Complete genome sequence of a German isolate of spartina mottle virus supports its classification as a member of the proposed genus "Sparmovirus" within the family Potyviridae.

Spartina mottle virus (SpMV), an unassigned member of the family Potyviridae, has been known since 1980, when it was first described in England and Wales in symptomatic plants of the genus Spartina. In infected cells, flexuous particles and pinwheel inclusion bodies were found that resemble those of potyvirids. To date, the NCBI database contains only two partial sequences of a German (Nessmersiel) and an Italian (Assisi) isolate, suggesting that SpMV could be the first member of a new genus, called "Sparmovirus", in the family Potyviridae. In this study, the first complete genome sequence of the German SpMV isolate (SpMV Ger) was determined. The genome of SpMV is a single-stranded, monopartite, polyadenylated RNA consisting of 9376 nucleotides. Sequence analysis revealed a genome organization similar to that of classical potyviruses, including many conserved features. In phylogenetic analysis, SpMV could not be assigned to any of the known genera, but it showed the closest relationship to rymoviruses and common reed chlorotic stripe virus (CRCSV, unassigned). Sequence comparisons confirmed that a new genus should be established containing SpMV, CRCSV, and three Bermuda grass mosaic virus isolates, which are considered divergent strains of SpMV.

First Report of Cucurbit chlorotic yellows virus Infecting Cucumber, Melon, and Squash in Iran.

Yellowing diseases of field- and greenhouse-grown cucurbits are becoming increasingly important in many cucurbit cultivation areas in Iran. Virus surveys were conducted from 2011 to 2012 in greenhouse-grown cucumber (Cucumis sativus L.) and field-cultivated cucumber, squash (Cucurbita sp.) and melon (Cucumis melo L.) in Tehran, Semnan, Bushehr, Hormozgan, Isfahan, Yazd, and Fars provinces, the major cucurbit-growing areas in Iran. Leaf samples with various symptoms, e.g., chlorosis, interveinal chlorotic spots on lower leaves, bright yellow color or sever yellowing on older leaves, were collected and screened for the presence of the whitefly transmitted criniviruses (family Closteroviridae) Cucurbit chlorotic yellows virus (CCYV) and Cucurbit yellow stunting disorder virus (CYSDV) through double-antibody sandwich (DAS)-ELISA, using CCYV and CYSDV specific antisera (DSMZ, Germany). The ELISA results showed that of 347 cucumber leaf samples originating from cucumber greenhouses, 170 and 65 were positive for CCYV and CYSDV, respectively, and 45 samples were infected with both viruses. In addition, of 147 leaf samples collected from melon, cucumber, and squash grown in open fields, 57 and 53 were infected with CCYV and CYSDV, respectively, and 14 were infected with both viruses. These results indicate that these two viruses are widely distributed on these cucurbit crops in Iran. CCYV was not detected in Bushehr and CYSDV was not detected in Isfahan and Hormozgan provinces. To confirm the presence of CCYV and CYSDV, total RNA was extracted (Sigma Chemical, St. Louis, MO) from 18 samples that reacted positive in DAS-ELISA originating from different surveyed provinces. RT-PCR was carried out using specific primers Crini-s2 (5'-CATTCCTACCTGTTTAGCCA-3') (2) and Crini-as1 (5'-ATCCTTCGCAGTGAAAAACC-3') to amplify a 460-bp fragment of the HSP70 gene and CCYV using specific primers CCYV-HSP-F1 (5'-TGCGTATGTCAATGGTGTTATG-3') and CCYV-HSP-R1 (5'-ATCCTTCGCAGTGAAAAACC-3') to amplify a 462-bp fragment of the HSP70 gene (latter 3 primers from [3]). Expected DNA fragments for CYSDV and CCYV were amplified from 11 (CCYV 7/11, CYSDV 4/11) of 18 samples but not from any of the healthy controls. Further analysis by sequencing three selected PCR products amplified with primers CCYV-HSP-F1/R1 showed complete consensus among the sequences, and in comparison with sequences available at GenBank, the highest identities were obtained to Asian CCYV isolates (94% nt/98% aa identity). The CCYV sequences were deposited in GenBank under accessions KC559449 to KC559451. The identity of the amplified CYSDV DNA could also be confirmed by sequencing of three PCR products. CCYV has first been proven to occur in different countries in East Asia and has recently been reported from Sudan (2) and Lebanon (1), indicating the putative spread of the virus wherever cucurbits are grown and its vector, the whitefly Bemisia tabaci, is present. Large populations of whiteflies were present in all surveyed areas. However, to our knowledge, this is the first report for the occurrence of CCYV in Iran. In conclusion, the presence of CCYV and CYSDV in the major cucurbit growing provinces and the large whitefly population pose a serious threat to cucurbit production in Iran. References: (1) P. E. Abrahamian et al. Plant Dis. 96:1704, 2012. (2) K. Hamed et al. Plant Dis. 95:1321, 2011. (3) R. Zeng et al. Plant Dis. 95:354, 2011.

