Molecular and Functional Characterization of Human Sex-Determining Region on the Y Chromosome Variants Using Protamine 1 Promoter.

The male sex-determining gene, sex-determining region on the Y chromosome (SRY), is expressed in adult testicular germ cells; however, its role in regulating spermatogenesis remains unclear. The role of SRY in the postmeiotic gene expression was investigated by determining the effect of SRY on the promoter of the haploid-specific Protamine 1 (PRM1) gene, which harbors five distinct SRY-binding motifs. In a luciferase reporter assay system, SRY upregulates PRM1 promoter activity in vitro in a dose-dependent manner. Through a gel-shift assay involving a 31-bp DNA fragment encompassing the SRY element within the PRM1 promoter, the third SRY-binding site on the sense strand (-373/-367) was identified as crucial for PRM1 promoter activation. This assay was extended to analyze 9 SRY variants found in the testicular DNA of 44 azoospermia patients. The findings suggest that SRY regulates PRM1 promoter activity by directly binding to its specific motif within the PRM1 promoter.

Prevalence and Determinants of Excessive Screen Viewing Time in Children Aged 3-15 Years and Its Effects on Physical Activity, Sleep, Eye Symptoms and Headache.

Screen viewing time is the total time spent by a child on any digital/electronic device. The objective of the present study was to determine the prevalence and predictors of excessive screen viewing time in children in Ujjain, India. This cross-sectional, community-based study was conducted through a house-to-house survey using the three-stage cluster sampling method in 36 urban wards and 36 villages of Ujjain District, India. Excessive screen viewing time was defined as screen viewing for >2 h/day. The prevalence of excessive screen viewing time was 18%. Risk factors identified using the multivariate logistic regression model were age (OR: 1.63, p < 0.001); mobile phone use before bedtime (OR: 3.35, p = 0.004); parents' perception about the child's habituation to screen time (OR: 8.46, p < 0.001); television in the bedroom (OR: 35.91, p < 0.001); morning mobile screen viewing time (OR: 6.40, p < 0.001); not reading books other than textbooks (OR: 6.45, p < 0.001); and lack of outdoor play for >2 h (OR: 5.17, p < 0.001). The presence of eye pain was a protective factor for excessive screen viewing time (OR: 0.13, p = 0.012). This study identified multiple modifiable risk factors for excessive screen viewing time.

Demystifying COVID-19 lung pathology: A clinicopathological study of postmortem core needle biopsy.

BACKGROUND: Atypical presentation of coronavirus disease-19 (COVID-19) from classic acute respiratory distress syndrome needs to be extensively evaluated to understand the pathophysiology to optimize the management protocol for severely ill patients to abrogate the terminal event. METHODS: Autopsy core needle biopsies of lungs were obtained from 12 patients who died with COVID-19. Routine histopathological examination of lung tissue along with immunohistochemical analysis of C4d complement staining was studied. Formalin-fixed paraffin-embedded biopsy material was also subjected to real-time reverse transcription-polymerase chain reaction for severe acute respiratory syndrome - coronavirus (SARS-CoV2) gene. RESULTS: In the study, all the deceased patients were symptomatic with two-thirds suffering from isolated SARS-CoV2-related pneumonia while remaining one-third had secondary COVID-19 infection. Histopathological evaluation highlights diffuse alveolar damage as the predominant pattern; however, complement-mediated endothelial injury of septal microvasculature, and microthrombi was also distinctly observed with increased serum levels of D-Dimer and fibrinogen-degradation products. The patients who had extrapulmonary manifestations at the time of presentation also showed pulmonary vascular lesions on histopathologic examination. Our study confirms the presence of coagulopathy and immune-mediated microthrombi in pulmonary septal microvasculature in patients with severe disease. CONCLUSION: The results of our small series of patients highlight the possibility of immune-mediated pulmonary vascular injury and thrombosis which has the potential to evolve into large vessel thrombosis and pulmonary embolism in critically ill patients. Definitive therapeutic management protocol including thromboembolic prophylaxis and development of effective immune-modulatory target could possibly reduce mortality in severely ill patients.

Mutational landscape of the human Y chromosome-linked genes and loci in patients with hypogonadism.

