[Effects of colpotomic approaches on prognosis and recurrence sites of stage â a2-â ¡a2 cervical cancer after laparoscopic radical hysterectomy].

Objective: To investigate the factors affecting the prognosis of stage Ⅰa2-Ⅱa2 cervical cancer after laparoscopic radical hysterectomy (LRH), and to compare the prognosis and recurrence sites of patients with different colpotomy paths. Methods: The clinical data of 965 patients with stage Ⅰa2-Ⅱa2 cervical cancer who underwent LRH in the First Affiliated Hospital of Army Medical University from January 2015 to December 2018 were collected. The median age was 47.0 years of all patients with a median follow-up of 62 months (48-74 months). Cox regression was used to perform the univariate and multivariate analysis of the clinicopathological factors associated with the prognosis that included disease-free survival (DFS) and overall survival (OS). Patients were categorized into LRH through vaginal colpotomy (VC group, n=475) and LRH through intracorporeal colpotomy (IC group, n=490) according to the colpotomic approaches. The prognosis and recurrence sites of patients in each group were compared. Results: (1) During the follow-up period, 137 cases recurred (14.2%, 137/965) and 98 cases died (10.2%, 98/965). The 5-year DFS and OS were 85.8% and 89.9%, respectively. In univariate analysis, positive vaginal margin (PVM) was significantly affected the 5-year OS of patients with cervical cancer (P=0.023), while clinical stage, maximum diameter of tumor, degree of pathological differentiation, lymph node metastasis (LNM), depth of cervical stromal invasion, parametrium involvement, and uterine corpus invasion (UCI) were significantly associated with 5-year DFS and OS in patients with cervical cancer (all P<0.05). In multivariate analysis, clinical stage (HR=1.882, 95%CI: 1.305-2.716), LNM (HR=2.178, 95%CI: 1.483-3.200) and UCI (HR=3.650, 95%CI: 1.906-6.988) were independent risk factors of 5-year DFS (all P<0.001). Clinical stage (HR=2.500, 95%CI: 1.580-3.956), LNM (HR=2.053, 95%CI: 1.309-3.218), UCI (HR=3.984, 95%CI: 1.917-8.280), PVM (HR=3.235, 95%CI: 1.021-10.244) were independent risk factors of 5-year OS (all P<0.05). (2) Different colpotomy paths did not significantly affect the 5-year DFS and OS of patients with stage Ⅰa2-Ⅱa2 cervical cancer. The 5-year DFS in VC group and IC group were 85.9% and 85.6% (P=0.794), and the 5-year OS were 90.8% and 89.3% (P=0.966), respectively. Recurrence patterns consisted of intraperitoneal recurrence, pelvic recurrence, vaginal stump recurrence, and lymph node and distant metastasis. The intraperitoneal recurrence rate of VC group was significantly lower than that of IC group [0.6%(3/468) vs 2.3% (11/485), P=0.037], while the rates of pelvic recurrence, vaginal stump recurrence, lymph node and distant metastasis and overall recurrence were not significantly different between two groups (all P>0.05). Subgroup analysis of patients with different clinical stages, LNM and UCI showed that statistical differences of the intraperitoneal recurrence rates between two groups were only in patients without LNM (0.5% vs 2.3%, P=0.030) or without UCI (0.7% vs 2.3%, P=0.037). Conclusions: Clinical stage, LNM, PVM and UCI are independent risk factors for the prognosis of patients with stage Ⅰa2-Ⅱa2 cervical cancer. For patients without LNM or UCI, LRH through VC could reduce the intraperitoneal recurrence rate, while it is not enough to improve 5-year DFS and OS of patients. Low proportion of intraperitoneal recurrence, intra-operative tumor cells spillage to vagina stump and pelvic cavity might be the explanation.

[Current situation and deliberating the application of open or minimally invasive surgery for the cervical cancer].

