Predictive value of a stemness-based classifier for prognosis and immunotherapy response of hepatocellular carcinoma based on bioinformatics and machine-learning strategies.

Objective: Significant advancements have been made in hepatocellular carcinoma (HCC) therapeutics, such as immunotherapy for treating patients with HCC. However, there is a lack of reliable biomarkers for predicting the response of patients to therapy, which continues to be challenging. Cancer stem cells (CSCs) are involved in the oncogenesis, drug resistance, and invasion, as well as metastasis of HCC cells. Therefore, in this study, we aimed to create an mRNA expression-based stemness index (mRNAsi) model to predict the response of patients with HCC to immunotherapy. Methods: We retrieved gene expression and clinical data of patients with HCC from the GSE14520 dataset and the Cancer Genome Atlas (TCGA) database. Next, we used the "one-class logistic regression (OCLR)" algorithm to obtain the mRNAsi of patients with HCC. We performed "unsupervised consensus clustering" to classify patients with HCC based on the mRNAsi scores and stemness subtypes. The relationships between the mRNAsi model, clinicopathological features, and genetic profiles of patients were compared using various bioinformatic methods. We screened for differentially expressed genes to establish a stemness-based classifier for predicting the patient's prognosis. Next, we determined the effect of risk scores on the tumor immune microenvironment (TIME) and the response of patients to immune checkpoint blockade (ICB). Finally, we used qRT-PCR to investigate gene expression in patients with HCC. Results: We screened CSC-related genes using various bioinformatics tools in patients from the TCGA-LIHC cohort. We constructed a stemness classifier based on a nine-gene (PPARGC1A, FTCD, CFHR3, MAGEA6, CXCL8, CABYR, EPO, HMMR, and UCK2) signature for predicting the patient's prognosis and response to ICBs. Further, the model was validated in an independent GSE14520 dataset and performed well. Our model could predict the status of TIME, immunogenomic expressions, congenic pathway, and response to chemotherapy drugs. Furthermore, a significant increase in the proportion of infiltrating macrophages, Treg cells, and immune checkpoints was observed in patients in the high-risk group. In addition, tumor cells in patients with high mRNAsi scores could escape immune surveillance. Finally, we observed that the constructed model had a good expression in the clinical samples. The HCC tumor size and UCK2 genes expression were significantly alleviated and decreased, respectively, by treatments of anti-PD1 antibody. We also found knockdown UCK2 changed expressions of immune genes in HCC cell lines. Conclusion: The novel stemness-related model could predict the prognosis of patients and aid in creating personalized immuno- and targeted therapy for patients in HCC.

HGCTNet: Handcrafted Feature-Guided CNN and Transformer Network for Wearable Cuffless Blood Pressure Measurement.

Biosignals collected by wearable devices, such as electrocardiogram and photoplethysmogram, exhibit redundancy and global temporal dependencies, posing a challenge in extracting discriminative features for blood pressure (BP) estimation. To address this challenge, we propose HGCTNet, a handcrafted feature-guided CNN and transformer network for cuffless BP measurement based on wearable devices. By leveraging convolutional operations and self-attention mechanisms, we design a CNN-Transformer hybrid architecture to learn features from biosignals that capture both local information and global temporal dependencies. Then, we introduce a handcrafted feature-guided attention module that utilizes handcrafted features extracted from biosignals as query vectors to eliminate redundant information within the learned features. Finally, we design a feature fusion module that integrates the learned features, handcrafted features, and demographics to enhance model performance. We validate our approach using two large wearable BP datasets: the CAS-BP dataset and the Aurora-BP dataset. Experimental results demonstrate that HGCTNet achieves an estimation error of 0.9 ± 6.5 mmHg for diastolic BP (DBP) and 0.7 ± 8.3 mmHg for systolic BP (SBP) on the CAS-BP dataset. On the Aurora-BP dataset, the corresponding errors are -0.4 ± 7.0 mmHg for DBP and -0.4 ± 8.6 mmHg for SBP. Compared to the current state-of-the-art approaches, HGCTNet reduces the mean absolute error of SBP estimation by 10.68% on the CAS-BP dataset and 9.84% on the Aurora-BP dataset. These results highlight the potential of HGCTNet in improving the performance of wearable cuffless BP measurements.

Inactivation of ERK1/2 in cancer-associated hepatic stellate cells suppresses cancer-stromal interaction by regulating extracellular matrix in fibrosis.