Sex chromosome-related anomalies engender plethora of conditions leading to male infertility. Hypogonadotropic hypogonadism (HH) is a rare but well-known cause of male infertility. Present study was conducted to ascertain possible consensus on the alterations of the Y-linked genes and loci in males representing hypogonadism (H), which in turn culminate in reproductive dysfunction. A total of nineteen 46, XY males, clinically diagnosed with H (11 representative HH adults and eight prepubertal boys suspected of having HH) were included in the study. Sequence-tagged site screening,SRY gene sequencing,fluorescence in situ hybridization mapping (FISH), copy number and relative expression studies by real-time PCR were conducted to uncover the altered status of the Y chromosome in the patients. The result showed random microdeletions within the AZFa (73%)/b (78%) and c(26%) regions. Sequencing of the SRY gene showed nucleotide variations within and outside of the HMG box in four males (21%). FISH uncovered mosaicism for SRY, AMELY,DAZ genes and DYZ1 arrays, structural rearrangement for AMELY (31%) and duplication of DAZ (57%) genes. Copy number variation for seven Y-linked genes (2-8 rounds of duplication), DYZ1 arrays (495-6201 copies) and differential expression of SRY,UTY and VCY in the patients' blood were observed. Present work demonstrates the organizational vulnerability of several Y-linked genes in H males. These results are envisaged to be useful during routine diagnosis of H patients.

Transcriptional dynamics of homeobox C11 gene in water buffalo bubalus bubalis.

The Hox complex contains 39 genes clustered into four groups involved in cell differentiation and development. We cloned full-length sequence of Hoxc11 gene from water buffalo Bubalus bubalis, assessed its copy number, localized the same onto the chromosome 5, and studied its evolutionary conservation across the species. Northern hybridization of Hoxc11 showed a 2.2 kb band in the tissues analyzed. Real-Time PCR showed highest expression of Hoxc11 gene in lung followed by spleen, spermatozoa, and testis. Six interacting partners of this gene showed higher expression in spleen, lung, testis, and spermatozoa. During the early stages of development, Hoxc11 and its interacting partners both showed lower expression, which then became prominent during the age of 1-3 years, regressed drastically thereafter, and remained so until the animal's life time (∼ 20 years). The high expression of Hoxc11 and its interacting partners in spermatozoa and testis during the onset of puberty suggests its likely role in the differentiation of gonads and subsequent reproductive activities. Additional work on Hoxc11 especially, in the context of respiratory, immunological, and in/fertility in other species, including humans would be useful for establishing its broader biological significance towards the enrichment of functional and comparative genomics.

RsaI repetitive DNA in Buffalo Bubalus bubalis representing retrotransposons, conserved in bovids, are part of the functional genes.

BACKGROUND: Repetitive sequences are the major components of the eukaryotic genomes. Association of these repeats with transcribing sequences and their regulation in buffalo Bubalus bubalis has remained largely unresolved. RESULTS: We cloned and sequenced RsaI repeat fragments pDp1, pDp2, pDp3, pDp4 of 1331, 651, 603 and 339 base pairs, respectively from the buffalo, Bubalus bubalis. Upon characterization, these fragments were found to represent retrotransposons and part of some functional genes. The resultant clones showed cross hybridization only with buffalo, cattle, goat and sheep genomic DNA. Real Time PCR, detected ~2 × 10(4) copies of pDp1, ~ 3000 copies of pDp2 and pDp3 and ~ 1000 of pDp4 in buffalo, cattle, goat and sheep genomes, respectively. RsaI repeats are transcriptionally active in somatic tissues and spermatozoa. Accordingly, pDp1 showed maximum expression in lung, pDp2 and pDp3 both in Kidney, and pDp4 in ovary. Fluorescence in situ hybridization showed repeats to be distributed all across the chromosomes. CONCLUSIONS: The data suggest that RsaI repeats have been incorporated into the exonic regions of various transcribing genes, possibly contributing towards the architecture and evolution of the buffalo and related genomes. Prospects of our present work in the context of comparative and functional genomics are highlighted.

Adherence to treatment guidelines for acute diarrhoea in children up to 12 years in Ujjain, India--a cross-sectional prescription analysis.