First Report of Garlic common latent virus Infecting Garlic in Sudan.

Garlic (Allium sativum L.) is one of the most important vegetable field crops in Sudan, cultivated on an area of more than 6,000 ha with a total yield of 27,000 t in 2010 (faostat.fao.org). As part of a project which started in 2010 to improve the garlic production in Sudan, samples from local varieties showing severe mosaic and/or mottling were collected in winter 2011 from the main production areas in River Nile State, Northern State, and Darfur State. The plant material used for garlic production came from Sudan and was not imported. Because no reliable data were available on which viruses occur in garlic in Sudan, specific tests were initially omitted. In order to get an overview of the viruses present, dsRNA was prepared of a mixed leaf sample (12 leaves of different samples). This resulted in a high molecular weight dsRNA of approximately 9 kbp that served as template for a random RT-PCR followed by cloning and sequencing (3). Three identical clones originating from one PCR product covering the C-terminal part of the coat protein to the N-terminal part of the nucleic acid binding protein showed the highest sequence similarity to Garlic common latent virus (GarCLV). The nucleotide sequence identities of the 554-bp insert range from 85% to an isolate from India (Accession No. FJ154841) up to 97% to a GarCLV isolate from The Netherlands (AB004804), identifying the virus as a Sudanese isolate of GarCLV, one of the most common garlic infecting viruses. GarCLV belongs to the genus Carlavirus (1) and has previously been reported from Asia, Europe, and South America ( http://sdb.im.ac.cn/vide/descr352.htm ). In order to confirm these results, a double antibody sandwich (DAS)-ELISA was performed with six individual garlic samples in which five samples showed a clear reaction with a GarCLV specific antiserum (AS-0230, DSMZ, Germany). The occurrence of GarCLV could be further confirmed for the ELISA positive samples by a specific RT-PCR using the primers published by Majumder and Baranwal (2). Fragments of the expected size were obtained for all five samples. In addition, one of the positive samples was examined by electron microscopy (Dr. K. Richert-Pöggeler, JKI Braunschweig); filamentous flexous particles typical for carlaviruses could be observed. The random RT-PCR sequence obtained in this study has been submitted to GenBank (KC013030). To our knowledge, this is the first report of GarCLV in garlic in Sudan and Africa. The impact of GarCLV on garlic production in Sudan needs to be evaluated, but the awareness of the occurrence of the virus and the availability of a reliable diagnostic tool will help to select virus-free propagation material. This will form the basis for a sustainable garlic production. References: (1) A. M. Q. King et al. Virus Taxonomy 924, 2012. (2) S. Majumder and V. K. Baranwal. Plant Dis. 93:106, 2009. (3) W. Menzel et al. Arch. Virol. 154:1343, 2009.

Sequencing of the Tamus red mosaic virus genome: further evidence that it is a distinct species of the genus Potexvirus.

In 1993, a virus causing red mosaic and leaf distortion has been isolated from black bryony (Tamus communis) in Italy. Based on particle properties and serology, the virus was assigned to the genus Potexvirus and named Tamus red mosaic virus (TRMV), pending a genome sequence. The original Italian TRMV isolate was submitted to the DSMZ plant virus collection (PV-0397). To confirm the taxonomic status of the virus, the entire genome sequence was determined comprising 6,495 nucleotides excluding the poly(A)-tail. Five putative open reading frames (ORFs) in an arrangement typical for potexviruses were predicted. TRMV is closely related to but distinct from Clover yellow mosaic virus and Allium virus X. In addition to previous morphological and serological characterization, the results presented in this study further reinforce the classification of TRMV as a distinct virus species of the genus Potexvirus.

First Report of Shallot virus X in Onion in Sudan.