Surgery is the primary treatment for early cervical cancer. Radical hysterectomy by laparotomy and minimally invasive surgery have been widely used for years. The results of the LACC study has overturned the clinical practice of the cervical cancer, and the radical hysterectomy by laparotomy is the only standard operation. Based on the studies of laparoscopy or robot-assisted laparoscopy comparing laparotomy for the risk factors of survival outcomes, as well as a series of methods for improving oncology outcomes, it suggests that the minimally invasive surgical approach in early cervical cancer should be reconsidered. Focusing on this topic, this paper discussed the risk factors that might affect the oncology outcome of minimally invasive surgery, and analyzed the surgical indications and recurrence patterns. Hence, to promote the standardized operation of "tumor-free" in the procedure of the minimally invasive surgery might be improve the patient survival outcomes.

Combinatorial ASO-mediated therapy with low dose SMN and the protective modifier Chp1 is not sufficient to ameliorate SMA pathology hallmarks.

Spinal muscular atrophy (SMA) is a devastating genetically inherited neuromuscular disorder characterized by the progressive loss of motor neurons in the spinal cord, leading to muscle atrophy and weakness. Although SMA is caused by homozygous mutations in SMN1, the disease severity is mainly determined by the copy number of SMN2, an almost identical gene that produces ~10% correctly spliced SMN transcripts. Recently, three FDA- and EMA-approved therapies that either increase correctly spliced SMN2 transcripts (nusinersen and risdiplam) or replace SMN1 (onasemnogen abeparvovec-xioi) have revolutionized the clinical outcome in SMA patients. However, for severely affected SMA individuals carrying only two SMN2 copies even a presymptomatic therapy might be insufficient to fully counteract disease development. Therefore, SMN-independent compounds supporting SMN-dependent therapies represent a promising therapeutic approach. Recently, we have shown a significant amelioration of SMA disease hallmarks in a severely affected SMA mouse carrying a mutant Chp1 allele when combined with low-dose of SMN antisense oligonucleotide (ASO) treatment. CHP1 is a direct interacting partner of PLS3, a strong protective modifier of SMA. Both proteins ameliorate impaired endocytosis in SMA and significantly restore pathological hallmarks in mice. Here, we aimed to pharmacologically reduce CHP1 levels in an ASO-based combinatorial therapy targeting SMN and Chp1. Chp1 modulation is a major challenge since its genetic reduction to ~50% has shown to ameliorate SMA pathology, while the downregulation below that level causes cerebellar ataxia. Efficacy and tolerability studies determined that a single injection of 30 µg Chp1-ASO4 in the CNS is a safe dosage that significantly reduced CHP1 levels to ~50% at postnatal day (PND)14. Unfortunately, neither electrophysiological predictors such as compound muscle action potential (CMAP) or motor unit number estimation (MUNE) nor histological hallmarks of SMA in neuromuscular junction (NMJ), spinal cord or muscle were ameliorated in SMA mice treated with Chp1-ASO4 compared to CTRL-ASO at PND21. Surprisingly, CHP1 levels were almost at control level 4-weeks post injection, indicating a rather short-term effect of the ASO. Therefore, we re-administrated Chp1-ASO4 by i.c.v. bolus injection at PND28. However, no significant improvement of SMA hallmarks were seen at 2 month-of-age either. In conclusion, in contrast to the protective effect of genetically-induced Chp1 reduction on SMA, combinatorial therapy with Chp1- and SMN-ASOs failed to significantly ameliorate the SMA pathology. Chp1-ASOs compared to SMN-ASO proved to have rather short-term effect and even reinjection had no significant impact on SMA progression, suggesting that further optimization of the ASO may be required to fully explore the combination.

Effect of monensin on milk fatty acid profile in dairy cows and on the use of fatty acids for early diagnosis of elevated blood plasma concentrations of nonesterified fatty acids and hyperketonemia.