BACKGROUND: Diarrhoea accounts for 20% of all paediatric deaths in India. Despite WHO recommendations and IAP (Indian Academy of Paediatrics) and Government of India treatment guidelines, few children suffering from acute diarrhoea in India receive low osmolarity oral rehydration solution (ORS) and zinc from health care providers. The aim of this study was to analyse practitioners' prescriptions for acute diarrhoea for adherence to treatment guidelines and further to determine the factors affecting prescribing for diarrhoea in Ujjain, India. METHODS: This cross-sectional study was conducted in pharmacies and major hospitals of Ujjain, India. We included prescriptions from all practitioners, including those from modern medicine, Ayurveda, Homeopathy as well as informal health-care providers (IHPs). The data collection instrument was designed to include all the possible medications that are given for an episode of acute diarrhoea to children up to 12 years of age. Pharmacy assistants and resident medical officers transferred the information regarding the current diarrhoeal episode and the treatment given from the prescriptions and inpatient case sheets, respectively, to the data collection instrument. RESULTS: Information was collected from 843 diarrhoea prescriptions. We found only 6 prescriptions having the recommended treatment that is ORS along with Zinc, with no additional probiotics, antibiotics, racecadotril or antiemetics (except Domperidone for vomiting). ORS alone was prescribed in 58% of the prescriptions; while ORS with zinc was prescribed in 22% of prescriptions, however these also contained other drugs not included in the guidelines. Antibiotics were prescribed in 71% of prescriptions. Broad-spectrum antibiotics were prescribed and often in illogical fixed-dose combinations. One such illogical combination, ofloxacin with ornidazole, was the most frequent oral antibiotic prescribed (22% of antibiotics prescribed). Practitioners from alternate system of medicine and IHPs are significantly less likely (OR 0.13, 95% CI 0.04-0.46, P = 0.003) to prescribe ORS and zinc than pediatricians. Practitioners from 'free' hospitals are more likely to prescribe ORS and zinc (OR 4.94, 95% CI 2.45-9.96, P < 0.001) and less likely to prescribe antibiotics (OR 0.01, 95% CI 0.01-0-04, P < 0.001) compared to practitioners from 'charitable' hospitals. Accompanying symptoms like the presence of fever, pain, blood in the stool and vomiting significantly increased antibiotic prescribing. CONCLUSION: This study demonstrated low adherence to standard treatment guidelines for management of acute diarrhoea in children under 12 years in Ujjain, India. Key public health concerns were the low use of zinc and the high use of antibiotics, found in prescriptions from both specialist paediatricians as well as practitioners from alternate systems of medicine and informal health-care providers. To improve case management of acute diarrhoea, continuing professional development programme targeting the practitioners of all systems of medicine is necessary.

Genome-wide search of the genes tagged with the consensus of 33.6 repeat loci in buffalo Bubalus bubalis employing minisatellite-associated sequence amplification.

Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5' CCTCCAGCCCTCCTCCAGCCCT 3'), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

Prevalence of extended spectrum beta lactamase and AmpC beta lactamase producers among Escherichia coli isolates in a tertiary care hospital in Jaipur.

Resistance to broad spectrum beta lactams, mediated by extended spectrum beta lactamase (ESbetaL) and AmpC betaL enzymes is an increasing problem worldwide. Presence of these in clinical infections can result in treatment failure if one of the second or third generation cephalosporins is used. Therefore, it is recommended that any ESbetaL-producing organism according to the National Committee for Clinical Laboratory Standards (NCCLS) criteria can be reported as resistant to all extended spectrum beta lactam antibiotics regardless of the susceptibility test results. In this study, a total of 250 Escherichia coli (E. coli) isolates were subjected to Double disc test and AmpC disc test for the detection of ESbetaL- and AmpC betaL-producing strains, respectively. Prevalence of ESbetaL- and AmpC betaL-producing strains among E. coli isolates, over a 3-month-period in the hospital-based population of Jaipur, was 64.80% (162/250). AmpC betaL producers were 24.00% (60/250) and co-existence of ESbetaL and AmpC betaL was detected in 8.00% (20/250) of the isolates.

Genomic instability of the DYZ1 repeat in patients with Y chromosome anomalies and males exposed to natural background radiation.

We assessed genomic instability of 3.4 kb DYZ1 repeat arrays in patients encompassing prostate cancer (PC), cases of repeated abortion (RA) and males exposed to natural background radiation (NBR) using real-time PCR and fluorescence in situ hybridization (FISH). Normal males showed DYZ1 copies ranging from 3000 to 4300, RA, 0-2237; PC, 550; and males exposed to NBR, 1577-5700. FISH showed organizational variation of DYZ1 in these samples substantiating the data obtained from real-time PCR. Of the 10 RA samples, 7 were found to be affected of which, 5 showed deletion of 265 bp from nt 25 to 290 and 773 bp from 1347 to 2119 and 2 showed deletion of 275 bp from nt 3128 to 3402. Copy number variation of DYZ1 in these males correlated with genetic constrains/anomalies. Although precise mechanisms of genomic instability of DYZ1 remains unclear, we construe that this repeat plays a critical role in maintaining the structural integrity of the Y chromosome, possibly by absorbing the load of mutations. This may be used as a marker system to analyze genetic integrity of the DYZ1 repeat array(s) across the spectrum of patients.

