Inflammasome activation and metabolic remodelling in p16-positive aging cells aggravates high-fat diet-induced lung fibrosis by inhibiting NEDD4L-mediated K48-polyubiquitin-dependent degradation of SGK1.

BACKGROUND: Chronic changes caused by a high-fat diet (HFD) may be associated with weakened lung function in obese patients. However, few studies have focused on the role of senescent cells in HFD-induced pulmonary fibrosis. This study aimed to determine whether (i) obesity causes the accumulation of aging cells in the lungs, (ii) p16 accumulation in aging epithelial cells or fibroblasts exacerbates long-term HFD-induced senescence-associated pulmonary fibrosis (SAPF) and (iii) p16 deletion or clearance of aging cells ameliorates HFD-induced SAPF through inactivation of the inflammasome and metabolic remodelling. METHODS: Twelve-month old male mice of p16INK4a (hereafter p16) knockout (p16-- ) and wild-type (WT), ApoE knockout (ApoE-- ) and ApoE-- p16-- were fed a HFD to induce obesity, and the effects of treatment with the senolytic drug ABT263 or the SGK1 specific inhibitor EMD638683 on fibrosis, inflammaging, gene expression, integrin-inflammasome signalling and metabolism were examined. A549 and IMR-90 cells were transduced with p16-overexpressing adenovirus, and treated with palmitic and oleic acids (P&O) to induce steatosis in vitro. RESULTS: We found that long-term HFD promoted the expression of p16 and the increase of senescent cells in the lung. P16 knockout or ABT263 treatment alleviated pulmonary fibrosis, the increase of senescent cells and senescence-associated secretory phenotype (SASP) in HFD-fed mice, as well as in P&O-treated A549 and IMR-90 cells. RNA sequencing and bioinformatics analyses revealed that p16 knockout inhibited activation of the integrin-inflammasome pathway and cellular glycolysis. Mass spectrometry, co-immunoprecipitation and GST pull-down assays demonstrated that p16 bound to the N-terminal of SGK1, thereby interfering with the interaction between the E3 ubiquitin ligase NEDD4L and SGK1, and subsequently inhibiting K48-polyubiquitin-dependent degradation of SGK1 mediated by the NEDD4L-Ubch5 complex. EMD638683 was found to alleviate HFD-induced pulmonary fibrosis and activation of the integrin-inflammasome pathway. CONCLUSION: P16 accumulation promoted activation of integrin- inflammasome pathway and cell glycolysis by binding to the N- terminal of SGK1, intefering with the interaction between the E3 ubiquitin ligase NEDD4L and SGK1, thereby inhibiting K48- polyubiquitin- dependent degradation of SGK1 mediated by the NEDD4L-Ubch5 complex. ABT263 or EMD638683 could be used as potential drugs to treat pulmonary fibrosis in obese patients.

Resveratrol improves cardiac function by promoting M2-like polarization of macrophages in mice with myocardial infarction.

Macrophage polarization determines the transition from the inflammation phase to the inflammation resolution phase after myocardial infarction (MI). The aim of the present study was to investigate whether resveratrol (RSV) could inhibit the inflammatory mediators associated with the regulation of macrophage phenotypes and functions in MI mice. We initially discovered that RSV significantly improved cardiac function and suppressed the expression of fibrosis markers, such as collagen-I, collagen-III, and fibronectin, and pro-inflammatory cytokines, including interleukin-1ß (IL-1ß), interleukin-6 (IL-6), and tumor necrosis factor alpha (TNF-α). RSV inhibited the expression of M1-like macrophage-related biomarkers (e.g., TNF-α and MCP-1) when bone marrow-derived macrophages (BMDMs) were stimulated with lipopolysaccharide (LPS) and interferon-γ (INF-γ). In contrast, it upregulated M2-like macrophage-related biomarkers (e.g., CD163 and Arg-1) when BMDMs were stimulated with interleukin-4 (IL-4) and interleukin-10 (IL-10). In addition, we found that RSV promoted M2-like macrophage polarization under anoxic conditions, which could be related to JAK2-SATA3 phosphorylation. In summary, RSV might promote anti-inflammatory M2-like polarization of macrophages after MI to improve cardiac function via the regulation of JAK2-SATA3 phosphorylation.

Muscone improves cardiac function in mice after myocardial infarction by alleviating cardiac macrophage-mediated chronic inflammation through inhibition of NF-κB and NLRP3 inflammasome.

