ABSTRACT
Sepsis is a systemic inflammatory response syndrome caused by the invasion of pathogenic microorganisms. Despite major advances in diagnosis and technology, morbidity and mortality remain high. The level of neutrophil extracellular traps (NETs) is closely associated with the progression and prognosis of sepsis, suggesting the regulation of NET formation as a new strategy in sepsis treatment. Owing to its pleiotropic effects, atorvastatin, a clinical lipid-lowering drug, affects various aspects of sepsis-related inflammation and immune responses. To align closely with clinical practice, we combined it with imipenem for the treatment of sepsis. In this study, we used a cecum ligation and puncture-induced lung injury mouse model and employed techniques including western blot, immunofluorescence, and enzyme-linked immunosorbent assay to measure the levels of NETs and other sepsis-related lung injury indicators. Our findings indicate that atorvastatin effectively inhibited the formation of NETs. When combined with imipenem, it significantly alleviated lung injury, reduced systemic inflammation, and improved the 7-day survival rate of septic mice. Additionally, we explored the inhibitory mechanism of atorvastatin on NET formation in vitro, revealing its potential action through the ERK/NOX2 pathway. Therefore, atorvastatin is a potential immunomodulatory agent that may offer new treatment strategies for patients with sepsis in clinical settings.
ABSTRACT
BACKGROUND: Effective teaching methods are needed to improve students' abilities in hand-eye coordination and understanding of cardiac anatomy in echocardiography education. Simulation devices have emerged as innovative teaching tools and exhibited distinctive advantages due to their ability to provide vivid and visual learning experiences. This study aimed to investigate the effect of simulation of sectional human anatomy using ultrasound on students' learning outcomes and satisfaction in echocardiography education. METHODS: The study included 18 first-year clinical medical students with no prior echocardiography training. After randomization, they underwent a pre-test to assess basic knowledge. Following this, the students were divided into two groups: traditional teaching (traditional group) and simulation of sectional human anatomy using ultrasound (digital group). Each group received 60 min of instruction. Post-tests were assigned to students at two different time points: immediately after the lecture, and one week later (referred to as post-tests 1, and 2). In addition, anonymous questionnaires were distributed to students after class to investigate their satisfaction with teaching. RESULTS: Both groups showed significant improvement in their scores on post-test 1 compared to pre-test (traditional group: from 33.1 ± 8.8 to 48.1 ± 13.1, P = 0.034 vs. digital group: from 35.0 ± 6.7 to 58.0 ± 13.2, P = 0.008). However, there were no significant differences between the two groups in several post-test comparisons. Student satisfaction ratings revealed that the digital group experienced significantly greater satisfaction in areas such as subject interest, teaching style, course alignment, and interaction compared to the traditional group. Additionally, 80% of the digital group strongly endorsed the use of simulation of sectional human anatomy using ultrasound for echocardiography teaching, highlighting its effectiveness. CONCLUSIONS: Simulation of sectional human anatomy using ultrasound may improve students' understanding of echocardiography and satisfaction with the course. Our study provides evidence supporting the use of simulation teaching devices in medical education. Further research is needed to explore the long-term impact of this teaching method on students' learning outcomes and its integration into the medical curriculum. TRIAL REGISTRATION: http://www.chictr.org.cn (registration number: ChiCTR2300074015, 27/07/2023).
Subject(s)
Echocardiography , Education, Medical, Undergraduate , Educational Measurement , Personal Satisfaction , Students, Medical , Humans , Pilot Projects , Female , Male , Education, Medical, Undergraduate/methods , Young Adult , Simulation Training , Anatomy/education , CurriculumABSTRACT
Introduction: Drip irrigation under mulch film promotes a non-uniform salinity distribution in salt fields. The effect of different N application methods on the growth and yield of cotton under drip irrigation under mulch film conditions in eastern coastal saline-alkaline soils in China remain remained unclear. Methods: A randomized complete block design was used in the experiment. Three N application methods were assigned: N applied under mulch film (low-salinity area; UM), N applied between mulch films (high-salinity area; BM), and half N applied under mulch film and half between mulch films (HUHB). Results: Plant height, photosynthesis, Chl content, boll load, biomass, boll weight and boll density under UM were all significantly higher than those under the other two treatments. The N absorption of UM was higher than in the other two treatments, which might be attributed to the expression of GHNRT1.5 and GHNRT2.1. The net NO3- influx in the roots in UM increased significantly compared with that in BM. The yield and FNRE of UM were 3.9% and 9.1%, respectively, and were 26.52% and 90.36% higher than under HUHB and BM treatments. Discussion: UM not only improved cotton yield but also alleviated the pollution of N residue on drip irrigation under mulch film conditions in salt areas.