This work examined the effects of precalving administration of continuous-release monensin capsule on postcalving milk fatty acid (FA) profile and on the accuracy of FA as a biomarker in the early identification of cows with elevated blood plasma nonesterified fatty acids (NEFA) and ß-hydroxybutyrate (BHB) concentrations. Approximately 3 wk before expected calving, 203 multiparous Estonian Holstein cows were randomly divided into control (CO; n = 116) and experimental (MO; n = 87) groups, and a continuous-release capsule of monensin was administered to the MO cows. Blood samples were taken daily in the first 4 d postpartum, then on the sixth or seventh day in milk, twice in the second week, and thenceforth once per week until the end of the sixth week. Milk samples were taken once from 4 to 7 d in milk, twice in the second week, and thenceforth once per week. Blood samples were analyzed for NEFA and BHB, and milk was analyzed for FA concentrations. Cows with postpartum BHB concentrations ≥1.2 mmol/L at least once during the 6 wk were classified as hyperketonemic (HYK), and cows with NEFA concentrations ≥1.0 mmol/L as having elevated concentration of NEFA (NEFAH). The ability of FA to predict NEFAH and HYK cows was studied with logistic regression and receiver operating characteristic curve analysis and the identification accuracy was estimated by area under the receiver operating characteristic curve. For these analyses, we used FA measured on the ninth day after calving. Monensin administration affected FA mobilization and metabolism of the animals as blood NEFA were lower in the MO group on wk 1 and wk 3, and BHB values were considerably lower from wk 1 to wk 4 compared with the CO group. The FA dynamics were generally similar for MO and CO groups. Monensin administration resulted in higher concentrations of C15:0, C16:0, iso C17:0, anteiso C15:0, anteiso C17:0, total trans monounsaturated FA, and C18:2 cis-9,trans-11, and lower proportions of C18:0, C18:1 cis-9, and most of the iso FA. The identification accuracy of NEFAH and HYK cows was higher in the CO compared with the MO group and for the identification of HYK compared with NEFAH cows (0.75-0.77 vs. 0.78-0.80 in the CO group, and 0.61-0.66 vs. 0.68-0.75 in the MO group for NEFAH vs. HYK, respectively). For all FA, the threshold values to identify NEFAH and HYK cows were different in the CO and MO groups. Results suggest that specific threshold values for the identification of NEFAH and HYK cows could be applicable only within similar feeding conditions and rumen environment.

[Oncologic outcomes of early stage cervical cancer performed operation by different laparoscopic surgical procedures: analysis of clinical data from mutiple centers].

Objective: To evaluate the oncologic outcomes of different laparoscopic radical hysterectomy. Methods: From January 2011 to December 2014, the laparoscopic operation cases of cervical cancer at stage Ⅰb1, Ⅰb2, Ⅱa1 and Ⅱa2, including the histologic subtypes of squamous-cell carcinoma, adenocarcinoma and adenosquamous carcinoma, were collected in five clinical centers. The data were divided into two groups according to the surgical procedures, that is, modified laparoscopic-vaginal radical hysterectomy (mLVRH) and total laparoscopic radical hysterectomy (TLRH). The overall survival rate (OS), disease-free survival rate (DFS) at 5 years were retrospectively analyzed in this study. Results: There were 674 cases in total, including 377 cases of mLVRH, 297 cases of TLRH. (1) The OS at 5 years: the mLVRH was 96.1% and the TLRH was 92.0%, and the mLVRH was higher than that of TLRH （P=0.010）. Stratify analysis， including stage of disease （Ⅰb1 and Ⅱa1）， histologic subtypes （squamous-cell carcinoma, adenocarcinoma）， lymph node metastasis， revealed that, ① Stage of disease: in stage Ⅰb1, the OS at five years of mLVRH was higher than that in TLRH group （98.6% vs 93.6%, P=0.012）. In stage Ⅱa1, there was significant difference between the two groups, the OS at five years of mLVRH and TLRH were 93.6% and 77.6% （P=0.007）. ② Histologic subtypes: for the OS at five years of squamous-cell carcinoma, mLVRH and TLRH were 96.1% and 92.3%, and there was significant difference （P=0.046）； for adenocarcinoma, the OS at five years were 91.0% and 88.6%， and there was no difference between two groups （P=0.230）. ③ Lymph node metastasis： the mLVRH and TLRH with lymph node metastasis, the OS at five years were 98.6% and 96.4%; the mLVRH and TLRH without lymph node metastasis, the OS at five years were 89.3% and 80.8%. There were no significant differences between the two groups,respectively (P=0.156， P=0.093）. (2) The DFS at 5 years: there was no significant difference between mLVRH and TLRH (94.1% vs 90.9%, P=0.220). Stratify analysis for stage of disease, the mLVRH group was higher than that in the TLRH group in stage Ⅰb1 (97.0% vs 92.8%, P=0.039). However, for stage Ⅱa1, there was no significant difference between mLVRH and TLRH group （88.2% vs 75.8%, P=0.074）. Conclusions: The results of this retrospective study indicated that different laparoscopy surgical procedures had diverse oncologic outcomes. The OS at 5 years of the mLVRH is superior to the TLRH. The DFS at 5 years in Ⅰb1 stage, the mLVRH is higher than the TLRH. Therefore, the modified laparoscopy is still an alternative surgery for early cervical cancer patients when following the principle of no-tumor-exposure.