Onion (Alium cepa L.) is among the most important vegetable field crops in Sudan. During a disease survey in crops (cvs. Kamleen Yellow and Abu-freua) conducted in 2010, samples showing mild mottling symptoms were collected from Shambat Research Station Farm, Khartoum North, Sudan. A CF-11 cellulose chromatography dsRNA preparation (4) of a mixed onion leaf sample of five plants (20 g) resulted, apart from smaller dsRNAs up to 3 kbp, in a high molecular weight dsRNA of approximately 9 kbp. This dsRNA was used as a template for a random reverse transcriptase (RT)-PCR followed by cloning (4) and sequencing of two randomly selected clones by the ABI BigDye Terminator v3.1 Cycle Sequencing Kit. Comparison with sequences available at GenBank revealed high identities to Shallot virus X (ShVX). ShVX is the type member of the genus Allexivirus (Alphaflexiviridae). One sequence obtained showed 84% nt and 98% aa sequence identity (genome position 414 to 1,285 of Accession No. M97264) to the replicase, whereas the other sequence partially covered the ORF4 and coat protein (CP) coding region (7,127 to 7,998). This sequence showed 80% nt (entire sequence) and 80/89% aa sequence identity to the ORF4 encoded protein/coat protein of a Russian ShVX isolate, respectively. ShVX was first reported in shallot in Russia (2) and subsequently in the Netherlands, Germany, India (3), and New Zealand (1). To confirm the presence of ShVX in Sudan, 32 symptomatic leaf samples were collected in 2011 from different onion fields in Khartoum North, with a similar disease incidence compared to 2010. Thirty-one of these onion samples reacted positively in a double antibody sandwich-ELISA with a ShVX-specific antiserum (DSMZ AS-1042). Total RNA was extracted from five ShVX-ELISA positive onion samples using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer's protocol. Two primer pairs were also designed on the basis of sequences obtained in the random RT-PCR approach, targeting a 659-bp fragment of the coat protein region (ShVX-CPs 5'GTTGAATGTGGCGAGCGCAA3' and ShVX-CPas 5'AGTGCAGAAGCCTTCCACA3') or a 686-bp fragment of the replicase (ShVX-Rs 5'ATGTACTTCGGTACGGCATCA3' and ShVX-R-as 5'TAATCGAATGAGGTCGGCCA3'). Fragments of the expected sizes were obtained for all positive samples. One RT-PCR product of each primer pair was directly sequenced, showing high sequence identities to those previously obtained (>98%). The random RT-PCR sequences obtained in this study were submitted to GenBank (JQ751056 and JQ751057). On the basis of the nucleotide sequences obtained with the dsRNA template, ShVX specific RT-PCR, and ELISA, the presence of ShVX in Sudan was confirmed in two consecutive years. To our knowledge, this is the first report of ShVX in Sudan and Africa, indicating this virus is more widespread than previously reported. The presence of ShVX also suggests the presence of its only known vector, the mite Aceria tulipae. The virus may have been introduced to Sudan by infected onion sets. Even if the impact of ShVX on onion production has not been determined, its identification and the availability of a diagnostic antiserum may be helpful to select virus-free propagation material in order to achieve sustainable onion production in Sudan. References: (1) Z. Egusquiza et al. New Disease Reports 18:29, 2008. (2) K. V. Kanyuka et al. J. Gen. Virol. 73:2553, 1992. (3) S. Majumder et al. New Disease Reports 15:52, 2007. (4) W. Menzel et al. Arch. Virol. 154:1343, 2009.

First Report of Cucurbit chlorotic yellows virus Infecting Muskmelon and Cucumber in Sudan.

In summer 2009, a survey for virus diseases in cucurbits was conducted in open fields and plastichouses in Khartoum State, the most important growing area for cucurbits in Sudan. Chlorosis and yellowing symptoms on middle and lower leaves were observed on many muskmelon (Cucumis melo L.) plants grown in open fields in the Assilat agricultural scheme and on approximately 80% of the cucumber (Cucumis sativus L.) plants grown in plastichouses in Khartoum North. Large populations of whiteflies (Bemisia tabaci L.) were present in both locations. Leaf symptoms that were observed were similar to those caused by Cucurbit chlorotic yellows virus (CCYV), a recently described new Crinivirus species infecting cucurbits in Japan (4), indicating presence of this virus previously only reported from Japan, Taiwan (2), and China (1). Samples from seven symptomatic muskmelon leaves were collected from individual plants grown in different open fields in Assilat and from a symptomatic cucumber plant grown in a plastichouse. Total RNA was extracted from these samples with the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) to amplify putative CCYV sequences with primers (Crini-s2 5'-CATTCCTACCTGTTTAGCCA and Crini-as2 5'-TGCACTTATAATCTGCTGGTAC) designed from CCYV sequences available at GenBank. A 353-bp DNA fragment of the HSP70 gene was amplified by reverse transcription (RT)-PCR for all samples. Further analysis by direct sequencing of two PCR products showed 99 to 100% nt sequence identity to Asian CCYV isolates. Amplification of the coat protein sequence with the primer pair (CCYV-CPs 5'-ATGGAGAAGACTGACAATAAACAA and CCYV-CPas 5'-TTTACTACAACCTCCCGGTG) followed by cloning and sequencing yielded a 760-bp fragment having 99% nucleotide sequence identity to all Asian isolates. For confirmation, dsRNA preparations of symptomatic muskmelon tissue (collected in June 2010) were made, showing dsRNA patterns typical for criniviruses after separation on agarose gels. This dsRNA was used as template for random RT-PCR followed by sequencing of the cloned PCR products (3). Comparison with sequences available at GenBank revealed that cDNA sequences from dsRNA also were 99 to 100% identical to the CCYV genome sequence (AB523788.1). Whitefly transmission of the virus was confirmed by giving a population of B. tabaci an acquisition access period of 24 h and a further 24 h on muskmelon and cucumber seedlings. Symptoms were observed after 5 to 7 days, and the presence of CCYV was confirmed by RT-PCR. In conclusion, symptoms, RT-PCR, and dsRNA sequencing results confirm the presence and establishment of CCYV in cucurbit crops in Sudan. It is remarkable that the sequences obtained from the Sudanese samples show only negligible sequence differences from Asian isolates. Because of the large whitefly vector populations, the spread of CCYV to neighboring countries in Africa and potentially southern Europe, or wherever cucurbits are grown, can be expected. To our knowledge, this is the first report of CCYV in Sudan and outside Eastern Asia. The sequences obtained in this study have been submitted to GenBank under Accession Nos. JF807053 to JF807055. References: (1) Q. S. Gu et al. Plant Dis. 95:73, 2011. (2) L. H. Huang et al. Plant Dis. 94:1168, 2010. (3) W. Menzel et al. Arch. Virol. 154:1343, 2009. (4) M. Okuda et al. Phytopathology 100:560, 2010.