Chromosomal localization, copy number assessment, and transcriptional status of BamHI repeat fractions in water buffalo Bubalus bubalis.

Higher eukaryotes contain a wide variety of repetitive DNA, although their functions often remain unknown. We describe cloning, chromosomal localization, copy number assessment, and transcriptional status of 1378- and 673-bp repeat fractions in the buffalo genome. The pDS5, representing the 1378-bp fragment, showed FISH signals in the centromeric region of acrocentric chromosomes only, whereas pDS4, corresponding to 673 bp, detected signals in the centromeric regions of all the chromosomes. Crosshybridization studies of pDS5 and pDS4 with genomic DNA from different sources showed signals only in buffalo, cattle, goat, and sheep. Real-time PCR analysis uncovered 1234 and 3420 copies of pDS5 and pDS4 fragments per the haploid genome, corresponding to 30 and 68 copies per chromosome, respectively. Analysis of cDNA from different tissues of buffalo with Real-time PCR showed maximum expression of pDS5 and pDS4 in the spleen and liver, respectively. Phylogenetic analysis of these sequences showed a close relationship between buffalo and cattle. The prospect of this approach in comparative genomics is highlighted.

Transcriptional status of known and novel genes tagged with consensus of 33.15 repeat loci employing minisatellite-associated sequence amplification (MASA) and real-time PCR in water buffalo, Bubalus bubalis.

We conducted minisatellite-associated sequence amplification (MASA) with an oligo (5' CACCTCTCCACCTGCC 3') based on consensus of 33.15 repeat loci using cDNA from the testis, ovary, spleen, kidney, heart, liver, and lung of water buffalo Bubalus bubalis and uncovered 25 amplicons of six different sizes (1,263, 846/847, 602, 576, 487, and 324 base pairs). These fragments, cloned and sequenced, were found to represent several functional, regulatory, and structural genes. Blast search of all the 25 amplicons showed homologies with 43 transcribing genes across the species. Of these, the 846/847-bp fragment, having homology with the adenylate kinase gene, showed nucleotide changes at six identical places in the ovary and testis. The 1,263; 324; and 487-bp fragments showed homology with the secreted modular calcium binding protein (SMOC-1), leucine-rich repeat neuronal 6A (LRRN6A) mRNA, and human TTTY5 mRNA, respectively. Real-time PCR showed maximum expression of AKL, LRRN6A, and T-cell receptor gamma (TCR-gamma)-like genes in the testis, SMOC-1 in the liver, and the T-cell receptor-like (TCRL) gene in the spleen compared to those used as endogenous control. We construe that these genes have evolved from a common progenitor and conformed to various biological functions during the course of evolution. MASA approach coupled with real-time PCR has potentials to uncover accurate expression of a large number of genes within and across the species circumventing the screening of cDNA library.

Organizational variation of DYZ1 repeat sequences on the human Y chromosome and its diagnostic potentials.

The long arm of the human Y chromosome is flecked with various fractions of repetitive DNA. DYZ1 is one such fraction, which is organized tandemly as an array of a 3.4-kb repeat ranging from 2000-4000 copies in normal males. We have studied the organizational variation of the DYZ1 fraction on the human Y chromosome using DNA samples from CEPH family members and the random population employing the RFLP approach, fluorescence in situ hybridization (FISH), and conducted a similarity search with GenBank sequences. Typing of genomic DNA using DYZ1 as a probe showed an allele length and copy number variations even between two male siblings. Hybridization of DNA from monochromosome hybrids with this probe showed its presence on chromosome 15 in addition to the Y chromosome. Fluorescence in situ hybridization of metaphase chromosomes from an apparently normal male showed DYZ1 sequences in the proximal region of chromosome 11 in addition to the long arm of the Y chromosome. Typing of sets of semen and blood DNA samples from the same human individuals showed discernible allelic variation between the two samples, indicating tissue-specific programmed sequence modulation. DYZ1 seems to be the first probe having the unique potential to discriminate unequivocally the difference between the DNA originating from semen and blood samples, and may be exploited in forensic cases. This probe may also be used as a diagnostic tool to ascertain Y chromosome mosaicism in patients (e.g., Turner), its aberrant status in somatic cells, and possible sequence modulation/rearrangement in the germline samples. Additionally, this can be used to uncover sequence polymorphism in the human population.