ABSTRACT
Enterovirus 71 (EV71) causes hand-foot-and-mouth disease (HFMD), neurological complications, and even fatalities in infants. Clinically, the increase of extracellular vesicles (EVs) in EV71 patients' serum was highly associated with the severity of HFMD. EV71 boosts EVs biogenesis in an endosomal sorting complex required for transport (ESCRT)-dependent manner to facilitate viral replication. Yet, the impact of EVs-derived from ESCRT-independent pathway on EV71 replication and pathogenesis is highly concerned. Here, we assessed the effects of EV71-induced EVs from ESCRT-independent pathway on viral replication and pathogenesis by GW4869, a neutral sphingomyelinase inhibitor. Detailly, in EV71-infected mice, blockade of the biogenesis of tissue-derived EVs in the presence of GW4869 restored body weight loss, attenuated clinical scores, and improved survival rates. Furthermore, GW4869 dampens EVs biogenesis to reduce viral load and pathogenesis in multiple tissues of EV71-infected mice. Consistently, GW4869 treatment in a human intestinal epithelial HT29 cells decreased the biogenesis of EVs, in which the progeny EV71 particle was cloaked, leading to the reduction of viral infection and replication. Collectively, GW4869 inhibits EV71-induced EVs in an ESCRT-independent pathway and ultimately suppresses EV71 replication and pathogenesis. Our study provides a novel strategy for the development of therapeutic agents in the treatment for EV71-associated HFMD.
Subject(s)
Aniline Compounds , Endosomal Sorting Complexes Required for Transport , Enterovirus A, Human , Extracellular Vesicles , Virus Replication , Animals , Virus Replication/drug effects , Enterovirus A, Human/drug effects , Enterovirus A, Human/physiology , Mice , Extracellular Vesicles/metabolism , Endosomal Sorting Complexes Required for Transport/metabolism , Humans , Benzylidene Compounds/pharmacology , Enterovirus Infections/virology , Enterovirus Infections/drug therapy , Enterovirus Infections/metabolism , Viral Load/drug effects , FemaleABSTRACT
CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.
Subject(s)
Blood Platelet Disorders , CD36 Antigens , Humans , CD36 Antigens/genetics , Blood Platelets , Databases, Factual , RNAABSTRACT
BACKGROUND: Leaf feeders, such as Spodoptera frugiperda and Spodoptera litura, and stem borers Ostrinia furnacalis and Chilo suppressalis, occupy two different niches and are well adapted to their particular environments. Borer larvae burrow and inhabit the interior of stems, which are relatively dark. By contrast, the larvae of leaf feeders are exposed to sunlight during feeding. We therefore designed series of experiments to evaluate the effect of light intensity (0, 2000, and 10 000 lx) on these pests with different feeding modes. RESULTS: The development of all four pests was significantly delayed at 0 lx. Importantly, light intensity affected the development of both male and female larvae of borers, but only significantly affected male larvae of leaf feeders. Furthermore, the proportion of female offspring of leaf feeders increased with increasing light intensity (S. frugiperda: 33.89%, 42.26%, 57.41%; S. litura: 38.90%, 51.75%, 65.08%), but no significant differences were found in stem borers. This research also revealed that the survival rate of female leaf feeders did not vary across light intensities, but that of males decreased with increasing light intensity (S. frugiperda: 97.78%, 85.86%, 61.21%; S. litura: 95.83%, 73.54%, 58.99%). CONCLUSION: These results improve our understanding of how light intensity affects sex differences in important lepidopteran pests occupying different feeding niches and their ecological interactions with abiotic factors in agroecosystems. © 2024 Society of Chemical Industry.