First Report of Malva vein clearing virus Naturally Occurring in Hollyhock in Germany.

Hollyhocks are popular garden plants and selected cultivars of Alcea rosea (family Malvaceae) are widespread in Germany. In spring 2009, dozens of A. rosea plants displaying strong vein clearing and veinal yellowing symptoms were found in private gardens in Hannover, Lower Saxony. Electron microscopic examinations of negatively stained adsorption preparations of five randomly selected samples of symptomatic plants or their offshoots revealed flexuous filamentous particles resembling those of potyviruses. Sap extracts also reacted strongly positive in an antigen coated plate (ACP)-ELISA with the broad-spectrum potyvirus antiserum AS-0573/I (DSMZ, Braunschweig, Germany). RNA extracts (RNeasy Kit, Qiagen, Valencia, CA) of the above mentioned leaf samples were used as templates in reverse transcription (RT)-PCR assays with potyvirus specific primers (2) that have been shown to amplify the 3' terminus of the genome of many potyvirus species. For extracts from symptomatic samples, this resulted in a consistent amplification of an ~1.6-kbp fragment, whereas no products were obtained from RNA extracts of asymptomatic plants. From one positive sample, the amplified fragment was cloned and one clone was partially sequenced. The nucleotide (nt) and amino acid sequences showed the highest identities (81 to 83% and 87 to 90%, respectively) to GenBank sequences FJ539084, FM212972, EU884405, and FJ561293 of the potyvirus Malva vein clearing virus (MVCM). On the basis of these identity values and according to the species demarcation criteria in the genus Potyvirus, the virus can be regarded as a German isolate of the recently sequenced MVCV (3,4). Direct sequencing of the 5'-end of the amplified RT-PCR fragment revealed sequences of only one potyvirus species. The virus isolate has been submitted to the DSMZ Plant Virus Collection (Braunschweig, Germany) under accession PV-0963 and the sequence obtained from the cloned cDNA is deposited in GenBank (GQ856544). In addition, sap from affected leaves was mechanically inoculated onto sets of herbaceous indicator plants (Chenopodium quinoa, C. foliosum, C. murale, C. amaranticolor, Datura stramonium, Nicotiana benthamiana, N. hesperis, Petunia hybrida, and Solanum lycopersicum) of which only C. quinoa plants became infected. Symptoms of weak chlorosis along and beside veins of inoculated leaves, but not systemic leaves, became visible 2 weeks postinoculation. Symptomatic leaves contained flexuous filamentous particles and ACP-ELISA and RT-PCR confirmed virus presence. The partially sequenced amplicon showed 99% nt identity to the sequence from the cloned cDNA. To our knowledge, this is the first report of a MVCV isolate naturally occurring in A. rosea and C. quinoa is the first host identified that does not belong to the plant family Malvaceae. In contrast, the MVCV isolate used in the host range study of Lunello et al. (4) did not infect A. rosea and C. quinoa, confirming previous host range descriptions by Brunt et al. (1). Since MVCV infections of hollyhocks seem to cause only leaf symptoms and do not noticeably affect growth or flowering of the plants, this will hopefully not impair the usability of this popular garden plant. References: (1) A. A. Brunt et al. Descriptions and Lists from the VIDE Database. Online publication. Version: 16th January, 1997. (2) J. Chen et al. Arch. Virol. 146:757, 2001. (3) A. Hein Phytopathol. Z. 28:205, 1957. (4) P. Lunello et al. Virus Res. 140:91, 2009.

Serological and Molecular Identification of Chickpea chlorotic stunt virus from Chickpea in Iran.

