Higher-order G-quadruplex structures and porphyrin ligands: Towards a non-ambiguous relationship.

Herein, we evaluated the interaction of the tetracationic porphyrin H2TCPPSpm4 with three distinct DNA G-quadruplex (G4) models, i.e., the tetramolecular G4 d(TGGGGT)4 (Q1), the 5'-5' stacked G4-dimer [d(CGGAGGT)4]2 (Q2), and a mixture of 5'-5' stacked G-wires [d(5'-CGGT-3'-3'-GGC-5')4]n (Qn). The combined data obtained from UV-Vis, CD, fluorescence, PAGE, RLS, AFM, NMR, and HPLC-SEC experiments allowed us to shed light on the binding mode of H2TCPPSpm4 with the three G4 models differing for the type and the number of available G4 ending faces, the length of the G4 units, and the number of stacked G4 building blocks. Specifically, we found that H2TCPPSpm4 interacted with the shortest Q1 as an end-stacking ligand, whereas the groove binding mode was ascertained in the case of the Q2 and Qn G4 models. In the case of the interaction with Q1 and Qn, we found that H2TCPPSpm4 induces the formation of supramolecular aggregates at porphyrin/G4 ratios higher than 2:1, whereas no significant aggregation was observed for the interaction with Q2 up to the 5:1 ratio. These results unambiguously demonstrated the suitability of porphyrins for the development of specific G4 ligands or G4-targeting diagnostic probes, being H2TCPPSpm4 capable to distinguish between different G4s.

Carrier capability of halloysite nanotubes for the intracellular delivery of antisense PNA targeting mRNA of neuroglobin gene.

Peptide nucleic acid (PNA) is a DNA mimic that shows good stability against nucleases and proteases, forming strongly recognized complementary strands of DNA and RNA. However, due to its feeble ability to cross the cellular membrane, PNA activity and its targeting gene action is limited. Halloysite nanotubes (HNTs) are a natural and low-cost aluminosilicate clay. Because of their peculiar ability to cross cellular membrane, HNTs represent a valuable candidate for delivering genetic materials into cells. Herein, two differently charged 12-mer PNAs capable of recognizing as molecular target a 12-mer DNA molecule mimicking a purine-rich tract of neuroglobin were synthetized and loaded onto HNTs by electrostatic attraction interactions. After characterization, the kinetic release was also assessed in media mimicking physiological conditions. Resonance light scattering measurements assessed their ability to bind complementary single-stranded DNA. Furthermore, their intracellular delivery was assessed by confocal laser scanning microscopy on living MCF-7 cells incubated with fluorescence isothiocyanate (FITC)-PNA and HNTs labeled with a probe. The nanomaterials were found to cross cellular membrane and cell nuclei efficiently. Finally, it is worth mentioning that the HNTs/PNA can reduce the level of neuroglobin gene expression, as shown by reverse transcription-quantitative polymerase chain reaction and western blotting analysis.

Exploring the DNA2-PNA heterotriplex formation in targeting the Bcl-2 gene promoter: A structural insight by physico-chemical and microsecond-scale MD investigation.

Peptide Nucleic Acids (PNAs) represent a promising tool for gene modulation in anticancer treatment. The uncharged peptidyl backbone and the resistance to chemical and enzymatic degradation make PNAs highly advantageous to form stable hybrid complexes with complementary DNA and RNA strands, providing higher stability than the corresponding natural analogues. Our and other groups' research has successfully shown that tailored PNA sequences can effectively downregulate the expression of human oncogenes using antigene, antisense, or anti-miRNA approaches. Specifically, we identified a seven bases-long PNA sequence, complementary to the longer loop of the main G-quadruplex structure formed by the bcl2midG4 promoter sequence, capable of downregulating the expression of the antiapoptotic Bcl-2 protein and enhancing the anticancer activity of an oncolytic adenovirus. Here, we extended the length of the PNA probe with the aim of including the double-stranded Bcl-2 promoter among the targets of the PNA probe. Our investigation primarily focused on the structural aspects of the resulting DNA2-PNA heterotriplex that were determined by employing conventional and accelerated microsecond-scale molecular dynamics simulations and chemical-physical analysis. Additionally, we conducted preliminary biological experiments using cytotoxicity assays on human A549 and MDA-MB-436 adenocarcinoma cell lines, employing the oncolytic adenovirus delivery strategy.

Summary of the Current Status of DNA Vaccination for Alzheimer Disease.