ABSTRACT
Herein we report an additive-free protocol for the facile synthesis of α,α-dichloroketones and α-chlorohydrins from various aryl terminal, diaryl internal, and aliphatic terminal alkynes and alkenes, respectively. The commercially available tert-butyl hypochlorite (tBuOCl) was employed as a suitable chlorinating reagent, being accompanied by the less harmful tBuOH as the by-product. In addition, the oxygen atoms in the products came from water rather than molecular oxygen, based on the 18O-labelling experiments. Meanwhile, the diastereoselectivity of the Z- and the corresponding E-alkenes has been compared and rationalized. Using a group of control experiments, the possible mechanisms have been proposed as the initial electrophilic chlorination of unsaturated C-C bonds in a Markovnikov-addition manner in general followed by a nucleophilic addition with water. This work simplified the oxychlorination method with a mild chlorine source and a green oxygen source under ambient conditions.
ABSTRACT
The development of potential-resolved electrochemiluminescence (ECL) systems with dual emitting signals holds great promise for accurate and reliable determination in complex samples. However, the practical application of such systems is hindered by the inevitable mutual interaction and mismatch between different luminophores or coreactants. In this work, for the first time, by precisely tuning the oxygen reduction performance of M-N-C single-atom catalysts (SACs), we present a dual potential-resolved luminol ECL system employing endogenous dissolved O2 as a coreactant. Using advanced in situ monitoring and theoretical calculations, we elucidate the intricate mechanism involving the selective and efficient activation of dissolved O2 through central metal species modulation. This modulation leads to the controlled generation of hydroxyl radical (·OH) and superoxide radical (O2·-), which subsequently trigger cathodic and anodic luminol ECL emission, respectively. The well-designed Cu-N-C SACs, with their moderate oxophilicity, enable the simultaneous generation of ·OH and O2·-, thereby facilitating dual potential-resolved ECL. As a proof of concept, we employed the principal component analysis statistical method to differentiate antibiotics based on the output of the dual-potential ECL signals. This work establishes a new avenue for constructing a potential-resolved ECL platform based on a single luminophore and coreactant through precise regulation of active intermediates.
ABSTRACT
To explore potential responses of ecosystem carbon density to changes of community structure during natural regeneration of woody plants, we analyzed the relationships between ecosystem carbon density and its components, tree species diversity, structural diversity (CVDBH) and spatial structure parameters (mingling, aggregation, dominance, crowding) of Cunninghamia lanceolata forests with different sprouting densities (1154, 847 and 465 individuals·hm-2) at the early stage of succession in Baishanzu National Park. The results showed that tree species diversity (species richness index and Shannon diversity index) increased with the decrease of sprouting density of C. lanceolata. Among the stand structural parameters, CVDBH, stand density, and mingling increased with the decrease of sprouting density of C. lanceolata. The stand distribution pattern of different C. lanceolata densities was uniform, with sub-dominant stand growth status and relatively dense status. The carbon density of tree layer under high, medium, and low sprouting densities of C. lanceolata were 57.56, 56.12 and 46.54 t·hm-2, soil carbon density were 104.35, 122.71 and 142.00 t·hm-2, and the total carbon density of ecosystem were 164.59, 182.41 and 190.13 t·hm-2, respectively. There was little variation in carbon density of understory layer and litter layer among different treatments. The carbon density distribution characteristics of different C. lanceolata densities were following the order of soil layer (63.4%-74.7%) > tree layer (24.5%-35.0%) > understory layer and litter layer (0.8%-2.0%). The results of variance partitioning analysis indicated that the change of tree layer carbon density was mainly influenced by stand structure diversity, soil layer carbon density was influenced by both tree species diversity and stand structure diversity, while ecosystem carbon density was mainly influenced by tree species diversity. Stand spatial structure parameters had a relatively little effect on ecosystem carbon density and its components. The sprouting density of C. lanceolata significantly affected ecosystem carbon accumulation during the conversion from C. lanceolata plantations to natural forests. A lower remaining density of C. lanceolata (about 500 individuals·hm-2) was more conducive to forest carbon sequestration.