Muscone is the main active monomer of traditional Chinese medicine musk. Previous studies have reported a variety of beneficial effects of muscone. However, the effects of muscone on chronic inflammation after myocardial infarction (MI) are rarely reported. This study evaluated the anti-inflammatory effects of muscone on myocardial infarction by establishing a MI model in mice. We found that muscone remarkably decreased the levels of inflammatory cytokines (IL-1ß, TNF-α and IL-6), and ultimately improved cardiac function and survival rate. Furthermore, the main anti-inflammatory effect of muscone was alleviating cardiac macrophage-mediated inflammatory response in heart tissues after MI. Bone marrow-derived macrophages (BMDMs) induced with lipopolysaccharide (LPS) were used as an in vitro inflammation model to further clarify anti-inflammatory mechanisms of muscone. Muscone significantly downregulated the levels of LPS-induced inflammatory cytokines and inhibited NF-κB and NLRP3 inflammasome activation in BMDMs. Moreover, ROS and antioxidant indices in LPS-induced BMDMs were also ameliorated after muscone treatment. To sum up, our study found that muscone alleviated cardiac macrophage-mediated chronic inflammation by inhibiting NF-κB and NLRP3 inflammasome activation, thereby improving cardiac function in MI mice. Besides, the inhibitory effect of muscone on inflammation may be related to the scavenging of ROS. It is suggested that muscone may serve as a promising and effective drug for post-MI treatment.

[Analysis of NF2 gene mutations in intraspinal Schwannomas].

OBJECTIVE: To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene. METHODS: Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing. RESULTS: Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations. CONCLUSION: The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.

Ad-HGF improves the cardiac remodeling of rat following myocardial infarction by upregulating autophagy and necroptosis and inhibiting apoptosis.

Cell death in MI is the most critical determinant of subsequent left ventricular remodeling and heart failure. Besides apoptosis, autophagy and necroptosis have been recently found to be another two regulated cell death styles. HGF has been reported to have a protective role in MI, but its impact on the three death styles remains unclear. Thus, our study was performed to investigate the distribution of autophagy, apoptosis and necroptosis in cardiac tissues after MI and explore the role and mechanism of Ad-HGF on cardiac remodeling by regulating the three death styles. We firstly showed the distribution of autophagy, apoptosis and necroptosis differs in temporal and spatial context after MI using immunofluorescence. Notably, Ad-HGF treatment improves the cardiac remodeling of SD rats following MI by preserving the heart function, reducing the scar size and aggresomes. Further mechanism study reveals Ad-HGF promotes autophagy and necroptosis and inhibits apoptosis in vivo and in vitro. Co-immunoprecipitation assays showed Ad-HGF treatment significantly decreased the binding of Bcl-2 to Beclin1 but enhanced Bcl-2 binding to Bax in H9c2 cells under hypoxia. Moreover, HGF-induced sequestration of Bax by Bcl-2 allows Bax to become inactive, thereby inhibiting apoptosis. In addition, Ad-HGF markedly increased the formation of Beclin1-Vps34-Atg14L complex, which accounted for promoting autophagy. Both the western blot and activity assay showed Ad-HGF significantly decreased the caspase 8 protein and activity levels, which obligated the cell to undergo necroptosis under hypoxia and block apoptosis. Thus, our findings offer new evidence and strategies for the treatment of MI and post-MI cardiac remodeling.

Correlation of high delta-like ligand 4 expression with peritumoral brain edema and its prediction of poor prognosis in patients with primary high-grade gliomas.

OBJECT: Peritumoral brain edema (PTBE) is a common phenomenon associated with high-grade gliomas (HGGs). In this study, the authors investigated the expression of Notch delta-like ligand 4 (DLL4) and its correlation with PTBE and prognosis in patients with an HGG. METHODS: Tumors from 99 patients with HGG were analyzed for DLL4 expression using immunohistochemistry. PTBE on preoperative MR images and the relationship between PTBE and DLL4 expression were evaluated. The effect of DLL4 on patient prognosis was assessed by using Kaplan-Meier survival and Cox proportional hazard models. RESULTS: Immunohistochemistry results revealed that the expression of DLL4 was distributed primarily within the cytoplasm of tumor vascular endothelial cells and seldom detected in tumor cells. DLL4 expression was correlated positively with the degree of edema (r = 0.845 and p < 0.001, Spearman's test). In addition, DLL4 was an independent predictor of prognosis in patients with HGGs (p = 0.001). CONCLUSIONS: DLL4 expression was correlated positively with the degree of PTBE and was an independent unfavorable prognostic indicator in patients with HGG.

Peritumoral edema shown by MRI predicts poor clinical outcome in glioblastoma.

BACKGROUND: Magnetic resonance imaging (MRI) plays an irreplaceable role in the preoperative diagnosis of glioma, and its imaging features are the base of making treatment decisions in patients with glioma, but it is still controversial whether peritumoral edema shown by MRI from preoperative routine scans are associated with patient survival. The aim of this study was to assess the prognostic value of preoperative MRI features in patients with glioblastoma. METHODS: A retrospective review of 87 patients with newly diagnosed supratentorial glioblastoma was performed using medical records and MRI data from routine scans. The Kaplan-Meier method and COX proportional hazard model were applied to evaluate the prognostic impact on overall survival of pretreatment MRI features (including peritumoral edema, edema shape, necrosis, cyst, enhancement, tumor crosses midline, edema crosses midline, and tumor size). RESULTS: In addition to patient age, Karnofsky performance status (KPS) and postoperative chemoradiotherapy, peritumoral edema extent and necrosis on preoperative MRI were independent prognostic indicator for poor survival. Furthermore, patients with two unfavorable conditions (major edema and necrosis) had a shorter overall survival compared with the remainder. CONCLUSIONS: Our data confirm that peritumoral edema extent and necrosis are helpful for predicting poor clinical outcome in glioblastoma. These features were easy to determine from routine MRI scans postoperatively and therefore could provide a certain instructive significance for clinical activities.