The ERK1/2 pathway is involved in epithelial-mesenchymal transformation and cell cycle of tumor cells in hepatocellular carcinoma (HCC). In the present study, we investigated the involvement of ERK1/2 activation on hepatic stellate cells (HSCs). We identified ERK1/2 phosphorylation in activated HSCs of HCC samples. We found that tumor cells promoted the migration and invasion capacity of HSCs by activating ERK1/2 phosphorylation. Using high throughput transcriptome sequencing analysis, we found that ERK1/2 inhibition altered genes significantly correlated to signaling pathways involved in extracellular matrix remodeling. We screened genes and demonstrated that the ERK1/2 inhibition-related gene set significantly correlated to cancer-associated fibroblast infiltration in TCGA HCC tumor samples. Moreover, inhibition of ERK1/2 suppressed tumor cell-induced enhancement of HSC migration and invasion by regulating expression of fibrosis markers FAP, FN1 and COL1A1. In a tumor cell and HSC splenic co-transplanted xenograft mouse model, inhibition of ERK1/2 suppressed liver tumor formation by downregulating fibrosis, indicating ERK1/2 inhibition suppresses tumor-stromal interactions in vivo. Taken together, our data indicate that inhibition of ERK1/2 in tumor-associated HSCs suppresses tumor-stromal interactions and progression. Furthermore, inhibition of ERK1/2 may be a potential target for HCC treatment.

An Ultra-Low Modulus of Ductile TiZrHfTa Biomedical High-Entropy Alloys through Deformation Induced Martensitic Transformation/Twinning/Amorphization.

Biomedical alloys are paramount materials in biomedical applications, particularly in crafting biological artificial replacements. In traditional biomedical alloys, a significant challenge is simultaneously achieving an ultra-low Young's modulus, excellent biocompatibility, and acceptable ductility. A multi-component body-centered cubic (BCC) biomedical high-entropy alloy (Bio-HEA), which is composed of non-toxic elements, is noteworthy for its outstanding biocompatibility and compositional tuning capabilities. Nevertheless, the aforementioned challenges still remain. Here, a method to achieve a single phase with the lowest Young's modulus among the constituent phases by precisely tuning the stability of the BCC phase in the Bio-HEA, is proposed. The subtle tuning of the BCC phase stability also enables the induction of stress-induced martensite transformation with extremely low trigger stress. The transformation-induced plasticity and work hardening capacity are achieved via the stress-induced martensite transformation. Additionally, the hierarchical stress-induced martensite twin structure and crystalline-to-amorphous phase transformation provide robust toughening mechanisms in the Bio-HEA. The cytotoxicity test confirms that this Bio-HEA exhibits excellent biocompatibility without cytotoxicity. In conclusion, this study provides new insights into the development of biomedical alloys with a combination of ultra-low Young's modulus, excellent biocompatibility, and decent ductility.

Long noncoding RNA LINC00665 is a diagnostic biomarker that enhances cell proliferation and migration in hepatocellular carcinoma.

BACKGROUND: This study aimed to evaluate the relationship between LINC00665 expression levels and the risk of hepatocellular carcinoma (HCC) in Chinese Han nationality patients and to explore the influence of LINC00665 dysregulation on the proliferation and migration potential of HCC cells. PATIENTS AND METHODS: We investigated the expression of LINC00665 in The Cancer Genome Atlas (TCGA) database. Then, we confirmed the expression of LINC00665 in 54 pairs of surgical tissues from HCC patients and in liver cancer cell lines by quantitative real-time polymerase chain reaction. Furthermore, we manipulated the expression level of LINC00665 and examined the cell proliferation and migration abilities of HCC cells. RESULTS: In the TCGA cohort, a high level of LINC00665 in patients with HCC was significantly associated with tumor stage, tumor differentiation grade, and overall survival. In our HCC patient cohort, overexpression of LINC00665 in patients showed positive correlations with alpha-fetoprotein level, Barcelona Clinic Liver Cancer stage, and tumor differentiation grade. In addition, LINC00665 was upregulated in HCC cells, especially in cells with rapid growth rates and high migration abilities. A new LINC00665 isoform with a length of 1,371 nucleotides was identified in MHCC-97H cells. Interfering with LINC00665 expression weakened the proliferation and migration abilities of HCC cells. In contrast, LINC00665 overexpression enhanced proliferation and migration abilities. CONCLUSION: LINC00665 was upregulated in HCC tissues and cells and might be used to predict a poor prognosis of HCC patients. In addition, LINC00665 may promote the malignant progression of HCC by enhancing proliferation and migration capacities.