Subject(s)
Cunninghamia , Ecosystem , Humans , Carbon/chemistry , Forests , Trees , Soil/chemistry , ChinaABSTRACT
Iodinated X-ray contrast media (ICM) are ubiquitously present in water sources and challenging to eliminate using conventional processes, posing a significant risk to aquatic ecosystems. Ultraviolet light-emitting diodes (UV-LED) emerge as a promising technology for transforming micropollutants in water, boasting advantages such as diverse wavelengths, elimination of chemical additives, and no induction of microorganisms' resistance to disinfectants. The research reveals that iohexol (IOX) degradation escalates as UV wavelength decreases, attributed to enhanced photon utilization efficiency. Pseudo-first-order rate constants (kobs) were determined as 3.70, 2.60, 1.31 and 0.65 cm2 J-1 at UV-LED wavelengths of 255, 265, 275 and 285 nm, respectively. The optical properties of dissolved organic matter (DOM) and anions undeniably influence the UV-LED photolysis process through photon competition and the generation of reactive substances. The influence of Cl- on IOX degradation was insignificant at UV-LED 255, but it promoted IOX degradation at 265, 275 and 285 nm. IOX degradation was accelerated by ClO2-, NO3-and HA due to the formation of various reactive species. In the presence of NO3-, the kobs of IOX followed the order: 265 > 255 > 275 > 285 nm. Photosensitizers altered the spectral dependence of IOX, and the intermediate photoactivity products were detected using electron spin resonance. The transformation pathways of IOX were determined through density functional theory calculations and experiments. Disinfection by-products (DBPs) yields of IOX during UV-LED irradiation decreased as the wavelength increased: 255 > 265 > 275 > 285 nm. The cytotoxicity index value decreased as the UV-LED wavelength increased from 255 to 285 nm. These findings are crucial for selecting the most efficient wavelength for UV-LED degradation of ICM and will benefit future water purification design.
ABSTRACT
Cancer patients frequently encounter difficulties associated with suboptimal sleep quality. Bright Light Therapy (BLT), an innovative treatment approach, has shown promise in enhancing sleep quality. However, several literature reviews showed conflicting results, and more analysis should be conducted regarding detailed BLT settings on sleep. This meta-analysis was undertaken to comprehensively assess the impact of BLT on sleep quality among cancer patients. Twelve studies with 679 patients were included. Compared with the control group, BLT overall resulted in significant improvements in terms of sleep quality [g = -0.34], total sleep time [g = 0.24], wake after sleep onset [g = -0.80], and fatigue [g = -0.54]. However, it did not yield a statistically significant effect on sleep efficiency, sleep onset latency, and insomnia severity. Regarding light settings, interventions featuring light intensities >5000lux, intervention duration ≥4 weeks, spectral emission peak at 464â¼465 nm, and using a lightbox demonstrated heightened efficacy in improving sleep. BLT may be considered a supplementary therapeutic option to improve sleep quality among cancer patients. However, more extensive and rigorous studies are necessary to determine the optimal timing of BLT delivery and its applicability to cancer patients across different age groups.
ABSTRACT
Metal anodes are emerging as culminating solutions for the development of energy-dense batteries in either aprotic, aqueous, or solid battery configurations. However, unlike traditional intercalation electrodes, the low utilization of "hostless" metal anodes due to the intrinsically disordered plating/stripping impedes their practical applications. Herein, we report ordered planar plating/stripping in a bulk zinc (Zn) anode to achieve an extremely high depth of discharge exceeding 90% with negligible thickness fluctuation and long-term stable cycling. The Zn can be plated/stripped with (0001)Zn preferential orientation throughout the consecutive charge/discharge process, assisted by a self-assembled supramolecular bilayer at the Zn anode-electrolyte interface. Through real-time tracking of the Zn atoms migration, we reveal that the ordered planar plating/stripping is driven by the construction of in-plane ZnâN bindings and the gradient energy landscape at the reaction fronts. The breakthrough results provide alternative insights into the ordered plating/stripping of metal anodes toward rechargeable energy-dense batteries.