During a survey of chickpea (Cicer arietinum L.) crops in western Iran in July 2009, leaf samples from yellow and stunted plants were collected from fields in the provinces of Kermanshah (n = 30) and Lorestan (n = 16). Symptoms suggested infections by luteoviruses, such as viruses of the Beet western yellows virus (BWYV) subgroup (e.g., Turnip yellows virus [TuYV]) (4) and Chickpea chlorotic stunt virus (CpCSV), a virus first described from Ethiopia (1) and recently reported from other countries of West Asia and North Africa (2). All 46 samples were analyzed by triple-antibody sandwich (TAS)-ELISA (3) using the luteovirus-specific monoclonal antibody (MAb) B-2-5G4 (1), a mixture of three MAbs (1-1G5, -3H4, and -4B12) to an Ethiopian (Eth) isolate of CpCSV (1), and six individual MAbs (5-1F10, -2B8, -3D5, -5B8, -6F11, and 6-4E10) to a CpCSV isolate from Syria (Sy) (2) in combination with a mixture of polyclonal antibodies to CpCSV and BWYV for plate coating. CpCSV-Eth and -Sy were used as positive controls. Six of the sixteen Lorestan samples and two of the thirty Kermanshah samples reacted with MAb B-2-5-G4, indicating infections with a luteovirus. While none of the 46 samples reacted with the mixture of the CpCSV-Eth specific MAbs, two (Lorestan No. 25 and Kermanshah No. 31) of the eight MAb B-2-5-G4-positive samples reacted strongly with each of the six individual MAbs to CpCSV-Sy. Since this indicated the presence of a serotype II isolate of CpCSV in these two chickpea samples from Iran, we tried to confirm this by reverse transcriptase (RT)-PCR. TRI-Reagent (Sigma, St. Louis, MO) was used for total RNA extraction from samples Nos. 25 and 31. RT-PCR was carried out using the primers 5'-CAC GTG AGA TCA ATA GTC AAT GAA TAC GGT CG-3' (sense) and 5'-TTT GTA ATT ACC AAY ATT CCA-3' (antisense) derived from the CpCSV coat protein (CP) gene and 5' end of ORF5, the readthrough domain (RTD), respectively. In RT-PCR experiments, no amplification was observed from healthy plant extracts, but chickpea samples Nos. 25 and 31 yielded amplicons of ~1,100 bp, which were used for cloning and sequencing. The sequences of the complete CP gene and 5' end of ORF5 (RTD) from the two samples were determined and deposited in GenBank (GU930837 and GU930838). Sequence analysis revealed that the two Iranian isolates were most similar to each other, sharing CP nucleotide and amino acid (aa) sequence identities of 97.8 and 99.1%, respectively. They differed from each other only in 3 of the 200 aa positions of their CP sequences and were indistinguishable in the 128 N-terminal aa positions of their RTD sequences. When using DNAMAN for phylogenetic analysis, they clustered with serogroup-II isolates of CpCSV from Egypt, Morocco, and Syria (2), with which they were most closely related (approximately 98% in CP aa sequence). While the two Iranian CpCSV isolates differed by approximately 10% in CP aa sequences from serotype-I isolates of CpCSV, they differed strikingly (by ~27%) in RTD aa sequences from CpCSV-Eth, a serotype-I isolate and the only CpCSV isolate for which RTD sequences are available. To our knowledge, this is the first report of the occurrence of CpCSV in Iran. The virus can cause yellowing and stunting of chickpea similar to symptoms caused by other viruses reported from this crop. References: (1) A. D. Abraham et al. Phytopathology 96:437, 2006. (2) A. D. Abraham et al. Arch. Virol 154:791, 2009. (3) A. Franz et al. Ann. Appl. Biol. 128:255, 1996. (4) K. M. Makkouk et al. J. Plant Dis. Prot. 110:157, 2003.

Molecular, serological and biological variation among chickpea chlorotic stunt virus isolates from five countries of North Africa and West Asia.

