ABSTRACT
OBJECTIVE: Pro-inflammatory polarization of adipose tissue macrophages (ATMs) plays a critical role in the pathogenesis of obesity-associated chronic inflammation. However, little is known about the role of lipids in the regulation of ATMs polarity and inflammation in response to metabolic stress. Deletion of α/ß-hydrolase domain-containing 6 (ABHD6), a monoacylglycerol (MAG) hydrolase, has been shown to protect against diet-induced obesity and insulin resistance. METHODS: Here we investigated the immunometabolic role of macrophage ABHD6 in response to nutrient excess using whole-body ABHD6-KO mice and human and murine macrophage cell-lines treated with KT203, a selective and potent pharmacological ABHD6 inhibitor. RESULTS: KO mice on high-fat diet showed lower susceptibility to systemic diet-induced inflammation. Moreover, in the setting of overnutrition, stromal vascular cells from gonadal fat of KO vs. control mice contained lower number of M1 macrophages and exhibited enhanced levels of metabolically activated macrophages (MMe) and M2 markers, oxygen consumption, and interleukin-6 (IL-6) release. Likewise, under in vitro nutri-stress condition, inhibition of ABHD6 in MMe-polarized macrophages attenuated the expression and release of pro-inflammatory cytokines and M1 markers and induced the upregulation of lipid metabolism genes. ABHD6-inhibited MMe macrophages showed elevated levels of peroxisome proliferator-activated receptors (PPARs) and 2-MAG species. Notably, among different MAG species, only 2-MAG treatment led to increased levels of PPAR target genes in MMe macrophages. CONCLUSIONS: Collectively, our findings identify ABHD6 as a key component of pro-inflammatory macrophage activation in response to excess nutrition and implicate an endogenous macrophage lipolysis/ABHD6/2-MAG/PPARs cascade, as a lipid signaling and immunometabolic pathway, which favors the anti-inflammatory polarization of ATMs in obesity.
Subject(s)
Monoglycerides , Peroxisome Proliferator-Activated Receptors , Humans , Animals , Mice , Peroxisome Proliferator-Activated Receptors/metabolism , Monoglycerides/metabolism , Mice, Obese , Hydrolases/genetics , Hydrolases/metabolism , Adipose Tissue/metabolism , Macrophages/metabolism , Obesity/metabolism , Inflammation/metabolism , Anti-Inflammatory Agents , Diet, High-Fat/adverse effects , Monoacylglycerol Lipases/genetics , Monoacylglycerol Lipases/metabolismABSTRACT
Do you always get what you want? Although none of us do, improving your negotiation skills can help increase your chances. This article discusses the importance of negotiation skills, the need to create a win-win situation, and summarizes the negotiation process: planning negotiations, conducting negotiations, postponing negotiations, and reaching closure, which is followed by an example. This article was written to help you to further develop your negotiation skills so that you can get what you want.
Subject(s)
Interprofessional Relations , Negotiating/methods , Professional Competence , Humans , Medical Laboratory Personnel , United StatesABSTRACT
OBJECTIVE: To describe our initial experience with a computerized telecommunication system, termed the interactive voice-response system, to record resident performance of laparoscopic surgery. METHODS: After completing a laparoscopic procedure, the surgeon and resident telephone a toll-free number independently and respond to three prerecorded statements using a Likert scale of 1 to 5. The caller then is asked to describe the resident's response to critical incidents or elements of surprise that arose during the surgery. The ratings and verbal comments are compiled, transcribed, and forwarded to the respective resident. The resident (and program director) can hear the verbal comments by entering a four-digit code. RESULTS: Between May 1, 1995, and May 31, 1996, 430 cases were reported by 11 surgeons and 16 residents using the interactive voice-response system. One hundred ninety-five (45%) procedures were entered by both the resident and surgeon. A survey undertaken during the introductory phase of the project revealed that five of the seven residents exposed to the system found that it provided useful feedback and preferred the system to traditional in-service reporting methods. In addition, five residents thought that the system complemented the personal feedback they received in the operating room. CONCLUSION: The system has been accepted by both residents and surgeons and has addressed the important components of resident in-training evaluation, namely, evaluation on a case-by-case basis, timely feedback, and self-assessment of resident performance.