ABSTRACT
Lung cancer, a prevalent and aggressive disease, is characterized by recurrence and drug resistance. It is essential to comprehend the fundamental processes and discover novel therapeutic objectives for augmenting treatment results. Based on our research findings, we have identified a correlation between methylation of cg09897064 and decreased expression of ZBP1, indicating a link to unfavorable prognosis in patients with lung cancer. Furthermore, these factors play a role in macrophage polarization, with ZBP1 upregulated in M1 macrophages compared to both M0 and M2 polarized macrophages. We observed cg09897064 methylation in M2 polarization, but not in M0 and M1 polarized macrophages. ATACseq analysis revealed closed chromatin accessibility of ZBP1 in M0 polarized macrophages, while open accessibility was observed in both M1 and M2 polarized macrophages. Our findings suggest that ZBP1 is downregulated in M0 polarized macrophages due to closed chromatin accessibility and downregulated in M2 polarized macrophages due to cg09897064 methylation. Further investigations manipulating cg09897064 methylation and ZBP1 expression through overexpression plasmids and shRNAs provided evidence for their role in modulating macrophage polarization and tumor growth. ZBP1 inhibits M2 polarization and suppresses tumor growth, while cg09897064 methylation promotes M2 polarization and macrophage-induced tumor growth. In mechanism investigations, we found that cg09897064 methylation impairs CEBPA binding to the ZBP1 promoter, leading to decreased ZBP1 expression. Clinical experiments were conducted to validate the correlation between methylation at cg09897064, ZBP1 expression, and macrophage M2 polarization. Targeting these factors may hold promise as a strategy for developing innovative checkpoint inhibitors in lung cancer treatment.
Subject(s)
Adenocarcinoma of Lung , Lung Neoplasms , RNA-Binding Proteins , Humans , Adenocarcinoma of Lung/genetics , Adenocarcinoma of Lung/metabolism , Chromatin/metabolism , Lung Neoplasms/genetics , Lung Neoplasms/metabolism , Macrophages/metabolism , Methylation , RNA-Binding Proteins/geneticsABSTRACT
BACKGROUND: Weaning usually causes low feed intake and weight loss in piglets, which mobilizes lipid to energize. The microbe-derived antioxidants (MAs) exhibit great potential in antioxidation, anti-inflammation, and metabolic regulation. OBJECTIVES: We aimed to investigate the changes of lipid metabolism postweaning and effects of MA on growth performance and hepatic lipid metabolism in weanling piglets. METHODS: In the first experiment, piglets weaned at 21 d of age were slaughtered on weaning day (d0), 4 (d4), and 14 (d14) postweaning (6 piglets per day). In the second experiment, piglets were divided into 2 groups, receiving MA (MA) and saline gavage (CON), respectively. All piglets were weaned at 21 d of age and 6 piglets from each group were slaughtered at 25 d of age. RESULTS: In experiment 1, the serum triglyceride, total cholesterol (TC), and LDL cholesterol on d4 and d14 declined significantly compared with d0 (P < 0.05). The serum leptin on d0 was higher than that on d4 and d14 (P < 0.05). The serum ghrelin kept increasing from d0 to d14 (P < 0.05). The hepatic hormone-sensitive lipase and adipose triglyceride lipase first increased from d0 to d4 and then decreased from d4 to d14 (P < 0.05). In experiment 2, the average daily gain and average daily feed intake from 21 to 25 d of age increased in the MA group compared with the CON group (P < 0.05). The serum TC, hepatic TC, and glucose of MA group showed a significant increase than that of the CON group (P < 0.05). The expression of SCD1, ACAT2, and PPARγ were upregulated in the MA group (P < 0.05). Contrary to the decreased expression of phosphorylation of adenosine 5'-monophosphate-activated protein kinase alfa subunit (Thr172), the nuclear sterol regulatory element-binding protein 1c, fatty acid synthase, and peroxisome proliferator-activated receptor gamma of MA group increased than that of CON group (P < 0.05). CONCLUSIONS: Weaning promoted hepatic lipolysis and MA could enhance lipid synthesis by regulating adenosine 5'-monophosphate-activated protein kinase alfa subunit-sterol regulatory element-binding protein 1c pathway, thus improving growth performance of weanling piglets.