Alzheimer disease (AD) is one of the most common and disabling neuropathies in the ever-growing aged population around the world, that especially affects Western countries. We are in urgent need of finding an effective therapy but also a valid prophylactic means of preventing AD. There is a growing attention currently paid to DNA vaccination, a technology particularly used during the COVID-19 era, which can be used also to potentially prevent or modify the course of neurological diseases, including AD. This paper aims to discuss the main features and hurdles encountered in the immunization and therapy against AD using DNA vaccine technology. Ultimately, this work aims to effectively promote the efforts in research for the development of safe and effective DNA and RNA vaccines for AD.

Multicomponent Peptide-Based Hydrogels Containing Chemical Functional Groups as Innovative Platforms for Biotechnological Applications.

Multicomponent hydrogels (HGs) based on ultrashort aromatic peptides have been exploited as biocompatible matrices for tissue engineering applications, the delivery of therapeutic and diagnostic agents, and the development of biosensors. Due to its capability to gel under physiological conditions of pH and ionic strength, the low molecular-weight Fmoc-FF (Nα-fluorenylmethoxycarbonyl-diphenylalanine) homodimer is one of the most studied hydrogelators. The introduction into the Fmoc-FF hydrogel of additional molecules like protein, organic compounds, or other peptide sequences often allows the generation of novel hydrogels with improved mechanical and functional properties. In this perspective, here we studied a library of novel multicomponent Fmoc-FF based hydrogels doped with different amounts of the tripeptide Fmoc-FFX (in which X= Cys, Ser, or Thr). The insertion of these tripeptides allows to obtain hydrogels functionalized with thiol or alcohol groups that can be used for their chemical post-derivatization with bioactive molecules of interest like diagnostic or biosensing agents. These novel multicomponent hydrogels share a similar peptide organization in their supramolecular matrix. The hydrogels' biocompatibility, and their propensity to support adhesion, proliferation, and even cell differentiation, assessed in vitro on fibroblast cell lines, allows us to conclude that the hybrid hydrogels are not toxic and can potentially act as a scaffold and support for cell culture growth.

The 3-(3-oxoisoindolin-1-yl)pentane-2,4-dione (ISOAC1) as a new molecule able to inhibit Amyloid ß aggregation and neurotoxicity.

Amyloid ß 1-42 (Aß1-42) protein aggregation is considered one of the main triggers of Alzheimer's disease (AD). In this study, we examined the in vitro anti-amyloidogenic activity of the isoindolinone derivative 3-(3-oxoisoindolin-1-yl)pentane-2,4-dione (ISOAC1) and its neuroprotective potential against the Aß1-42 toxicity. By performing the Thioflavin T fluorescence assay, Western blotting analyses, and Circular Dichroism experiments, we found that ISOAC1 was able to reduce the Aß1-42 aggregation and conformational transition towards ß-sheet structures. Interestingly, in silico studies revealed that ISOAC1 was able to bind to both the monomer and a pentameric protofibril of Aß1-42, establishing a hydrophobic interaction with the PHE19 residue of the Aß1-42 KLVFF motif. In vitro analyses on primary cortical neurons showed that ISOAC1 counteracted the increase of intracellular Ca2+ levels and decreased the Aß1-42-induced toxicity, in terms of mitochondrial activity reduction and increase of reactive oxygen species production. In addition, confocal microscopy analyses showed that ISOAC1 was able to reduce the Aß1-42 intraneuronal accumulation. Collectively, our results clearly show that ISOAC1 exerts a neuroprotective effect by reducing the Aß1-42 aggregation and toxicity, hence emerging as a promising compound for the development of new Aß-targeting therapeutic strategies for AD treatment.

Polymorphism of G-quadruplexes formed by short oligonucleotides containing a 3'-3' inversion of polarity: From G:C:G:C tetrads to π-π stacked G-wires.

G-wires are supramolecular DNA structures based on the G-quadruplex (G4) structural motif obtained by the self-assembly of interlocked slipped G-rich oligonucleotide (ON) strands, or by end-to-end stacking of G4 units. Despite the increasing interest towards G-wires due to their potential applications in DNA nanotechnologies, the self-assembly process to obtain G-wires having a predefined length and stability is still neither completely understood nor controlled. In our previous studies, we demonstrated that the d(5'CG2-3'-3'-G2C5') ON, characterized by the presence of a 3'-3'-inversion of polarity site self-assembles into a G-wire structure when annealed in the presence of K+ ions. Herein, by using CD, PAGE, HPLC size exclusion chromatography, and NMR investigations we studied the propensity of shorter analogues having sequences 5'CGn-3'-3'-GmC5' (with n = 1 and 1 ≤ m ≤ 3) to form the corresponding G-quadruplexes and stacked G-wires. The results revealed that the formation of G-wires starting from d(5'CGn-3'-3'-GmC5') ONs is possible only for the sequences having n and m > 1 in which both guanosines flanking the 5'-ending cytosines are not involved into the 3'-3' phosphodiester bond.