Exploring the effects and mechanisms of Guizhigancao Decoction on heart failure using an integrated approach based on experimental support and network pharmacology strategy.

Background and aim: HF (Heart Failure) is the leading cause of mortality and is a significant clinical problem affecting millions of patients worldwide. To date, the mechanisms of HF remain largely elusive. The effective treatments contributing to HF remain incompletely understood. Therefore, the development of an effective strategy for HF is urgently needed. Experimental procedure: In the present study, we devoted to investigating the effective treatments and sought to systematically decipher the related molecular mechanisms of Guizhigancao Decoction (GZGCD, Cinnamomum cassia Presl and Glycyrrhizae Radix Et Rhizoma Praeparata Cum Melle) for treating HF. We examined the therapeutic effect of GZGCD on HF in vivo. An integrative approach combining biomarker examination, echocardiography, myocardial fibrosis and cardiac apoptosis condition using Masson and TUNEL staining was performed to assess the efficacy of GZGCD against HF. Subsequently, comprehensive network pharmacology analyses were performed to explore the mechanisms involved in GZGCD therapeutic effects on HF. Results and conclusions: The results showed that GZGCD could reverse cardiac function in rats with HF by reducing NT-proBNP, increasing EF, decreasing LVESV, LVEDV, LVIDs, LVIDd, increasing running time, and ameliorate myocardial collagen fiber hyperplasia and cardiomyocyte apoptosis. We showed that GZGCD might contribute to HF treatment via oxidative related pathways through bioinformatics. Eventually, promising compound quercetin in GZGCD for HF therapeutics was proposed in database-based analysis. Collectively, our findings indicate that GZGCD has a treatment effect on HF. We proposed that GZGCD might contribute HF treatment via oxidative response-related pathways.

A novel hepatocellular carcinoma-specific mTORC1-related signature for anticipating prognosis and immunotherapy.

Tumor oncogenesis, cancer metastasis, and immune evasion were substantially impacted by the mammalian target of the rapamycin complex 1 (mTORC1) pathway. However, in hepatocellular carcinoma (HCC), no mTORC1 signaling-based gene signature has ever been published. mTORC1 scores were computed employing a single sample gene set enrichment analysis based on databases including the International Cancer Genome Consortium (ICGC) and The Cancer Genome Atlas (TCGA). The PAG1, LHFPL2, and FABP5 expression levels were obtained to construct a mTORC1 pathway-related model. In two databases, the overall survival (OS) rate was shorter for high-mTORC1 score patients compared to those with low scores. The activation of TFs in the group with high risk was enhanced, such as the HIF-1 pathway. Additionally, it was discovered that a high mTORC1 score was linked to an immune exclusion phenotype and enhanced immunosuppressive cell infiltration. Notably, it was discovered that high-mTORC1 scores patients had poorer immunotherapeutic results and might not gain benefit from immunotherapy. When compared to the low HCC metastatic cell lines, the high HCC metastatic cell lines have overexpressed levels of PAG1, LHFPL2, and FABP5 expression. The expression of PAG1, LHFPL2, and FABP5 was inhibited by the MAPK and mTORC1 pathway inhibitors. Our study identified mTORC1 score signature can aid in the development of individualized immunotherapy protocols and predict the HCC patients' prognoses.

System Analysis Based on Pancreatic Cancer Progression Identifies BRINP2 as a Novel Prognostic Biomarker.

Pancreatic adenocarcinoma (PAAD) is a malignant tumor of the digestive system, which develops rapidly and has no obvious early symptoms. This study aims to discover the biomarkers associated with PAAD development. We obtained RNA expression of PAAD patient samples and corresponding clinical data from The cancer genome atlas (TCGA), and screened out BMP/RA-inducible neural-specific protein 2 (BRINP2) gene which is highly associated with PAAD severity. Then, gene ontology (GO) enrichment, Kyoto encyclopedia of genes and genomes (KEGG) pathway analysis and single-sample gene set enrichment analysis (ssGSEA) analysis were performed to explore the biological functions of BRINP2. Subsequently, long non-coding RNA (lncRNAs) associated with BRINP2 were screened out via correlation analysis, and Cox regression analysis and least absolute shrinkage selection operator (LASSO) regression analysis were used to construct the risk prediction model. We further validated the expression level of BRINP2 and its associated lncRNAs in BRINP2-associated lncRNAs prognostic model in vitro. We proposed that BRINP2 might be correlated to the tumor immune microenvironment and could also be used as a biomarker for PAAD progression. GO enrichment analysis and KEGG pathway analysis showed that the prognostic model was highly correlated to immune microenvironment-related pathways. Additionally, we established a BRINP2-associated lncRNAs prognostic model consisting of three lncRNAs. We validated the expression trends of BRINP2 and its associated lncRNAs in BRINP2-associated lncRNAs prognostic model in PAAD cells with various severity of metastatic potential using the quantitative real-time PCR (qRT-PCR). Meanwhile, pRRophetic R package was employed to predict potential therapeutic drugs for BRINP2-associated lncRNAs prognostic model of PAAD. The results suggest that BRINP2 can be used as a novel prognostic biomarker for PAAD.