Body condition and insulin resistance interactions with periparturient gene expression in adipose tissue and lipid metabolism in dairy cows.

Adipose tissue plays an important role in a cow's ability to adapt to the metabolic demands of lactation, because of its central involvement in energy metabolism and immunity. High adiposity and adipose tissue resistance to insulin are associated with excessive lipid mobilization. We hypothesized that the response to a glucose challenge differs between cows of different body condition 21 d before and after calving and that the responses are explainable by gene expression in subcutaneous adipose tissue (SAT). In addition, we aimed to investigate insulin resistance with gene expression in SAT and lipid mobilization around parturition. Multiparous Holstein cows were grouped according to body conditions score (BCS) 4 wk before calving, as follows: BCS ≤ 3.0 = thin (T, n = 14); BCS 3.25 to 3.5 = optimal (O, n = 14); BCS ≥ 3.75 = over-conditioned (OC, n = 14). We collected SAT on d -21 and d 21 relative to calving. A reverse-transcriptase quantitative (RT-q)PCR was used to measure gene expression related to lipid metabolism. One hour after the collection of adipose tissue, an intravenous glucose tolerance test was carried out, with administration of 0.15 g of glucose per kg of body weight (with a 40% glucose solution). Once weekly from the first week before calving to the third week after calving, a blood sample was taken. The transition to lactation was associated with intensified release of energy stored in adipose tissue, a decrease in the lipogenic genes lipoprotein lipase (LPL) and diacylglycerol O-acyltransferase 2 (DGAT2), and an increase in the lipolytic gene hormone-sensitive lipase (LIPE). On d -21, compared with T cows, OC cows had lower mRNA abundance of LPL and DGAT2, and the latency of fatty acid response after glucose infusion was also longer (8.5 vs. 23.3 min) in OC cows. Cows with higher insulin area under the curve on d -21 had concurrently lower LPL and DGAT2 gene expression and greater concentration of fatty acids on d -7, d 7, and d 14. In conclusion, high adiposity prepartum lowers the whole-body lipid metabolism response to insulin and causes reduced expression of lipogenic genes in SAT 3 weeks before calving. In addition, more pronounced insulin release after glucose infusion on d -21 is related to higher lipid mobilization around calving, indicating an insulin-resistant state, and is associated with lower expression of lipogenic genes in SAT.

Effect of alternative intravenous lipid emulsion in clinical outcome in non-critically ill patients.

INTRODUCTION: Most studies on alternative intravenous lipid emulsion (IVLE) versus conventional IVLE have been conducted in the critically ill patients. The benefits of alternative IVLE in non-critically ill patients is uncertain. We aim to determine clinical outcome difference between alternative IVLE versus conventional IVLE in non-critically ill patients. METHOD: All patients on parenteral nutrition (PN) from July 2007 to September 2010 were identified. Patients were stratified into two groups: conventional IVLE (soybean oil-based) and alternative IVLEs, namely MCT oil-based, olive oil-based and fish oil-containing IVLE. RESULT: Three hundred and eighty-eight patients were included in the study. Ninety-one patients received soybean-based IVLE, 59 patients received MCT oil-based IVLE, 141 patients received olive oil-based IVLE and 97 patients received fish oil-containing IVLE. Adjusting the effect of baseline covariates in separate multiple linear/logistic regression models, there were no differences in mortality, readmission, length of stay and infection between conventional IVLE group and alternative IVLEs group, the adjusted p-value was 0.64, 0.06, 0.36 and 0.18 respectively. However, there was a significant change in day 5 CRP between these two groups (8.43 g/L (SD 112.2) vs -41.2 (SD 106.4); adjusted p-value = 0.01). There was no difference in day 5 albumin between these two group (-1.03 (SD 5.1) vs -0.1 (SD 5.3); adjusted p-value = 0.08). CONCLUSION: Our study showed that pertinent clinical outcomes in non-critically ill patients who received either conventional IVLE or alternative IVLEs were the same. However, there was significant reduction in day-5 CRP in alternative IVLE compared to conventional IVLE.