Chickpea chlorotic stunt virus (CpCSV), a proposed new member of the genus Polerovirus (family Luteoviridae), has been reported only from Ethiopia. In attempts to determine the geographical distribution and variability of CpCSV, a pair of degenerate primers derived from conserved domains of the luteovirus coat protein (CP) gene was used for RT-PCR analysis of various legume samples originating from five countries and containing unidentified luteoviruses. Sequencing of the amplicons provided evidence for the occurrence of CpCSV also in Egypt, Morocco, Sudan, and Syria. Phylogenetic analysis of the CP nucleotide sequences of 18 samples from the five countries revealed the existence of two geographic groups of CpCSV isolates differing in CP sequences by 8-10%. Group I included isolates from Ethiopia and Sudan, while group II comprised those from Egypt, Morocco and Syria. For distinguishing these two groups, a simple RFLP test using HindIII and/or PvuII for cleavage of CP-gene-derived PCR products was developed. In ELISA and immunoelectron microscopy, however, isolates from these two groups could not be distinguished with rabbit antisera raised against a group-I isolate from Ethiopia (CpCSV-Eth) and a group-II isolate from Syria (CpCSV-Sy). Since none of the ten monoclonal antibodies (MAbs) that had been produced earlier against CpCSV-Eth reacted with group-II isolates, further MAbs were produced. Of the seven MAbs raised against CpCSV-Sy, two reacted only with CpCSV-Sy and two others with both CpCSV-Sy and -Eth. This indicated that there are group I- and II-specific and common (species-specific) epitopes on the CpCSV CP and that the corresponding MAbs are suitable for specific detection and discrimination of CpCSV isolates. Moreover, CpCSV-Sy (group II) caused more severe stunting and yellowing in faba bean than CpCSV-Eth (group I). In conclusion, our data indicate the existence of a geographically associated variation in the molecular, serological and presumably biological properties of CpCSV.

First Report of Carrot red leaf virus and Carrot mottle virus, Causal Agents of Carrot Motley Dwarf, in Carrot in Mauritius.

Carrot motley dwarf (CMD) affects carrot and other apiaceous plants by causing leaf yellowing or reddening as well as plant stunting and leads often to serious economic losses wherever these crops are grown (2). CMD has been reported from Australia, Europe, Japan, Israel, and North America and is known to result from a mixed infection by at least two viruses, the polerovirus, Carrot red leaf virus (CtRLV), and one of the umbraviruses, Carrot mottle virus (CMoV) or Carrot mottle mimic virus (CMoMV). The viruses are transmitted in a circulative persistent manner by aphid species (Cavariella spp.). In November of 2008, symptoms typical of CMD were observed in carrot (Daucus carota) and coriander (Coriandrum sativum) plantations in the region of Henrietta in the central part of Mauritius. Carrot cultivars affected were Victoria, Sigma, and Namdhari. Incidences of up to 50% were recorded in some fields. Symptoms were observed mainly on plants near the edges of fields and were initially attributed to physiological factors. However, following RNA extraction from affected carrot plants and reverse transcription (RT)-PCR, fragments of the expected sizes (CtRLV; 377 bp: CMoV; 549 bp) were obtained. For CtRLV, a pair of degenerate primers (S2/AS3 [1]) for poleroviruses, and for the above mentioned umbraviruses, a universal primer pair (UmbraCS: CTTTGGAGTACACAACAACTCC and UmbraCAS: GCA/GTCIAGICCIACACAA/GACTGG, I = Inosin; unpublished) was used. Direct sequencing of one PCR product for each virus (Eurofins MWG Operon GmbH, Martinsried, Germany) and comparison with sequences retrieved from GenBank resulted in nucleotide and amino acid sequence identities of 93 and 90% (coat protein) to the CtRLV strain UK-1 (Accession No. AY695933) and 86 and 96% (replicase) to the German CMoV isolate (Accession No. FJ188473), respectively. Carrot samples also tested CtRLV-positive in triple-antibody sandwich-ELISA using polyclonal IgGs to CtRLV for trapping and a mixture of two CtRLV-specific monoclonal antibodies (CtRLV-2-3A9 and CtRLV 3-4B9) as detecting antibodies (all from the stock of the Julius Kuehn Institute; H. J. Vetten, Braunschweig, Germany). The presence of CMoV was confirmed by sap transmission to Nicotiana benthamiana and N. occidentalis 'P1', which resulted in vein yellowing/etching symptoms. In addition, agarose gel electrophoresis of the dsRNA extract of a primary infected carrot sample revealed major dsRNAs of approximately 4.2 and 1.4 kbp, which represent the genomic and subgenomic RNAs of an umbravirus. Thus, sequence analysis, as well as serological and biological data, demonstrates that CMD-affected carrot plants from Mauritius were infected with CtRLV and CMoV isolates closely related to those from Europe. The sequences obtained in this study for CtRLV and CMoV have been deposited in GenBank under Accession Nos. FJ969849 and FJ969848, respectively. To our knowledge, this is the first report of CMD in Mauritius and the Indian Ocean Region. Future works comprise an island wide survey across carrot-growing regions to determine the incidence of the virus complex and the natural host range of the viruses in Mauritius. References: (1) A. D. Abraham et al. Plant Dis. 91:1059, 2007. (2) A. F. Murant. No 137 in: Descriptions of Plant Viruses. Assoc. Appl. Biol. Kew, England, 1974.

Construction of an infectious full-length cDNA clone of potato virus M.