Identifying a baicalein-related prognostic signature contributes to prognosis prediction and tumor microenvironment of pancreatic cancer.

Pancreatic ductal adenocarcinoma (PDAC) is one of the most malignant and lethal human cancers in the world due to its high metastatic potential, and patients with PDAC have a poor prognosis, yet quite little is understood regarding the underlying biological mechanisms of its high metastatic capacity. Baicalein has a dramatic anti-tumor function in the treatment of different types of cancer. However, the therapeutic effects of baicalein on human PDAC and its mechanisms of action have not been extensively understood. In order to explore the biological characteristic, molecular mechanisms, and potential clinical value of baicalein in inhibiting the metastatic capacity of PDAC. We performed several in vitro, in vivo, and in silico studies. We first examined the potential regulation of baicalein in the metastatic capacity of PDAC cells. We showed that baicalein could dramatically suppress liver metastasis of PDAC cells with highly metastatic potential in mice model. The high-throughput sequencing analysis was employed to explore the biological roles of baicalein in PDAC cells. We found that baicalein might be involved in the infiltration of Cancer-Associated Fibroblasts (CAF) in PDAC. Moreover, a baicalein-related risk model and a lncRNA-related model were built by Cox analysis according to the data set of PDAC from TCGA database which suggested a clinical value of baicalein. Finally, we revealed a potential downstream target of baicalein in PDAC, we proposed that baicalein might contribute to the infiltration of CAF via FGFBP1. Thus, we uncovered a novel role for baicalein in regulation of PDAC liver metastasis that may contribute to its anti-cancer effect. We proposed that baicalein might suppress PDAC liver metastasis via regulation of FGFBP1-mediated CAF infiltration. Our results provide a new perspective on clinical utility of baicalein and open new avenues for the inhibition of liver-metastasis of PDAC.

Cuffless Blood Pressure Measurement Using Smartwatches: A Large-Scale Validation Study.

This study aimed to evaluate the performance of cuffless blood pressure (BP) measurement techniques in a large and diverse cohort of participants. We enrolled 3077 participants (aged 18-75, 65.16% women, 35.91% hypertensive participants) and conducted followed-up for approximately 1 month. Electrocardiogram, pulse pressure wave, and multiwavelength photoplethysmogram signals were simultaneously recorded using smartwatches; dual-observer auscultation systolic BP (SBP) and diastolic BP (DBP) reference measurements were also obtained. Pulse transit time, traditional machine learning (TML), and deep learning (DL) models were evaluated with calibration and calibration-free strategy. TML models were developed using ridge regression, support vector machine, adaptive boosting, and random forest; while DL models using convolutional and recurrent neural networks. The best-performing calibration-based model yielded estimation errors of 1.33 ± 6.43 mmHg for DBP and 2.31 ± 9.57 mmHg for SBP in the overall population, with reduced SBP estimation errors in normotensive (1.97 ± 7.85 mmHg) and young (0.24 ± 6.61 mmHg) subpopulations. The best-performing calibration-free model had estimation errors of -0.29 ± 8.78 mmHg for DBP and -0.71 ± 13.04 mmHg for SBP. We conclude that smartwatches are effective for measuring DBP for all participants and SBP for normotensive and younger participants with calibration; performance degrades significantly for heterogeneous populations including older and hypertensive participants. The availability of cuffless BP measurement without calibration is limited in routine settings. Our study provides a large-scale benchmark for emerging investigations on cuffless BP measurement, highlighting the need to explore additional signals or principles to enhance the accuracy in large-scale heterogeneous populations.

Glycolytic regulatory enzyme PFKFB3 as a prognostic and tumor microenvironment biomarker in human cancers.