Influence of functional food components on gut health.

Intestinal epithelial cells (IECs) lining the gastrointestinal tract establish a barrier between external environments and the internal milieu. An intact intestinal barrier maintains gut health and overall good health of the body by preventing from tissue injury, pathogen infection and disease development. When the intestinal barrier function is compromised, bacterial translocation can occur. Our gut microbiota also plays a fundamentally important role in health, for example, by maintaining intestinal barrier integrity, metabolism and modulating the immune system, etc. Any disruption of gut microbiota composition (also termed dysbiosis) can lead to various pathological conditions. In short, intestinal barrier and gut microbiota are two crucial factors affecting gut health. The gastrointestinal tract is a complex environment exposed to many dietary components and commensal bacteria. Dietary components are increasingly recognized to play various beneficial roles beyond basic nutrition, resulting in the development of the functional food concepts. Various dietary modifiers, including the consumption of live bacteria (probiotics) and ingestible food constituents such as prebiotics, as well as polyphenols or synbiotics (combinations of probiotics and prebiotics) are the most well characterized dietary bioactive compounds and have been demonstrated to beneficially impact the gut health and the overall well-being of the host. In this review we depict the roles of intestinal epithelium and gut microbiota in mucosal defence responses and the influence of certain functional food components on the modulation of gut health, with a particular focus on probiotics, prebiotics and polyphenols.

Effects of human rhinovirus on epithelial barrier integrity and function in children with asthma.

BACKGROUND: Bronchial epithelial tight junctions (TJ) have been extensively assessed in healthy airway epithelium. However, no studies have yet assessed the effect of human rhinovirus (HRV) infection on the expression and resultant barrier function in epithelial tight junctions (TJ) in childhood asthma. OBJECTIVES: To investigate the impact of HRV infection on airway epithelial TJ expression and barrier function in airway epithelial cells (AECs) of children with and without asthma. Furthermore, to test the hypothesis that barrier integrity and function is compromised to a greater extent by HRV in AECs from asthmatic children. METHODS: Primary AECs were obtained from children with and without asthma, differentiated into air-liquid interface (ALI) cultures and infected with rhinovirus. Expression of claudin-1, occludin and zonula occluden-1 (ZO-1) was assessed via qPCR, immunocytochemistry (ICC), in-cell western (ICW) and confocal microscopy. Barrier function was assessed by transepithelial electrical resistance (TER; RT ) and permeability to fluorescent dextran. RESULTS: Basal TJ gene expression of claudin-1 and occludin was significantly upregulated in asthmatic children compared to non-asthmatics; however, no difference was seen with ZO-1. Interestingly, claudin-1, occludin and ZO-1 protein expression was significantly reduced in AEC of asthmatic children compared to non-asthmatic controls suggesting possible post-transcriptional inherent differences. HRV infection resulted in a transient dissociation of TJ and airway barrier integrity in non-asthmatic children. Although similar dissociation of TJ was observed in asthmatic children, a significant and sustained reduction in TJ expression concurrent with both a significant decrease in TER and an increase in permeability in asthmatic children was observed. CONCLUSION: This study demonstrates novel intrinsic differences in TJ gene and protein expression between AEC of children with and without asthma. Furthermore, it correlates directly the relationship between HRV infection and the resultant dissociation of epithelial TJ that causes a continued altered barrier function in children with asthma.