Subject(s)
Antioxidants , Lipid Metabolism , Animals , Antioxidants/metabolism , Protein Kinases/metabolism , Sterol Regulatory Element Binding Protein 1/metabolism , Swine , WeaningABSTRACT
Deciphering patterns of connectivity between neurons in the brain is a critical step toward understanding brain function. Imaging-based neuroanatomical tracing identifies area-to-area or sparse neuron-to-neuron connectivity patterns, but with limited throughput. Barcode-based connectomics maps large numbers of single-neuron projections, but remains a challenge for jointly analyzing single-cell transcriptomics. Here, we established a rAAV2-retro barcode-based multiplexed tracing method that simultaneously characterizes the projectome and transcriptome at the single neuron level. We uncovered dedicated and collateral projection patterns of ventromedial prefrontal cortex (vmPFC) neurons to five downstream targets and found that projection-defined vmPFC neurons are molecularly heterogeneous. We identified transcriptional signatures of projection-specific vmPFC neurons, and verified Pou3f1 as a marker gene enriched in neurons projecting to the lateral hypothalamus, denoting a distinct subset with collateral projections to both dorsomedial striatum and lateral hypothalamus. In summary, we have developed a new multiplexed technique whose paired connectome and gene expression data can help reveal organizational principles that form neural circuits and process information.
Subject(s)
Neurites , Neurons , Neurons/metabolism , Brain , Prefrontal Cortex , Neural Pathways/physiologyABSTRACT
Cortex-like cytoskeleton, a thin layer of cross-linked cytoplasmic proteins underlying the cell membrane, plays an essential role in modulating membrane behavior and cell surface properties. However, bottom-up construction of functional cortex-like cytoskeleton in artificial cells remains a challenge. Here, we present metal-phenolic networks as artificial cortical cytoskeletons in liposome-based artificial cells. The metal-phenolic cytoskeleton-reinforced artificial cells exhibit long-term stability, enhanced resistance to a variety of harsh environments, tunable permeability, and well-controlled morphologies. We anticipate that our stable artificial cell models will stride forward to practical applications of liposome-based microsystem.
Subject(s)
Artificial Cells , Liposomes/metabolism , Cytoskeleton/metabolism , Microtubules , Cell Membrane/metabolism , Metals/metabolismABSTRACT
Ammonia-oxidizing Nitrososphaeria are among the most abundant archaea on Earth and have profound impacts on the biogeochemical cycles of carbon and nitrogen. In contrast to these well-studied ammonia-oxidizing archaea (AOA), deep-branching non-AOA within this class remain poorly characterized because of a low number of genome representatives. Here, we reconstructed 128 Nitrososphaeria metagenome-assembled genomes from acid mine drainage and hot spring sediment metagenomes. Comparative genomics revealed that extant non-AOA are functionally diverse, with capacity for carbon fixation, carbon monoxide oxidation, methanogenesis, and respiratory pathways including oxygen, nitrate, sulfur, or sulfate, as potential terminal electron acceptors. Despite their diverse anaerobic pathways, evolutionary history inference suggested that the common ancestor of Nitrososphaeria was likely an aerobic thermophile. We further surmise that the functional differentiation of Nitrososphaeria was primarily shaped by oxygen, pH, and temperature, with the acquisition of pathways for carbon, nitrogen, and sulfur metabolism. Our study provides a more holistic and less biased understanding of the diversity, ecology, and deep evolution of the globally abundant Nitrososphaeria.
Subject(s)
Ammonia , Archaea , Ammonia/metabolism , Temperature , Archaea/genetics , Archaea/metabolism , Oxidation-Reduction , Nitrogen/metabolism , Sulfur/metabolism , Hydrogen-Ion Concentration , PhylogenyABSTRACT
Control of convection plays an important role in heat transfer regulation, bio/chemical sensing, phase separation, etc. Current convection controlling systems generally depend on engineered energy sources to drive and manipulate the convection, which brings additional energy consumption into the system. Here the use of human hand as a natural and sustainable infrared (IR) radiation source for the manipulation of liquid convection is demonstrated. The fluid can sense the change of the relative position or the shape of the hand with the formation of different convection patterns. Besides the generation of static complex patterns, dynamic manipulation of convections can also be realized via moving of hand or finger. The use of such sustainable convections to control the movement of a floating "boat" is further achieved. The use of human hands as the natural energy sources provides a promising approach for the manipulation of liquid convection without the need of extra external energy, which may be further utilized for low-cost and intelligent bio/chemical sensing and separation.