An infectious full-length cDNA clone of potato virus M (PVM) was produced. Total RNA was extracted from PVM-infected Nicotiana hesperis plants and used for cDNA synthesis. Subsequent RT-PCR produced two DNA fragments of about 5.5 and 3.2 kbp, which were ligated downstream of an enhanced 35S cauliflower mosaic virus promoter. After cloning of the enhanced 35S promoter with the PVM sequence into a modified pBIN19 plasmid and electroporation of Agrobacterium tumefaciens, the agroinoculated PVM full-length clone (pPVM-flc) led to systemic PVM infections in different host plants, causing symptoms indistinguishable from those caused by wild-type PVM.

First Report of Soybean dwarf virus (Genus Luteovirus) Infecting Faba Bean and Clover in Germany.

In 2003, leaf samples from faba bean plants (Vicia faba L.) showing slight growth reductions and yellowing symptoms were collected in a field near Hebenshausen, Hesse, Germany. Some of these samples did not react in triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) with species-specific monoclonal antibodies (Mabs) to either Bean leaf roll virus or Turnip yellows virus, but did react with a broad-spectrum Mab (B-2-5G4) used to detect viruses in the genera Polerovirus and Luteovirus (family Luteoviridae) (1). Since this indicated the occurrence of a hitherto unrecognized polero- or luteovirus in faba bean in Germany, attempts were made to obtain nucleotide sequence information on two of the unknown faba bean isolates using a pair of degenerate primers (S2 [5'-ATCACITTCGGGCCGWSTCTATCAGA-3'] and AS3 [5'-CACGCGTCIACCTATTTIGGRTTITG-3'] [I = inosine]) derived from conserved domains in the capsid protein (CP) genes of several polero- and luteoviruses. Following reverse transcription (RT)-PCR amplification and cloning, the CP gene sequences of two genetically distinct isolates of Soybean dwarf virus (SbDV), a species of the genus Luteovirus, were obtained. To our knowledge, SbDV has not been reported from Germany or Europe but only from Africa, Australia, Japan, and the United States. In the two latter countries, at least two SbDV strain groups, SbDV-Y (for yellowing) and SbDV-D (for dwarfing), are distinguished on the basis of differences in symptomatology, host range, and molecular properties (2-4). On the basis of CP aa sequences, the two faba bean isolates from Hebenshausen differed by 8%, with one (FB1) most similar (>96% identity) to SbDV-D isolates and the other (FB2) closely related (>96%) to SbDV-Y isolates. Similar to observations in Japan (3) and the United States (2), we were able to detect SbDV in numerous samples from red clover (Trifolium pratense) and white clover (T. repens) in Braunschweig using SbDV antibodies (Agdia, Elkhart, IN) in DAS-ELISA. This was confirmed by RT-PCR amplification of CP gene sequences using SbDV-specific primers (SbDVs: 5'-GTCTACCTAAAAATTTCAAAGAATCTG-3'; SbDVas: 5'-CGGACCCGGTTCTCCGTCTA-3'). CP sequence analysis of two SbDV-positive clover samples revealed the presence of a SbDV-D isolate in red clover. However, a white clover plant contained an unusual SbDV isolate that possessed a unique CP, sharing aa sequence identities of approximately 92% with the two faba bean isolates from Germany and only 88.5 to 90.5% with other SbDV isolates. Attempts at aphid transmission of SbDV isolates from clover to faba bean were only successful for the combination Acyrthosiphon pisum and the white clover isolate. No faba bean seedlings became infected when the aphid species Aulacorthum solani and Aphis craccivora were given acquisition access feedings of 48 to 72 h on SbDV-infected white and red clover plants. The sequences determined in this study were deposited in GenBank (Accession Nos. EF466131-EF466134). References: (1) A. D. Abraham et al. Phytopathology 96:437, 2006. (2) V. D. Damsteegt et al. Phytopathology 89:374, 1999. (3) T. Tamada and M. Kojima. No. 179 in: Descriptions of Plant Viruses. Assoc. Appl. Biol. Kew, England, 1977. (4) H. Terauchi et al. Arch. Virol. 146:1885, 2001.

Chickpea chlorotic stunt virus: A New Polerovirus Infecting Cool-Season Food Legumes in Ethiopia.

ABSTRACT Serological analysis of diseased chickpea and faba bean plantings with yellowing and stunting symptoms suggested the occurrence of an unknown or uncommon member of the family Luteoviridae in Ethiopia. Degenerate primers were used for reverse transcriptase-polymerase chain reaction amplification of the viral coat protein (CP) coding region from both chickpea and faba bean samples. Cloning and sequencing of the amplicons yielded nearly identical (96%) nucleotide sequences of a previously unrecognized species of the family Luteoviridae, with a CP amino acid sequence most closely related (identity of approximately 78%) to that of Groundnut rosette assistor virus. The complete genome (5,900 nts) of a faba bean isolate comprised six major open reading frames characteristic of polero-viruses. Of the four aphid species tested, only Aphis craccivora transmitted the virus in a persistent manner. The host range of the virus was confined to a few species of the family Fabaceae. A rabbit antiserum raised against virion preparations cross-reacted unexpectedly with Beet western yellows virus-like viruses. This necessitated the production of murine monoclonal antibodies which, in combination with the polyclonal antiserum, permitted both sensitive and specific detection of the virus in field samples by triple-antibody sandwich, enzyme-linked immunosorbent assay. Because of the characteristic field and greenhouse symptoms in chickpea, the name Chickpea chlorotic stunt virus is proposed for this new member of the genus Polerovirus (family Luteoviridae).