Adipose tissue insulin receptor and glucose transporter 4 expression, and blood glucose and insulin responses during glucose tolerance tests in transition Holstein cows with different body condition.

Glucose uptake in tissues is mediated by insulin receptor (INSR) and glucose transporter 4 (GLUT4). The aim of this study was to examine the effect of body condition during the dry period on adipose tissue mRNA and protein expression of INSR and GLUT4, and on the dynamics of glucose and insulin following the i.v. glucose tolerance test in Holstein cows 21 d before (d -21) and after (d 21) calving. Cows were grouped as body condition score (BCS) ≤3.0 (thin, T; n = 14), BCS = 3.25 to 3.5 (optimal, O; n = 14), and BCS ≥3.75 (overconditioned, OC; n = 14). Blood was analyzed for glucose, insulin, fatty acids, and ß-hydroxybutyrate concentrations. Adipose tissue was analyzed for INSR and GLUT4 mRNA and protein concentrations. During the glucose tolerance test 0.15 g/kg of body weight glucose was infused; blood was collected at -5, 5, 10, 20, 30, 40, 50, and 60 min, and analyzed for glucose and insulin. On d -21 the area under the curve (AUC) of glucose was smallest in group T (1,512 ± 33.9 mg/dL × min) and largest in group OC (1,783 ± 33.9 mg/dL × min), and different between all groups. Basal insulin on d -21 was lowest in group T (13.9 ± 2.32 µU/mL), which was different from group OC (24.9 ± 2.32 µU/mL. On d -21 the smallest AUC 5-60 of insulin in group T (5,308 ± 1,214 µU/mL × min) differed from the largest AUC in group OC (10,867 ± 1,215 µU/mL × min). Time to reach basal concentration of insulin in group OC (113 ± 14.1 min) was longer compared with group T (45 ± 14.1). The INSR mRNA abundance on d 21 was higher compared with d -21 in groups T (d -21: 3.3 ± 0.44; d 21: 5.9 ± 0.44) and O (d -21: 3.7 ± 0.45; d 21: 4.7 ± 0.45). The extent of INSR protein expression on d -21 was highest in group T (7.3 ± 0.74 ng/mL), differing from group O (4.6 ± 0.73 ng/mL), which had the lowest expression. The amount of GLUT4 protein on d -21 was lowest in group OC (1.2 ± 0.14 ng/mL), different from group O (1.8 ± 0.14 ng/mL), which had the highest amount, and from group T (1.5 ± 0.14 ng/mL). From d -21 to 21, a decrease occurred in the GLUT4 protein levels in both groups T (d -21: 1.5 ± 0.14 ng/mL; d 21: 0.8 ± 0.14 ng/mL) and O (d -21: 1.8 ± 0.14 ng/mL; d 21: 0.8 ± 0.14 ng/mL). These results demonstrate that in obese cows adipose tissue insulin resistance develops prepartum and is related to reduced GLUT4 protein synthesis. Regarding glucose metabolism, body condition did not affect adipose tissue insulin resistance postpartum.

Distributed State Estimation Using a Modified Partitioned Moving Horizon Strategy for Power Systems.

In this paper, a distributed state estimation method based on moving horizon estimation (MHE) is proposed for the large-scale power system state estimation. The proposed method partitions the power systems into several local areas with non-overlapping states. Unlike the centralized approach where all measurements are sent to a processing center, the proposed method distributes the state estimation task to the local processing centers where local measurements are collected. Inspired by the partitioned moving horizon estimation (PMHE) algorithm, each local area solves a smaller optimization problem to estimate its own local states by using local measurements and estimated results from its neighboring areas. In contrast with PMHE, the error from the process model is ignored in our method. The proposed modified PMHE (mPMHE) approach can also take constraints on states into account during the optimization process such that the influence of the outliers can be further mitigated. Simulation results on the IEEE 14-bus and 118-bus systems verify that our method achieves comparable state estimation accuracy but with a significant reduction in the overall computation load.

Impaired airway epithelial cell responses from children with asthma to rhinoviral infection.