Subject(s)
Convection , Hot Temperature , Humans , Infrared RaysABSTRACT
BACKGROUND: In heart failure (HF), mitochondrial dysfunction and metabolic remodeling lead to a reduction in energy productivity and aggravate cardiomyocyte injury. Supplementation with α-ketoglutarate (AKG) alleviated myocardial hypertrophy and fibrosis in mice with HF and improved cardiac insufficiency. However, the myocardial protective mechanism of AKG remains unclear. We verified the hypothesis that AKG improves mitochondrial function by upregulating NAD+ levels and activating silent information regulator 2 homolog 1 (SIRT1) in cardiomyocytes. METHODS: In vivo, 2% AKG was added to the drinking water of mice undergoing transverse aortic constriction (TAC) surgery. Echocardiography and biopsy were performed to evaluate cardiac function and pathological changes. Myocardial metabolomics was analyzed by liquid chromatographyâmass spectrometry (LCâMS/MS) at 8 weeks after surgery. In vitro, the expression of SIRT1 or PINK1 proteins was inhibited by selective inhibitors and siRNA in cardiomyocytes stimulated with angiotensin II (AngII) and AKG. NAD+ levels were detected using an NAD test kit. Mitophagy and ferroptosis levels were evaluated by Western blotting, qPCR, JC-1 staining and lipid peroxidation analysis. RESULTS: AKG supplementation after TAC surgery could alleviate myocardial hypertrophy and fibrosis and improve cardiac function in mice. Metabolites of the malate-aspartate shuttle (MAS) were increased, but the TCA cycle and fatty acid metabolism pathway could be inhibited in the myocardium of TAC mice after AKG supplementation. Decreased NAD+ levels and SIRT1 protein expression were observed in heart of mice and AngII-treated cardiomyocytes. After AKG treatment, these changes were reversed, and increased mitophagy, inhibited ferroptosis, and alleviated damage in cardiomyocytes were observed. When the expression of SIRT1 was inhibited by a selective inhibitor and siRNA, the protective effect of AKG was suppressed. CONCLUSION: Supplementation with AKG can improve myocardial hypertrophy, fibrosis and chronic cardiac insufficiency caused by pressure overload. By increasing the level of NAD+, the SIRT-PINK1 and SIRT1-GPX4 signaling pathways are activated to promote mitophagy and inhibit ferroptosis in cardiomyocytes, which ultimately alleviates cardiomyocyte damage.
Subject(s)
Aortic Valve Stenosis , Ferroptosis , Heart Failure , Ketoglutaric Acids , Mitophagy , Angiotensin II , Chromatography, Liquid , Ferroptosis/drug effects , Fibrosis , Heart Failure/drug therapy , Heart Failure/metabolism , Hypertrophy , Ketoglutaric Acids/pharmacology , Ketoglutaric Acids/therapeutic use , Mitophagy/drug effects , Myocytes, Cardiac , NAD , Protein Kinases , RNA, Small Interfering , Sirtuin 1 , Tandem Mass Spectrometry , Animals , MiceABSTRACT
The big data era requires ultrafast, low-power, and silicon-compatible materials and devices for information storage and processing. Here, ferroelectric tunnel junctions (FTJs) based on SiO2/Hf0.5Zr0.5O2 composite barrier and both conducting electrodes are designed and fabricated on Si substrates. The FTJ achieves the fastest write speed of 500 ps under 5 V (2 orders of magnitude faster than reported silicon-compatible FTJs) or 10 ns speed at a low voltage of 1.5 V (the lowest voltage among FTJs at similar speeds), low write current density of 1.3 × 104 A cm-2, 8 discrete states, good retention > 105 s at 85 °C, and endurance > 107. In addition, it provides a large read current (88 A cm-2) at 0.1 V, 2 orders of magnitude larger than reported FTJs. Interestingly, in FTJ-based synapses, gradually tunable conductance states (128 states) with high linearity (<1) are obtained by 10 ns pulses of <1.2 V, and a high accuracy of 91.8% in recognizing fashion product images is achieved by online neural network simulations. These results highlight that silicon-compatible HfO2-based FTJs are promising for high-performance nonvolatile memories and electrical synapses.