Subject(s)
Computer-Assisted Instruction , Educational Measurement/methods , Internship and Residency , Laparoscopy , Telecommunications , Feasibility Studies , HumansABSTRACT
To estimate the prevalence of dissociative disorders in a day hospital and examine their relation to traumatic experiences, trained clinicians evaluated 70 of 229 patients consecutively admitted to an acute care day hospital. They used the Mini-Structured Clinical Interview for DSM-III-R Dissociative Disorders and the Traumatic Experience Questionnaire. Six of the 70 patients (9 percent) received a definite diagnosis of a dissociative disorder. Five of the six patients reported a childhood history of sexual or physical abuse. The results show that dissociative disorders are not rare among general psychiatric patients in a day hospital setting and are associated with histories of childhood trauma.
Subject(s)
Day Care, Medical/statistics & numerical data , Dissociative Disorders/epidemiology , Adult , Aged , Child , Child Abuse/psychology , Child Abuse/statistics & numerical data , Child Abuse, Sexual/psychology , Child Abuse, Sexual/statistics & numerical data , Connecticut/epidemiology , Cross-Sectional Studies , Dissociative Disorders/diagnosis , Dissociative Disorders/psychology , Female , Humans , Incidence , Male , Medical Indigency/statistics & numerical data , Middle Aged , Psychiatric Status Rating Scales , Stress Disorders, Post-Traumatic/diagnosis , Stress Disorders, Post-Traumatic/epidemiology , Stress Disorders, Post-Traumatic/psychologyABSTRACT
Some managers may not feel confident conducting job interviews. A major reason is that most have not been trained to interview, and managers in departments with few employees and/or low turnover rates usually do not interview frequently enough to develop the skill on their own. Hiring the wrong employee results in wasted time, effort, and money, and possibly a law suit. A list of what you can and cannot legally ask during the selection process is presented in Table 1. The best way to avoid problem employees is not to hire them in the first place.
Subject(s)
Interviews as Topic/methods , Personnel Selection/methods , Interviews as Topic/standards , Laboratories/organization & administration , Personnel Selection/legislation & jurisprudence , Personnel Selection/standards , United States , WorkforceABSTRACT
Do you always agree with your boss, peers, and employees? If not, then you have conflict. This article presents five conflict management styles and examples of situations in which each is appropriate for resolving a conflict. With the aid of step-by-step models, you will learn how to use the Collaborating conflict-management style to: 1) initiate a conflict resolution with others; 2) respond to a conflict resolution brought to you by someone; and 3) mediate a conflict resolution between your employees. This article should help you to improve your ability to resolve conflicts without negative effects on human relations.
Subject(s)
Conflict, Psychological , Employee Grievances , Interprofessional Relations , Models, Psychological , Personnel Management/standards , Humans , Personnel Administration, Hospital/standards , Problem Solving , United StatesSubject(s)
Acquired Immunodeficiency Syndrome/prevention & control , Mental Disorders/rehabilitation , Patient Education as Topic , Sex Education , Sexually Transmitted Diseases/prevention & control , Acquired Immunodeficiency Syndrome/transmission , Adult , Community Mental Health Centers , Connecticut , Day Care, Medical , Female , Health Knowledge, Attitudes, Practice , Humans , Male , Medical Indigency , Middle Aged , Risk Factors , Sexually Transmitted Diseases/transmissionSubject(s)
Acquired Immunodeficiency Syndrome/prevention & control , Day Care, Medical/statistics & numerical data , Health Knowledge, Attitudes, Practice , Hospitals, Psychiatric/statistics & numerical data , Mental Disorders/rehabilitation , Acquired Immunodeficiency Syndrome/psychology , Acquired Immunodeficiency Syndrome/transmission , Adult , Connecticut , Female , Health Behavior , Humans , Male , Mental Disorders/psychology , Patient Education as Topic , Risk FactorsABSTRACT
Responding to an increase in the number of acutely and severely ill patients being treated in partial hospital programs, this paper addresses the treatment of aggressive patients in acute partial hospital settings. The authors review the limited conceptual literature published in this area and then suggest concrete strategies of intervention that fit the day-to-day life of a day hospital. They take as a guiding principle for these interventions an extension of the tenet of deinstitutionalization that patients be treated in the least restrictive manner possible and offer a variety of possible interventions for managing aggressive acts, ranging from least to most restrictive. Six issues which arise in applying less restrictive controls in the partial hospital treatment of aggressive patients are then identified, and illustrations of the principles employed in each of these areas are provided through reflection on two representative clinical vignettes. Taken together, these principles and interventions suggest ways for staff to intervene with aggressive patients, with each other, and with the significant others in patients' lives, in a manner which respects and fosters patients' autonomy and individual responsibility for their own behavior while maintaining a safe environment.