The 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3 (PFK-2/FBPase-2, PFKFB3) is a glycolysis regulatory enzyme and plays a key role in oncogenesis of several cancers. However, the systematic study of crosstalk between PFKFB3 and Tumor microenvironment (TME) in pan-cancer has less been examined. In this study, we conducted a comprehensive analysis of the relationship between PFKFB3 expression, patient prognostic, Tumor mutational burden (TMB), Microsatellite instability (MSI), DNA mismatch repair (MMR), and especially TME, including immune infiltration, immune regulator, and immune checkpoint, across 33 types of tumors using datasets of The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO). We found that PFKFB3 expression was significantly correlated with patient prognostic and TME factors in various tumors. Moreover, we confirmed that PFKFB3 was an independent prognostic factor for kidney renal papillary cell carcinoma (KIRP), and established a risk prognostic model based on the expression of PFKFB3 as a clinical risk factor, which has a good predictive ability. Our study indicated that PFKFB3 is a potent regulatory factor for TME and has the potential to be a valuable prognostic biomarker in human tumor therapy.

Long non-coding RNA colon cancer-associated transcript 1-Vimentin axis promoting the migration and invasion of HeLa cells.

BACKGROUND: Long non-coding RNA colon cancer-associated transcript 1 (CCAT1) is involved in transforming multiple cancers into malignant cancer types. Previous studies underlining the mechanisms of the functions of CCAT1 primarily focused on its decoy for miRNAs (micro RNAs). However, the regulatory mechanism of CCAT1-protein interaction associated with tumor metastasis is still largely unknown. The present study aimed to identify proteome-wide CCAT1 partners and explored the CCAT1-protein interaction mediated tumor metastasis. METHODS: CCAT1-proteins complexes were purified and identified using RNA antisense purification coupled with the mass spectrometry (RAP-MS) method. The database for annotation, visualization, and integrated discovery and database for eukaryotic RNA binding proteins (EuRBPDB) websites were used to bioinformatic analyzing CCAT1 binding proteins. RNA pull-down and RNA immunoprecipitation were used to validate CCAT1-Vimentin interaction. Transwell assay was used to evaluate the migration and invasion abilities of HeLa cells. RESULTS: RAP-MS method worked well by culturing cells with nucleoside analog 4-thiouridine, and cross-linking was performed using 365 nm wavelength ultraviolet. There were 631 proteins identified, out of which about 60% were RNA binding proteins recorded by the EuRBPDB database. Vimentin was one of the CCAT1 binding proteins and participated in the tumor metastasis pathway. Knocked down vimetin ( VIM ) and rescued the downregulation by overexpressing CCAT1 demonstrated that CCAT1 could enhance tumor migration and invasion abilities by stabilizing Vimentin protein. CONCLUSION: CCAT1 may bind with and stabilize Vimentin protein, thus enhancing cancer cell migration and invasion abilities.

CDCA8 induced by NF-YA promotes hepatocellular carcinoma progression by regulating the MEK/ERK pathway.

BACKGROUND: Hepatocellular carcinoma (HCC) is one of the most lethal malignant tumors. Cell division cycle associated 8 (CDCA8) is an important multifactorial regulator in cancers. However, its up and downstream targets and effects in HCC are still unclear. METHODS: A comprehensive bioinformatics analysis was performed using The Cancer Genome Atlas dataset (TCGA) to explore novel core oncogenes. We quantified CDCA8 levels in HCC tumors using qRT-PCR. HCC cell's proliferative, migratory, and invasive abilities were detected using a Cell Counting Kit-8 (CCK-8) assay, 5-ethynyl-2'-deoxyuridine (EdU) assay, clone formation, and a Transwell assay. An orthotopic tumor model and tail vein model were constructed to determine the effects of CDCA8 inhibition in vivo. The mechanism underlying CDCA8 was investigated using RNA sequencing. The prognostic value of CDCA8 was assessed with immunohistochemical staining of the tissue microarrays. RESULTS: CDCA8 was identified as a novel oncogene during HCC development. The high expression of CDCA8 was an independent predictor for worse HCC outcomes both in publicly available datasets and in our cohort. We found that CDCA8 knockdown inhibited HCC cell proliferation, colony formation, and migration by suppressing the MEK/ERK pathway in vitro. Moreover, CDCA8 deficiency significantly inhibited tumorigenesis and metastasis. Next-generation sequencing and laboratory validation showed that CDCA8 silencing inhibited the expression of TPM3, NECAP2, and USP13. Furthermore, NA-YA overexpression upregulated the expression of CDCA8. CDCA8 knockdown could attenuate NF-YA-mediated cell invasion in vitro. The expression of NF-YA alone or in combined with CDCA8 were validated as significant independent risk factors for patient survival. CONCLUSION: Our findings revealed that the expression of CDCA8 alone or in combined with NF-YA contributed to cancer progression, and could serve as novel potential therapeutic targets for HCC patients.

