[Comparison of efficacy and safety of insulin aspart injection Rishulin and NovoRapid for treatment of diabetes: a multicenter, randomized, open-labeled, controlled trial].

Objective: To compare the efficacy and safety of Tonghua Dongbao's insulin aspart injection (Rishulin) and NovoRapid (Novo Nordisk) in the treatment of diabetes. Methods: A 26-week, randomized, open-label, parallel-group, positive control drug and non-inferiority trial was conducted in 23 centers in China. A total of 563 diabetes with poor blood glucose control treated with insulin for at least 3 months before were included. The subjects were randomized(stratified block random method) into those receiving Rishulin or NovoRapid at a ratio of 3∶1. Both groups were combined with basal insulin (Lantus). The primary endpoint was the change in glycosylated hemoglobin (HbA1c) from baseline to the end of 24 weeks of treatment. Results: For full analysis set, after 24 weeks of treatment, HbA1c level of Ruishulin group decreased from (8.66±1.28)% to (7.77±1.09)% (P<0.001), and that of NovoRapid group decreased from (8.47±1.28) % to (7.65±0.97) % (P<0.001). Treatment difference in HbA1c (NovoRapid group-Ruishulin group) was -0.061% (95%CI -0.320-0.199). HbA1c<7.0% target reacing rates were 24.26% and 21.21% (P=0.456), and HbA1c<6.5% target reacing rates were 9.65% and 6.82% (P=0.310) in Ruishulin group and NovoRapid group, repectively. The standard 2 hours postprandial blood glucose (2hPG) in Ruishulin group decreased from (16.23±5.22) mmol/L to (12.65±4.57) mmol/L (P<0.001), and 2hPG in NovoRapid group decreased from (16.13±5.37) mmol/L to (11.91)±4.21) mmol/L (P<0.001). The fingertips blood glucose at 7-point of both groups exhibited varying degrees of reduction compared with those at baseline, repectively. Positive ratios of specific antibodies were 31.68% in Ruishulin group and 36.36% in NovoRapid group (P=0.320). Ratios of negative to positive were 7.43% and 10.61% (P=0.360), and ratios of positive to negative were 10.40% and 7.58% (P=0.360) in Ruishulin group and NovoRapid group, respectively. The incidence of hypoglycemia was 60.05% and 55.40% (P=0.371), and the incidence of adverse events was 76.60% and 77.70% (P=0.818) in Ruishulin group and NovoRapid group, respectively. Conclusions: Rishulin is not inferior to NovoRapid, and has shown good efficacy and safety. It can be an ideal choice for clinicians in patients with poor blood glucose control with insulin.

Lipocalin-2: a role in hepatic gluconeogenesis via AMP-activated protein kinase (AMPK).

PURPOSE: Evidence is accumulating that lipocalin2 (LCN2) is implicated in insulin resistance and glucose homeostasis, but the underlying possible mechanisms remain unclear. This study is to investigate the possible linkage between LCN2 and AMP-activated protein kinase (AMPK) or forkhead transcription factor O1 (FoxO1), which influences insulin sensitivity and gluconeogenesis in liver. METHODS: LCN2 knockout (LCN2KO) mice and wild-type littermates were used to evaluate the effect of LCN2 on insulin sensitivity and hepatic gluconeogenesis through pyruvate tolerance test (PTT), glucose tolerance test (ipGTT), insulin tolerance test (ITT), and hyperinsulinemic-euglycemic clamps, respectively. LCN2KO mice and WT mice in vivo, and in vitro HepG2 cells were co-transfected with adenoviral FoxO1-siRNA (Ad-FoxO1-siRNA) or adenovirus expressing constitutively active form of AMPK (Ad-CA-AMPK), or dominant negative adenovirus AMPK (Ad-DN-AMPK), the relative mRNA and protein levels of two key gluconeogenic enzymes phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (G6P) were measured. RESULTS: Improved insulin sensitivity and inhibited gluconeogenesis in the LCN2KO mice were confirmed by pyruvate tolerance tests and hyperinsulinemic-euglycemic clamps. Nuclear FoxO1 and its downstream genes PEECK and G6P were decreased in the livers of the LCN2KO mice, and AMPK activity was stimulated and directly phosphorylated FoxO1. In vitro, AMPK activity was inhibited in HepG2 cells overexpressing LCN2 leading to a decrease in phosphorylated FoxO1 and an increase in nuclear FoxO1. CONCLUSION: The present study demonstrates that LCN2 regulates insulin sensitivity and glucose metabolism through inhibiting AMPK activity, and regulating FoxO1 and its downstream genes PEPCK/G6P, which regulate hepatic gluconeogenesis.

Metformin improves the glucose and lipid metabolism via influencing the level of serum total bile acids in rats with streptozotocin-induced type 2 diabetes mellitus.

OBJECTIVE: To study the effects of metformin on streptozotocin-induced type 2 diabetes mellitus (T2DM) in rats. MATERIALS AND METHODS: Wistar male rats were divided into two groups: standard diet (SD, n = 20) group and high-fat diet (HFD, n = 80) group. Twenty rats in HFD group were randomly treated with metformin (EI group). After 6 weeks, among rats in HFD group, 20 rats were intraperitoneally injected with citrate buffered saline (IR group), 20 rats treated with metformin per day for 4 weeks (LI group), and 20 rats were given nothing (DM group). Rats in SD group were injected with citrate buffered saline as normal control (NC) group. Moreover, streptozotocin (STZ) was used for inducing diabetes. The metabolic parameters, such as body weight, fasting blood glucose (FBG), fasting insulin concentration (FINS), total cholesterol (TC), total triglycerides (TG), low-density lipoprotein cholesterol (LDLC) and total bile acid (TBA) were measured. RESULTS: Compared with SD group, the levels of body weight, FBG, TC, LDLC, TBA and FINS and AUC (glucose) were significantly higher in HFD group. After administration of metformin, the levels of FBG, TG, TC, LDLC and TBA in DM and LI group were higher than NC group. Besides, the FBG, TG, TC, TBA and LDLC levels in EI group were higher than DM group. CONCLUSIONS: Metformin may help to improve the glucose and lipid metabolism by influencing the level of serum total bile acids. A combination of HFD and metformin could be effective in the treatment of rats with T2DM.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response.

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

[Survey on sex ratio of the children from one-child families in Shihezi in the Xinjiang Uigur autonomous region].

PIP: A survey of 1 child families in the Shihezi area showed a higher ratio of boys, 920 boys vs. 822 girls (1.12:1.00). There was also a higher ratio of boys among children born between 1975-1980, but the proportion of girls was higher among children born before 1974. The ratio of boys was higher among firstborn children born between 1976-1980 (1.086:1.00), while the sex ratio was 1.00 among 2nd born children born between 1976-1980. School children between age 6-18 showed 6266 boys and 6218 girls (1.01:1.00). The sex ratio of the total population in the Shihezi area was 1.05:1:00; this coincides with our national ratio of 1.08:1.00 (1953 census) and the world sex ratio of 1.0035:1.00 in 1975. The universal occurrence of more males than females is probably a result of physiological factors. It is actually beneficial to the country to have a slightly higher ratio of males because many jobs are more suitable for men because of their physical condition and the accidental death rate is also higher for men. The slightly higher percentage of boys among single child families was not statistically significant (P0.05).^ieng