BACKGROUND: The airway epithelium forms an effective immune and physical barrier that is essential for protecting the lung from potentially harmful inhaled stimuli including viruses. Human rhinovirus (HRV) infection is a known trigger of asthma exacerbations, although the mechanism by which this occurs is not fully understood. OBJECTIVE: To explore the relationship between apoptotic, innate immune and inflammatory responses to HRV infection in airway epithelial cells (AECs) obtained from children with asthma and non-asthmatic controls. In addition, to test the hypothesis that aberrant repair of epithelium from asthmatics is further dysregulated by HRV infection. METHODS: Airway epithelial brushings were obtained from 39 asthmatic and 36 non-asthmatic children. Primary cultures were established and exposed to HRV1b and HRV14. Virus receptor number, virus replication and progeny release were determined. Epithelial cell apoptosis, IFN-ß production, inflammatory cytokine release and epithelial wound repair and proliferation were also measured. RESULTS: Virus proliferation and release was greater in airway epithelial cells from asthmatics but this was not related to the number of virus receptors. In epithelial cells from asthmatic children, virus infection dampened apoptosis, reduced IFN-ß production and increased inflammatory cytokine production. HRV1b infection also inhibited wound repair capacity of epithelial cells isolated from non-asthmatic children and exaggerated the defective repair response seen in epithelial cells from asthmatics. Addition of IFN-ß restored apoptosis, suppressed virus replication and improved repair of airway epithelial cells from asthmatics but did not reduce inflammatory cytokine production. CONCLUSIONS: Collectively, HRV infection delays repair and inhibits apoptotic processes in epithelial cells from non-asthmatic and asthmatic children. The delayed repair is further exaggerated in cells from asthmatic children and is only partially reversed by exogenous IFN-ß.

Green tea polyphenol epigallocatechin-3-gallate improves epithelial barrier function by inducing the production of antimicrobial peptide pBD-1 and pBD-2 in monolayers of porcine intestinal epithelial IPEC-J2 cells.

SCOPE: Green tea has been known to confer numerous health benefits such as the prevention of cardiovascular disease, cancers, and obesity. Epigallocatechin-3-gallate (EGCG) is the major polyphenol present in green tea. Since EGCG is a food-derived component, intestinal epithelial cells lining the gastrointestinal tract are constantly and directly exposed to EGCG. It is anticipated that EGCG can exert beneficial effects in the intestine. The aim of this study was to explore the protective effects of EGCG on intestinal barrier functions against bacterial translocation by using a porcine jejunal epithelial cell line, IPEC-J2. METHODS AND RESULTS: EGCG reduced bacterial translocation across IPEC-J2 cell monolayers through the enhancement of the intestinal epithelial immunological barrier function by inducing secretion of antimicrobial peptides, porcine ß-defensins 1 and 2 (pBD-1 and 2), which possessed higher antimicrobial activity against Escherichia coli. Further mechanistic studies demonstrated that EGCG upregulated pBD-2 but not pBD-1 via the p38 mitogen-activated protein kinase dependent pathway. Such effects were not an "artifact" of hydrogen peroxide, catechin dimers, or other auto-oxidation products generated from EGCG in cell culture media. CONCLUSION: Our results imply that EGCG may be useful for prevention of intestinal disorders or bacterial infection in animals/humans.

Breathomics--exhaled volatile organic compound analysis to detect hepatic encephalopathy: a pilot study.

The current diagnostic challenge with diagnosing hepatic encephalopathy (HE) is identifying those with minimal HE as opposed to the more clinically apparent covert/overt HE. Rifaximin, is an effective therapy but earlier identification and treatment of HE could prevent liver disease progression and hospitalization. Our pilot study aimed to analyse breath samples of patients with different HE grades, and controls, using a portable electronic (e) nose. 42 patients were enrolled; 22 with HE and 20 controls. Bedside breath samples were captured and analysed using an uvFAIMS machine (portable e-nose). West Haven criteria applied and MELD scores calculated. We classify HE patients from controls with a sensitivity and specificity of 0.88 (0.73-0.95) and 0.68 (0.51-0.81) respectively, AUROC 0.84 (0.75-0.93). Minimal HE was distinguishable from covert/overt HE with sensitivity of 0.79 and specificity of 0.5, AUROC 0.71 (0.57-0.84). This pilot study has highlighted the potential of breathomics to identify VOCs signatures in HE patients for diagnostic purposes. Importantly this was performed utilizing a non-invasive, portable bedside device and holds potential for future early HE diagnosis.

