart failure, and KEGG enrichment suggested that NF-κB signaling pathway was a key pathway for YXT treatment of heart failure. Animal model validation results indicated the following: YXT can significantly reduce the content of intestinal microbiota metabolites such as trimethylamine oxide (TMAO) and improve heart failure by improving the EF and FS values of heart ultrasound in rats and reducing the levels of serum NT-proBNP, ANP, and BNP to improve heart failure. Together, YXT can inhibit cardiac muscle hypertrophy and fibrosis in rats and improve myocardial ultrastructure and serum IL-1ß, IL-6, and TNF-α levels. These effects are achieved by inhibiting the expressions of NF-κB and PKC. Conclusion: YXT regulates the TMAO/PKC/NF-κB signaling pathway in heart failure.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Photosynthetic carbon allocation in native and invasive salt marshes undergoing hydrological change: A mesocosm experiment.

Biogeochemical processes mediated by plants and soil in coastal marshes are vulnerable to environmental changes and biological invasion. In particular, tidal inundation and salinity stress will intensify under future rising sea level scenarios. In this study, the interactive effects of flooding regimes (non-waterlogging vs. waterlogging) and salinity (0, 5, 15, and 30 parts per thousand (ppt)) on photosynthetic carbon allocation in plant, rhizodeposition, and microbial communities in native (Phragmites australis) and invasive (Spartina alterniflora) marshes were investigated using mesocosm experiments and 13CO2 pulse-labeling techniques. The results showed that waterlogging and elevated salinity treatments decreased specific root allocation (SRA) of 13C, rhizodeposition allocation (RA) 13C, soil 13C content, grouped microbial PLFAs, and the fungal 13C proportion relative to total PLFAs-13C. The lowest SRA, RA, and fungal 13C proportion occurred under the combined waterlogging and high (30 ppt) salinity treatments. Relative to S. alterniflora, P. australis displayed greater sensitivity to hydrological changes, with a greater reduction in rhizodeposition, soil 13C content, and fungal PLFAs. S. alterniflora showed an earlier peak SRA but a lower root/shoot 13C ratio than P. australis. This suggests that S. alterniflora may transfer more photosynthetic carbon to the shoot and rhizosphere to facilitate invasion under stress. Waterlogging and high salinity treatments shifted C allocation towards bacteria over fungi for both plant species, with a higher allocation shift in S. alterniflora soil, revealing the species-specific microbial response to hydrological stresses. Potential shifts towards less efficient bacterial pathways might result in accelerated carbon loss. Over the study period, salinity was the primary driver for both species, explaining 33.2-50.8 % of 13C allocation in the plant-soil-microbe system. We propose that future carbon dynamics in coastal salt marshes under sea-level rise conditions depend on species-specific adaptive strategies and carbon allocation patterns of native and invasive plant-soil systems.

Direct reduction of NO into N2 catalyzed by fullerene-supported rhodium clusters.

Catalytic conversion of NO has long been a focus of atmospheric pollution control and diesel vehicle exhaust treatment. Rhodium is one of the most effective metals for catalyzing NO reduction, and understanding the nature of the active sites and underlying mechanisms can help improve the design of Rh-based catalysts towards NO reduction. In this work, we investigated the detailed catalytic mechanisms for the direct reduction of NO to N2 by fullerene-supported rhodium clusters, C60Rh4+, with density functional theory calculations. We found that the presence of C60 facilitates the smooth reduction of NO into N2 and O2, as well as their subsequent desorption, recovering the catalyst C60Rh4+. Such a process fails to be completed by free Rh4+, emphasizing the critical importance of C60 support. We attribute the novel performance of C60Rh4+ to the electron sponge effect of C60, providing useful guidance for designing efficient catalysts for the direct reduction of NO.

Supplements for cognitive ability in patients with mild cognitive impairment or Alzheimer's disease: a protocol for systematic review and network meta-analysis of randomised controlled trials.

INTRODUCTION: Considering the increasing incidence of Alzheimer's disease (AD) and mild cognitive impairment (MCI) worldwide, there is an urgent need to identify efficacious, safe and convenient treatments. Numerous investigations have been conducted on the use of supplements in this domain, with oral supplementation emerging as a viable therapeutic approach for AD or MCI. Nevertheless, given the multitude of available supplements, it becomes imperative to identify the optimal treatment regimen. METHODS AND ANALYSIS: Eight academic databases and three clinical trial registries will be searched from their inception to 1 June 2023. To identify randomised controlled trials investigating the effects of supplements on patients with AD or MCI, two independent reviewers (X-YZ and Y-QL) will extract relevant information from eligible articles, while the risk of bias in the included studies will be assessed using the Rob 2.0 tool developed by the Cochrane Collaboration. The primary outcome of interest is the overall cognitive function. Pair-wise meta-analysis will be conducted using RevMan V.5.3, while network meta-analysis will be carried out using Stata 17.0 and ADDIS 1.16.8. Heterogeneity test, data synthesis and subgroup analysis will be performed if necessary. The GRADE system will be employed to assess the quality of evidence. This study is scheduled to commence on 1 June 2023 and conclude on 1 October 2023. ETHICS AND DISSEMINATION: Ethics approval is not required for systematic review and network meta-analysis. The results will be submitted to a peer-reviewed journal or at a conference. TRIAL REGISTRATION NUMBER: PROSPERO (CRD42023414700).