ZnO Tetrapods for Label-Free Optical Biosensing: Physicochemical Characterization and Functionalization Strategies.

In this study, we fabricated three different ZnO tetrapodal nanostructures (ZnO-Ts) by a combustion process and studied their physicochemical properties by different techniques to evaluate their potentiality for label-free biosensing purposes. Then, we explored the chemical reactivity of ZnO-Ts by quantifying the available functional hydroxyl groups (-OH) on the transducer surface necessary for biosensor development. The best ZnO-T sample was chemically modified and bioconjugated with biotin as a model bioprobe by a multi-step procedure based on silanization and carbodiimide chemistry. The results demonstrated that the ZnO-Ts could be easily and efficiently biomodified, and sensing experiments based on the streptavidin target detection confirmed these structures' suitability for biosensing applications.

State of art in the chemistry of nucleoside-based Pt(II) complexes.

After the fortuitous discovery of the anticancer properties of cisplatin, many Pt(II) complexes have been synthesized, to obtain less toxic leads which could overcome the resistance phenomena. Given the importance of nucleosides and nucleotides as antimetabolites, studying their coordinating properties towards Pt(II) ions is challenging for bioorganic and medicinal chemistry. This review aims to describe the results achieved so far in the aforementioned field, paying particular attention to the synthetic aspects, the chemical-physical characterization, and the biological activities of the nucleoside-based Pt(II) complexes.

Ultrashort Cationic Peptide Fmoc-FFK as Hydrogel Building Block for Potential Biomedical Applications.

Fmoc-diphenylalanine (Fmoc-FF) is a low-molecular-weight peptide hydrogelator. This simple all-aromatic peptide can generate self-supporting hydrogel materials, which have been proposed as novel materials for diagnostic and pharmaceutical applications. Our knowledge of the molecular determinants of Fmoc-FF aggregation is used as a guide to design new peptide-based gelators, with features for the development of improved tools. Here, we enlarge the plethora of Fmoc-FF-based hydrogelated matrices by studying the properties of the Fmoc-FFK tripeptide, alone or in combination with Fmoc-FF. For multicomponent matrices, the relative weight ratios between Fmoc-FFK and Fmoc-FF (specifically, 1/1, 1/5, 1/10, and 1/20 w/w) are evaluated. All the systems and their multiscale organization are studied using different experimental techniques, including rheology, circular dichroism, Fourier transform infrared spectroscopy, and scanning electron microscopy (SEM). Preliminary profiles of biocompatibility for the studied systems are also described by testing them in vitro on HaCaT and 3T3-L1 cell lines. Additionally, the lysine (K) residue at the C-terminus of the Fmoc-FF moiety introduces into the supramolecular material chemical functions (amino groups) which may be useful for modification/derivatization with bioactive molecules of interest, including diagnostic probes, chelating agents, active pharmaceutical ingredients, or peptide nucleic acids.

Exploring the Relationship between G-Quadruplex Nucleic Acids and Plants: From Plant G-Quadruplex Function to Phytochemical G4 Ligands with Pharmaceutic Potential.

G-quadruplex (G4) oligonucleotides are higher-order DNA and RNA secondary structures of enormous relevance due to their implication in several biological processes and pathological states in different organisms. Strategies aiming at modulating human G4 structures and their interrelated functions are first-line approaches in modern research aiming at finding new potential anticancer treatments or G4-based aptamers for various biomedical and biotechnological applications. Plants offer a cornucopia of phytocompounds that, in many cases, are effective in binding and modulating the thermal stability of G4s and, on the other hand, contain almost unexplored G4 motifs in their genome that could inspire new biotechnological strategies. Herein, we describe some G4 structures found in plants, summarizing the existing knowledge of their functions and biological role. Moreover, we review some of the most promising G4 ligands isolated from vegetal sources and report on the known relationships between such phytochemicals and G4-mediated biological processes that make them potential leads in the pharmaceutical sector.

Development of Surface Chemical Strategies for Synthesizing Redox-Responsive Diatomite Nanoparticles as a Green Platform for On-Demand Intracellular Release of an Antisense Peptide Nucleic Acid Anticancer Agent.