[Corrigendum] lncRNA DQ786243 promotes hepatocellular carcinoma cell invasion and proliferation by regulating the miR­15b­5p/Wnt3A axis.

Following the publication of this article, an interested reader drew to the authors' attention that the primer sequences written for lncRNA DQ786243 and miR­15b­5p on p. 2 in the study were incorrect. Upon requesting an explanation of these errors from the authors, they realized that, regarding the sequence of the reverse primer for lncRNA DQ786243, three nucleotides were omitted from its 3'­end [the sequence of this primer on p. 2, right­hand column, line 25 should have been written as 5'­CTTCTGCTGGGCTGTTGAGTG­3' (with the omitted nucleotides highlighted in bold)]. Regarding the primers of miR­15b­5p, the authors used the mature miR­15b­5p sequence as the forward primer; however, they inadvertently overlooked replacing U with T in the description of the forward primer of miR­15b­5p, and therefore the sequence of the forward primer of miR­15b­5p on line 27 should have been written as 5'­TAGCAGCACATCATGGTTTACA­3'. Moreover, a universal reverse primer was used for the reverse primer of miR­15b­5p, as provided by the kit [specifically, the authors used an Mir­X miRNA qRT­PCR TB Green Kit (Takara Bio USA, Inc.) for detecting the expression of miR­15b­5p, and the reverse primer was supplied in the kit]; however, a different primer sequence used in the authors' lab was erroneously written as the reverse primer of miR­15b­5p in the manuscript. Finally, note that the title was published with a typographical error: "miR­15p­5p" in the title should have been written as "miR­15b­5p", as appeared elsewhere throughout the paper, and the corrected title is presented above.  The authors are grateful to the Editor of Molecular Medicine Reports for allowing them the opportunity to publish this corrigendum, and all the authors agree with its publication. The authors also regret the inconvenience that these mistakes have caused. [Molecular Medicine Reports 23: 318, 2021; DOI: 10.3892/mmr.2021.11957].

Identification and validation of a fatty acid metabolism-related lncRNA signature as a predictor for prognosis and immunotherapy in patients with liver cancer.

BACKGROUND: Fatty acid (FA) metabolism is considered the emerging cause of tumor development and metastasis, driving poor prognosis. Long non-coding RNAs (lncRNAs) are closely related to cancer progression and play important roles in FA metabolism. Thus, the discovery of FA metabolism-related lncRNA signatures to predict outcome and immunotherapy response is critical in improving the survival of patients with hepatocellular carcinoma (HCC). METHODS: FA metabolism scores and a FA metabolism-related lncRNA signature were constructed using a single-sample gene set enrichment analysis based on The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases. "ConsensusClusterPlus" was used to screen molecular subtypes. Chi-squared test and Fisher's exact test were applied to explore the relationship between clinical, genomic mutation characteristics and subtypes. Transcription factor (TF) activity scores, cellular distributions, immune cell infiltration, and immunotherapy response were employed to investigate the functions of FA metabolism-related lncRNA signatures. FA metabolism microarray and western blot were performed to detect the biological function of candidate lncRNAs. RESULTS: A total of 70 lncRNAs that highly correlated with FA metabolism scores in two cohorts were used to construct two distinct clusters. Patients in cluster 2 had lower FA metabolism scores and worse survival than those in cluster 1. Patients in cluster 2 exhibited a high frequency of DNA damage, gene mutations, oncogenic signaling such as epithelial-to-mesenchymal transition, and a high degree of immune cell infiltration. Moreover, the lncRNA signature could predict the effects of immunotherapy in patients with HCC. Furthermore, three lncRNAs (SNHG1, LINC00261, and SNHG7) were identified that were highly correlated with FA metabolism. Additionally, SNHG1 and SNHG7 were found to regulate various FA metabolism-related genes and ferroptosis-related genes in vitro experiments. GSEA analysis revealed that SNHG1 and SNHG7 promote fatty acid beta-oxidation. SNHG1 and SNHG7 silencing dramatically reduced lipid droplets in HCC cells. Many immune-infiltration genes and TFs were overexpressed in HCC tissues with SNHG1 and SNHG7 high expression. CONCLUSIONS: A novel molecular model of FA metabolism-related lncRNAs was developed, which has significantly prognostic potential in HCC diagnosis and aids in clinical decision making.