Peritumoral edema on magnetic resonance imaging predicts a poor clinical outcome in malignant glioma.

Peritumoral edema (PTE), one of the main characteristics of malignant glioma, is a significant contributor to the morbidity and mortality from glioma, however, a recent systematic review suggested that controversy remains with regard to its prognostic value. To further determine whether PTE was a potential prognostic factor on routine pre-operative magnetic resonance imaging (MRI) for malignant glioma, the association between survival and PTE was investigated in the present retrospective review of 109 patients with newly diagnosed supratentorial malignant glioma using MRI data from these routine scans. The Kaplan-Meier method was used to calculate overall survival (OS) in univariate analysis, and COX proportional hazards model was applied to evaluate the effect of pre-operative MRI features on OS in multivariate analysis. The PTE extent, edema shape, degree of necrosis, enhancement extent, pathological grade, patient age, Karnofsky performance status (KPS) and post-operative chemoradiotherapy were associated with OS in the patients with malignant glioma on univariate analysis. Multivariate analysis indicated that the extent of PTE and degree of necrosis shown by pre-operative MRI were independent predictors of OS, in addition to pathological grade, patient age, KPS and post-operative chemoradiotherapy. Moreover, patients with two unfavorable factors (major edema and severe necrosis) exhibited a poorer OS compared with the remainder. In summary, PTE and degree of necrosis, which are easily determined from routine MRI, can be useful for predicting a poor clinical outcome in patients with newly diagnosed malignant glioma.

High delta-like ligand 4 (DLL4) is correlated with peritumoral brain edema and predicts poor prognosis in primary glioblastoma.

Delta-like ligand 4 (DLL4), 1 of the 5 known Notch ligands, is involved in a variety of tumor initiation and progression, particularly in the process of tumor angiogenesis. However, the clinical and prognostic significance of DLL4 in glioblastoma have not been fully elucidated.Tumor tissues from 69 glioblastoma patients were analyzed using immunohistochemistry for DLL4 expression. Peritumoral brain edema (PTBE) on preoperative magnetic resonance imaging of these patients and the relationship with DLL4 expression were evaluated. The effect on prognosis was assessed by using the Kaplan-Meier survival and the Cox proportional hazard model.The results showed that elevated DLL4 expression was primarily distributed in the cytoplasm of tumor vascular endothelial cells and rarely detected in tumor cells. Univariate analysis indicated significant correlation of high DLL4 expression with shorter time to progression (TTP) (P < 0.001) and overall survival (OS) (P < 0.001) in glioblastoma. Multivariate analysis confirmed high DLL4 expression as an unfavorable prognostic indicator for TTP (P < 0.001) and OS (P < 0.001), independent of age, gender, symptom duration, resection degree, and PTBE. Importantly, the study also found that DLL4 expression was positively related with PTBE (Spearman's test: r = 0.845, P < 0.001). A multiple linear regression model was constructed to confirm that the positive index of DLL4 was associated with an increase in maximum extent of PTBE (P < 0.001).It is thus concluded that DLL4 is correlated with PTBE and may be useful for predicting prognosis in glioblastoma.

Pre-operative peritumoral edema and survival rate in glioblastoma multiforme.

The aim of this systematic review was to examine the relationship between pre-operative peritumoral edema and survival in patients with glioblastoma multiforme (GBM). We searched for studies involving patients with GBM who underwent pre-operative imaging (magnetic resonance imaging and/or computed tomography) in which the peritumoral edema was assessed as a prognostic factor for survival. 7 retrospective studies met the eligibility criteria and were included in the study. 2 studies found that pre-operative peritumoral edema was an independent prognostic factor for decreased survival. 1 study found that survival was dependent on the severity of the peritumoral edema (minimal and severe: increased survival; moderate: decreased survival). 2 studies found that pre-operative peritumoral edema was a predictor of decreased survival based on univariate but not multivariate analysis. 1 study found that there was no relationship between pre-operative peritumoral edema and survival, while the remaining study found that patients with peritumoral edema had decreased survival compared with patients without peritumoral edema. There was considerable heterogeneity between the studies regarding the patient characteristics. The results of our systematic review are inconclusive; the available evidence does not definitely support or rule out an association between pre-operative peritumoral edema and survival. Hence, further, well-designed, prospective studies are clearly needed.