First Report of Tomato chlorotic spot virus Infecting Tomatoes in Ohio.

Virus-like symptoms including deformation, discoloration, and necrotic ringspots on green and red fruits of tomato (Solanum lycopersicum L. cv. Big Dena) were observed in a 400 m2 commercial high tunnel in Wayne Co., Ohio, in July and August 2013. No symptoms were observed on leaves. Incidence of symptomatic fruits was approximately 15%. Tomato seedlings transplanted into the high tunnel were produced in a greenhouse containing ornamental plants. The grower observed high levels of thrips infestation in the tomato seedlings prior to transplanting. A tospovirus was suspected as a possible causal agent. Four symptomatic fruits were tested using immunostrip tests for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (Agdia, Inc., Elkhart, IN), a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for Groundnut ringspot virus (GRSV)/Tomato chlorotic spot virus (TCSV) (Agdia, Inc., Elkhart, IN), and DAS-ELISA for TCSV (AC Diagnostics Inc., Fayetteville, AR). All of the symptomatic fruits tested negative with Agdia immunostrips and positive with the Agdia and AC Diagnostics DAS-ELISAs. Total RNA was extracted from one ELISA-positive sample using TRIZOL Reagent (Life Technologies, Carlsbad, CA) and tested in RT-PCR using GRSV- or TCSV-specific primers (2). An expected RT-PCR product was generated using primers derived from TCSV S-RNA (JAP885, 5'-CTCGGTTTTCTGCTTTTC-3' and JAP886, 5'CGGACAGGCTGGAGAAATCG3') (~290 bp) but not when using primers specific to GRSV S-RNA (JAP887, 5'-CGTATCTGAGGATGTTGAGT-3' and JAP888, 5'-GCTAACTCCTTGTTCTTTTG-3'). The 290-bp RT-PCR product was cloned using a TOPO TA cloning kit (Life Technologies, Grand Island, NY), and six clones were sequenced. Sequences from three clones were identical to a consensus sequence of a 292-bp fragment covering part of the TCSV nucleocapsid gene (GenBank Accession No. KJ744213). Sequences of the remaining three clones contained one, two, or three nucleotide mutations. To confirm the presence of TCSV in this sample, two newly designed primers flanking the entire nucleocapsid protein gene (TCSV-F1, 5'-AGTATTATGCATCTATAGATTAGCACA-3' and TCSV-R1, 5'-ACAAATCATCACATTGCCAGGA-') were used in RT-PCR to generate an expected 948-bp product. Upon cloning and sequencing, this fragment was shown to contain a full nucleocapsid protein gene of TCSV (GenBank Accession No. KM610235). The fragment contained a sequence identical to the first 292-bp RT-PCR product. BLASTn analysis (National Center for Biotechnology Information database) showed that the large fragment sequence had 98% nucleotide sequence identity to the TCSV Florida isolate (GenBank Accession No. JX244196) and 94% to the TCSV Physalis isolate (GenBank Accession No. JQ034525). Tobacco plants were inoculated mechanically with sap from symptomatic tomato fruits. Necrotic local lesions developed, and the presence of TCSV was confirmed using AC Diagnostics' DAS-ELISA. TCSV has been reported in Brazil (1), Puerto Rico (3), and Florida (2). To our knowledge, this is the first report of TCSV infecting tomatoes in Ohio. Because TCSV is transmitted by thrips and has a broad host range, this emerging virus could pose a significant threat to the U.S. vegetable industry. References: (1) A. Colariccio et al. Fitopatol. Bras. 20:347, 1995. (2) A. Londoño et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Plant Health Progress doi:10.1094/PHP-2013-0812-01-BR, 2013.