Overexpression of SRD5A3 in Hepatocellular Carcinoma and Its Molecular Mechanism: A Study of Bioinformatics Exploration Analysis with Experimental Verification.

Background: Hepatocellular carcinoma (HCC) is one of the most common cancers worldwide, and more prevalent among males than females. However, the biological role of enzyme 5α-reductase (SRD5A3), which plays a critical role in the androgen receptor signaling pathway during HCC development, remains poorly understood. Methods: ONCOMINE, GEPIA, UALCAN, and Kaplan-Meier Plotter were used to analyze the expression and prognostic value of SRD5A3 in HCC. STRING and Metascape were applied to analyze potential target and molecular pathways underlying SRD5A3 in HCC. A real-time quantitative reverse transcription-polymerase chain reaction was used to validate the downstream target expression of SRD5A3. Results: The expression of SRD5A3 was significantly overexpressed in HCC tissues compared with normal tissues, while the expression of SRD5A1 and SRD5A2 were downregulated in multiple public datasets. It may be that the low methylation of the SRD5A3 promoter leads to its overexpression. The level of SRD5A3 tended to be higher expressed in clinical samples with advanced stage and positive node metastasis. Furthermore, the patients with higher SRD5A3 were remarkably associated with poorer overall survival and disease-free survival in the TCGA data. In addition, the increased mRNA expression of SRD5A3 could predict poorer overall survival in Kaplan-Meier Plotter database including different patient cohorts. Moreover, HCC patients with higher level of SRD5A3 had significantly shorter recurrence-free survival, progression-free survival, and disease-specific survival. Furthermore, enrichment analysis demonstrated that multiple processes, such as steroid hormone biosynthesis, lipid biosynthetic process, and androgen metabolic process, were affected by SRD5A1-3 alterations. In vitro experiments showed that the expression of SRD5A3 was increased in HCC tissues than that in adjacent tissues. SRD5A3 silencing promoted the expression of DOLK in two HCC cell lines. Conclusions: This study identified SRD5A3/DOLK as a novel axis to regulate HCC development.

MMP2 Polymorphisms and Colorectal Cancer Susceptibility in a Chinese Han Population.

Purpose: Colorectal cancer (CRC) is among the most common cancers worldwide and an important cause of cancer-related death. Inherited genetic variation plays a vital role in the occurrence and development of CRC. The aim of this study was to evaluate the association of single nucleotide polymorphisms (SNPs) in MMP2 with CRC risk. Patients and Methods: Three candidates, MMP2 SNPs, rs1053605, rs243849, and rs14070, were selected and genotyped using the Agena MassARRAY RS1000 system, and their association with risk of CRC was evaluated in 663 CRC cases and 663 healthy controls by calculating odds ratio (OR) with 95% confidence interval (95% CI) values. Results: The minor allele of rs243849 (T) was significantly less frequent in cases than controls (p = 0.021), and this SNP was associated with a decreased risk of CRC under co-dominant (p = 0.033), dominant (p = 0.021), and log-additive (p = 0.017) models, after adjusting for confounding factors. After stratification, rs243849 was found to be protective against CRC in patients who were non-smoking, consumed alcohol, and were ≥60 years old (p < 0.05). Conversely, rs1053605 was associated with disease occurrence in patients with CRC who consumed alcohol and were <60 years old (p < 0.05). Furthermore, rs1053605 genotype was associated with an increased risk of colon cancer (p < 0.05), while that of rs243849 was associated with a decreased risk of rectal cancer (p < 0.05). The rs1053605-rs243849 CT haplotype exhibited a protective role in CRC risk, following adjustment for confounders (p = 0.014). The rs14070 SNP was not associated with CRC risk. Finally, the false discovery rate (FDR) method was used to validate the study results. Conclusion: Overall, the MMP2 gene polymorphisms, rs243849 and rs1053605, may be useful for predicting CRC progression.

Isoschaftoside Reverses Nonalcoholic Fatty Liver Disease via Activating Autophagy In Vivo and In Vitro.