Multiplex RT-PCR-ELISA compared with bioassay for the detection of four apple viruses.

A sensitive and reliable multiplex RT-PCR-ELISA technique for the detection of Apple chlorotic leaf spot virus, Apple stem pitting virus, Apple mosaic virus and Apple stem grooving virus was developed. This technique is compared with the method used commonly for indexing by woody indicators, which is time consuming and expensive. For the RT-PCR-ELISA technique, the amplified products were labeled with digoxigenin during the RT-PCR by incorporation of a digoxigenin labeled primer. After hybridization of the PCR products to specific capture oligonucleotides, which were bound covalently to the surface of NucleoLink strips, anti-digoxigenin antibodies were used for detection. More than 100 samples were tested in parallel by indexing and multiplex-RT-PCR-ELISA. All infections detected by woody indicators were also detected by multiplex RT-PCR-ELISA. Furthermore, additional infections were only found by multiplex RT-PCR-ELISA. The colourimetric detection of multiplex-RT-PCR products was at least as sensitive and sometimes slightly more sensitive than detection by gel electrophoresis. The results show that this molecular technique is more reliable for the detection of the above mentioned apple viruses than indexing by woody indicators, thereby helping to reduce cost and time during the certification of plant material.

Simultaneous retrieval of atmospheric profiles, land-surface temperature, and surface emissivity from Moderate-Resolution Imaging Spectroradiometer thermal infrared data: extension of a two-step physical algorithm.

An extension to the two-step physical retrieval algorithm was developed. Combined clear-sky multitemporal and multispectral observations were used to retrieve the atmospheric temperature-humidity profile, land-surface temperature, and surface emissivities in the midwave (3-5 microns) and long-wave (8-14.5 microns) regions. The extended algorithm was tested with both simulated and real data from the Moderate-Resolution Imaging Spectroradiometer (MODIS) Airborne Simulator. A sensitivity study and error analysis demonstrate that retrieval performance is improved by the extended algorithm. The extended algorithm is relatively insensitive to the uncertainties simulated for the real observations. The extended algorithm was also applied to real MODIS daytime and nighttime observations and showed that it is capable of retrieving medium-scale atmospheric temperature water vapor and retrieving surface temperature emissivity with retrieval accuracy similar to that achieved by the Geostationary Operational Environmental Satellite (GOES) but at a spatial resolution higher than that of GOES.

Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control.

Two multiplex RT-PCR assays with specific coamplification of plant mRNA as an internal control from total nucleic acids are described for the parallel detection of Apple chlorotic leaf spot virus, Apple stem pitting virus, Apple mosaic virus and Apple stem grooving virus. All are important economically and common pathogens in commercial apple and pear cultivars, except for Apple mosaic virus. Four virus specific primer pairs and one primer pair which allows the specific amplification of mRNA of the mitochondrial nad5 gene are described. Specificity of all primer pairs was confirmed by sequencing the RT-PCR products. A range of different virus isolates from various geographic origins could be detected by these multiplex RT-PCR assays all year round. Viruses were detected reliably in composite extracts at a ratio of one part total nucleic acid extract from an infected sample mixed with 39 parts of extract from healthy samples. The use of the internal control minimizes the risk of obtaining false negative RT-PCR results, which is desirable for routine testing, and avoids the need to eliminate contaminating DNA in extracts. To our knowledge, this is the first report on the use of a specific internal RNA control from total nucleic acids. The multiplex RT-PCR assays described are reliable, rapid and sensitive methods for the detection of these viruses, and may replace techniques need commonly like indexing by woody indicators or ELISA.

New measurement of the rare decay K+ --> pi(+)&mgr;(+)&mgr;(-)

More than 400 K+-->pi(+)&mgr;(+)&mgr;(-) events were observed in a rare K+ decay experiment at the Brookhaven Alternating Gradient Synchrotron. Normalized to the K+-->pi(+)pi(+)pi(-) decay, the branching ratio is determined to be [9.22+/-0.60(stat)+/-0. 49(syst)]x10(-8). This branching ratio and the &mgr;&mgr; mass spectrum is in very good agreement with the measurement of the K+-->pi(+)e(+)e(-) decay, but deviates significantly from the previous measurement.