Subject(s)
Aggression , Day Care, Medical/standards , Progressive Patient Care/standards , Safety , Violence , Adult , Connecticut , Crisis Intervention , Day Care, Medical/organization & administration , Deinstitutionalization/organization & administration , Evaluation Studies as Topic , Female , Humans , Male , Patient Participation , Professional-Patient Relations , Progressive Patient Care/methodsABSTRACT
The clinical laboratory is a fast-paced environment where accuracy and efficiency are crucial. A major responsibility of the clinical manager is to assign tasks clearly to ensure that a quality job is done right the first time. Have you ever heard a manager say "This isn't what I asked for?" When this happens, it is usually the fault of the manager. Managers often make incorrect assumptions and do not take 100% of the responsibility for ensuring that assigned tasks are understood. To assign tasks effectively, managers must state exactly what they want, how they want it done, and when they want it. And, in addition to stating the desired end results, managers must verify that the directions were correctly understood; this is done by asking for feedback through questioning and paraphrasing. The five-step model described in this article will help you to assign tasks that get the job done right the first time.
Subject(s)
Laboratories/organization & administration , Personnel Management/methods , Communication , Feedback , Humans , Medical Laboratory Personnel , Personnel Management/standards , United StatesABSTRACT
One characteristic of power is the ability to influence others; managers cannot be effective without it. Politics is the network of interactions by which power is acquired, transferred, and exercised; it is a fact of health-care life. Like the money in our economy, politics is the medium of exchange in an organization. Managers must be political beings to meet their objectives. This article helps you to assess your political behavior and describes specific methods to increase power and develop political skills. Using these techniques can result in getting what you want and having things done your way, resulting in better job performance and career advancement.
Subject(s)
Administrative Personnel , Leadership , Politics , Power, Psychological , Laboratories, Hospital/organization & administration , United StatesABSTRACT
The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.
Subject(s)
DNA/genetics , Genes , Replicon , Tetrahydrofolate Dehydrogenase/genetics , Animals , Base Sequence , Cell Line , Cloning, Molecular , Gene Amplification , Humans , Macromolecular Substances , Molecular Sequence Data , Nucleic Acid Conformation , Plasmids , Repetitive Sequences, Nucleic Acid , Restriction Mapping , Sequence Homology, Nucleic AcidABSTRACT
A study of ambulatory care and education was conducted by sending questionnaires to U.S. Department of Veterans Affairs hospitals (75) and medical schools (65) prior to the Conference on Ambulatory Care and Education. Responses from 48% of medical schools indicated that there was little required clinical time in ambulatory care (15-20%), as well as faculty resistance and lack of medical school commitment to ambulatory care education. VA respondents (35% sample) also documented relatively little training in ambulatory care at the undergraduate and graduate levels. Numerous barriers to ambulatory care education are mentioned and strategies for overcoming the problems found are discussed.
Subject(s)
Ambulatory Care/statistics & numerical data , Education, Medical/statistics & numerical data , Hospitals, Veterans , Schools, Medical , Curriculum , Education, Medical, Undergraduate/statistics & numerical data , Humans , Internship and Residency , Specialization , Surveys and Questionnaires , United StatesSubject(s)
Attitude of Health Personnel , Punishment , Substance-Related Disorders , Adult , Female , Humans , Jurisprudence , Male , Manitoba , Students, NursingABSTRACT
This research examined the relationship between hopelessness, defined as a system of negative expectancies about the future, and two theoretically relevant constructs: internal-external locus of control, and depression. Two samples of 67 and 44 undergraduates were administered the Beck, et al. Hopelessness Scale, the Rotter Internal-External Scale, and the Beck Depression Inventory. The data of both samples supported the predictions that hopelessness would be positively related to external locus of control and to depression.