Redox-responsive silica drug delivery systems are synthesized by aeco-friendly diatomite source to achieve on-demand release of peptide nucleic acid (PNA) in tumor reducing microenvironment, aiming to inhibit the immune checkpoint programmed cell death 1 receptor/programmed cell death receptor ligand 1 (PD-1/PD-L1) in cancer cells. The nanoparticles (NPs) are coated with polyethylene glycol chains as gatekeepers to improve their physicochemical properties and control drug release through the cleavable disulfide bonds (S-S) in a reductive environment. This study describes different chemical conditions to achieve the highest NPs' surface functionalization yield, exploring both multistep and one-pot chemical functionalization strategies. The best formulation is used for covalent PNA conjugation via the S-S bond reaching a loading degree of 306 ± 25 µg PNA mg-1 DNPs . These systems are used for in vitro studies to evaluate the kinetic release, biocompatibility, cellular uptake, and activity on different cancer cells expressing high levels of PD-L1. The obtained results prove the safety of the NPs up to 200 µg mL-1 and their advantage for controlling and enhancing the PNA intracellular release as well as antitumor activity. Moreover, the downregulation of PD-L1 observed only with MDA-MB-231 cancer cells paves the way for targeted immunotherapy.

CD, UV, and In Silico Insights on the Effect of 1,3-Bis(1'-uracilyl)-2-propanone on Serum Albumin Structure.

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1'-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein. Through circular dichroism (CD) and UV spectroscopy, we demonstrated that the compound, but not the similar thymine derivative T2O, was able to alter the secondary structure of the serum albumin leading to significant consequences in terms of BSA structure with respect to the unbound protein (Δß-turn + Δß-sheet = +23.6%, Δα = -16.7%) as revealed in our CD binding studies. Moreover, molecular docking studies suggested that U2O is preferentially housed in the domain IIIB of the protein, and its affinity for the albumin is higher than that of the reference ligand HA 14-1 (HDOCK score (top 1-3 poses): -157.11 ± 1.38 (U2O); -129.80 ± 6.92 (HA 14-1); binding energy: -7.6 kcal/mol (U2O); -5.9 kcal/mol (HA 14-1)) and T2O (HDOCK score (top 1-3 poses): -149.93 ± 2.35; binding energy: -7.0 kcal/mol). Overall, the above findings suggest the ability of 1,3-bis(1'-uracilyl)-2-propanone to bind serum albumins and the observed reduction of the α-helix structure with the concomitant increase in the ß-structure are consistent with a partial protein destabilization due to the interaction with U2O.

Cytosine-rich oligonucleotides incorporating a non-nucleotide loop: A further step towards the obtainment of physiologically stable i-motif DNA.

i-Motifs, also known as i-tetraplexes, are secondary structures of DNA occurring in cytosine-rich oligonucleotides (CROs) that recall increasing interest in the scientific community for their relevance in various biological processes and DNA nanotechnology. This study reports the design of new structurally modified CROs, named Double-Ended-Linker-CROs (DEL-CROs), capable of forming stable i-motif structures. Here, two C-rich strands having sequences d(AC4A) and d(C6) have been attached, in a parallel fashion, to the two linker's edges by their 3' or 5' ends. The resulting DEL-CROs have been investigated for their capability to form i-motif structures by circular dichroism, poly-acrylamide gel electrophoresis, HPLC-size-exclusion chromatography, and NMR studies. This investigation established that DEL-CROs could form more stable i-motif structures than the corresponding unmodified CROs. In particular, the i-motif formed by DEL-5'-d(C6)2 resulted stable enough to be detected even at near physiological conditions (37 °C, pH 7.0). The results open the way to developing pH-switchable nanocarriers and aptamers based on suitably functionalized DEL-CROs.

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin.

Trans-polydatin (tPD), the 3-ß-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.

Nucleic Acids as Biotools at the Interface between Chemistry and Nanomedicine in the COVID-19 Era.

The recent development of mRNA vaccines against the SARS-CoV-2 infection has turned the spotlight on the potential of nucleic acids as innovative prophylactic agents and as diagnostic and therapeutic tools. Until now, their use has been severely limited by their reduced half-life in the biological environment and the difficulties related to their transport to target cells. These limiting aspects can now be overcome by resorting to chemical modifications in the drug and using appropriate nanocarriers, respectively. Oligonucleotides can interact with complementary sequences of nucleic acid targets, forming stable complexes and determining their loss of function. An alternative strategy uses nucleic acid aptamers that, like the antibodies, bind to specific proteins to modulate their activity. In this review, the authors will examine the recent literature on nucleic acids-based strategies in the COVID-19 era, focusing the attention on their applications for the prophylaxis of COVID-19, but also on antisense- and aptamer-based strategies directed to the diagnosis and therapy of the coronavirus pandemic.

Exploring a peptide nucleic acid-based antisense approach for CD5 targeting in chronic lymphocytic leukemia.