Nonalcoholic fatty liver disease (NAFLD) is the most common metabolic liver disease globally, and the incidence of NAFLD has been increasing rapidly year by year. Currently, there is no effective pharmacotherapy for NAFLD. Therefore, studies are urgently needed to explore therapeutic drugs for NAFLD. In this study, we show that isoschaftoside (ISO) dramatically reduces lipid deposition in cells. Meanwhile, ISO treatment reverses the NAFLD and reduces hepatic steatosis in mice. Importantly, we reveal that ISO suppresses the expression of light-chain 3-II (LC3-II) and SQSTM1/p62 in palmitic acid (PA) induced autophagy inhibition in the cell model and the NAFLD mouse model, which suggests that ISO might reverse NAFLD through regulating autophagy flux. We propose that ISO might alleviate hepatic steatosis in NAFLD via regulating autophagy machinery. Consequently, our study suggests that ISO might be of potential clinical value in the field of NAFLD therapy. ISO might have the potential for future therapeutic application.

Assessing systemic vascular resistance using arteriolar pulse transit time based on multi-wavelength photoplethysmography.

Objective.Sympathetic nerve activity affects blood pressure by contracting the arteriole, which can increase systemic vascular resistance (SVR). Consequently, SVR is a key factor affecting blood pressure. However, a method for measuring SVR continuously is lacking. This paper formulated and experimentally validated a method that uses the arteriolar pulse transmit time (aPTT) to track changes in SVR.Approach.multi-wavelength photoplethysmogram (PPG), electrocardiogram (ECG), and galvanic skin response (GSR) data were simultaneously gathered using a measurement system designed by this study. Blood perfusion was monitored by laser Doppler. Least mean square (LMS) is an adaptive filtering algorithm. Our LMS-based algorithm formulated in this study was used to calculate the aPTT from the multi-wavelength PPGs. A cold stimulation experiment was conducted to verify the relationship between aPTT determined by algorithm and arteriole vasodilation. An emotinal stimulation experiment conducted, in which GSR was employed to further verify the relationship between aPTT and SVR. Twenty healthy young participants were asked to watch movie clips, which excited their sympathetic nerves. The dynamic time warping (DTW) distance is applied to evaluate between correlation of GSR and aPTT.Main results.The changes in aPTT was extracted using our LMS-based method. During the recovery period after cold stimulation, aPTT decreased with the average slope of -0.2080, while blood perfusion increased with the average slope of 0.7046. Meanwhile, 70% participants' DTW distances median between aPTT and GSR were significantly smaller than that between PTT and GSR during emotion stimulation.Significance.Our method uses aPTT, a continuous measurable parameter, to closely reflect SVR, as verified through experiments.

DC Surface Flashover Characteristics of Polyimide Containing Polyhedral Oligomeric Silsesquioxane (POSS) in the Main Chains under Vacuum.

Polyimide, which is widely used to insulate power equipment operating in a vacuum environment, is prone to insulation failure due to surface flashover. Using POSS to modify it is an effective solution. This paper focuses on the study of DC surface flashover characteristics in vacuum of POSS/polyimide composite film, by introducing 1%, 3%, 5% equivalent mole content of POSS into polyimide, and conducting a surface flashover characteristics test in vacuum together with pure polyimide. The physical and chemical properties of the composite films were tested utilizing Fourier transform infrared spectroscopy and ultraviolet-visible spectroscopy. Combined with resistivity, SEM, and other test techniques, the influence mechanism of POSS molecular modification on DC surface flashover characteristics of polyimide films in vacuum was initially revealed. The results showed that after the introduction of POSS, the overall functional group structure of polyimide remained unchanged, the intermolecular charge transfer complexation was inhibited, and the transmittance of the film increased. The thermal conductivity and thermogravimetric temperature of the film are improved to a certain extent, and the mechanical properties are slightly decreased. With the increase of the introduced POSS content, the dielectric strength of the composite film is also enhanced. The surface flashover voltage of the composite film with a POSS content of 5% is 17.5 kV in vacuum, which is 30.5% higher than that of the pure film. Further analysis shows that the introduction of POSS will reduce the resistivity of the composite film, accelerate the dissipation of surface charges, and increase the flashover voltage. In addition, POSS forms a uniformly distributed Si-O-Si cage-like structure through molecular modification. When the surface of the film is damaged, SiOx inorganic flocculent particles are generated, which can not only scatter electrons, but also shallow the depth of trap energy level and accelerate the dissipation rate of surface charge, thus increasing the flashover voltage.