We herein report an innovative antisense approach based on Peptide Nucleic Acids (PNAs) to down-modulate CD5 expression levels in chronic lymphocytic leukemia (CLL). Using bioinformatics tools, we selected a 12-mer tract of the CD5 mRNA as the molecular target and synthesized the complementary and control PNA strands bearing a serine phosphate dipeptide tail to enhance their water solubility and bioavailability. The specific recognition of the 12-mer DNA strand, corresponding to the target mRNA sequence by the complementary PNA strand, was confirmed by non-denaturing polyacrylamide gel electrophoresis, thermal difference spectroscopy, circular dichroism (CD), and CD melting studies. Cytofluorimetric assays and real-time PCR analysis demonstrated the downregulation of CD5 expression due to incubation with the anti-CD5 PNA at RNA and protein levels in Jurkat cell line and peripheral blood mononuclear cells from B-CLL patients. Interestingly, we also observed that transfection with the anti-CD5 PNA increases apoptotic response induced by fludarabine in B-CLL cells. The herein reported results suggest that PNAs could represent a potential candidate for the development of antisense therapeutic agents in CLL.

3D Chitosan-Gallic Acid Complexes: Assessment of the Chemical and Biological Properties.

Three-dimensional chitosan-gallic acid complexes were proposed and prepared for the first time by a simple adsorption process of gallic acid (GA) on three-dimensional chitosan structures (3D chitosan). Highly porous 3D devices facilitate a high GA load, up to 2015 mmol/kg at pH 4.0. The preservation of the redox state of GA released from 3D chitosan was confirmed by spectroscopic analyses. The antioxidant activity of 3D chitosan-GA complexes was assessed using the DPPH radical scavenging assay and was found to be dramatically higher than that of free chitosan. The mechanical property of 3D chitosan-GA complexes was also evaluated using a compression test. Finally, 3D chitosan-GA complexes showed a significant antimicrobial capacity against E. coli and S. aureus, selected, respectively, as a model strain for Gram-negative and Gram-positive bacteria. Our study demonstrated a new, simple, and eco-friendly approach to prepare functional chitosan-based complexes for nutraceutical, cosmeceutical, and pharmaceutical applications.

Structure- and Interaction-Based Design of Anti-SARS-CoV-2 Aptamers.

Aptamer selection against novel infections is a complicated and time-consuming approach. Synergy can be achieved by using computational methods together with experimental procedures. This study aims to develop a reliable methodology for a rational aptamer in silico et vitro design. The new approach combines multiple steps: (1) Molecular design, based on screening in a DNA aptamer library and directed mutagenesis to fit the protein tertiary structure; (2) 3D molecular modeling of the target; (3) Molecular docking of an aptamer with the protein; (4) Molecular dynamics (MD) simulations of the complexes; (5) Quantum-mechanical (QM) evaluation of the interactions between aptamer and target with further analysis; (6) Experimental verification at each cycle for structure and binding affinity by using small-angle X-ray scattering, cytometry, and fluorescence polarization. By using a new iterative design procedure, structure- and interaction-based drug design (SIBDD), a highly specific aptamer to the receptor-binding domain of the SARS-CoV-2 spike protein, was developed and validated. The SIBDD approach enhances speed of the high-affinity aptamers development from scratch, using a target protein structure. The method could be used to improve existing aptamers for stronger binding. This approach brings to an advanced level the development of novel affinity probes, functional nucleic acids. It offers a blueprint for the straightforward design of targeting molecules for new pathogen agents and emerging variants.

Probing the Ca2+ mobilizing properties on primary cortical neurons of a new stable cADPR mimic.

Cyclic adenosine diphosphate ribose (cADPR) is a second messenger involved in the Ca2+ homeostasis. Its chemical instability prompted researchers to tune point by point its structure, obtaining stable analogues featuring interesting biological properties. One of the most challenging derivatives is the cyclic inosine diphosphate ribose (cIDPR), in which the hypoxanthine isosterically replaces the adenine. As our research focuses on the synthesis of N1 substituted inosines, in the last few years we have produced new flexible cIDPR analogues, where the northern ribose has been replaced by alkyl chains. Interestingly, some of them mobilized Ca2+ ions in PC12 cells. To extend our SAR studies, herein we report on the synthesis of a new stable cIDPR derivative which contains the 2″S,3″R dihydroxypentyl chain instead of the northern ribose. Interestingly, the new cyclic derivative and its open precursor induced an increase in intracellular calcium concentration ([Ca2+]i) with the same efficacy of the endogenous cADPR in rat primary cortical neurons.