Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 12 de 12
Filter
Add more filters











Publication year range
1.
China Pharmacy ; (12): 497-501, 2023.
Article in Chinese | WPRIM (Western Pacific) | ID: wpr-962499

ABSTRACT

Acute ischemic stroke is a cerebrovascular disease with high incidence, high mortality and disability, and high recurrence rate, which seriously endangers patients’ health. Thrombolytic drugs play a key role in the treatment of acute ischemic stroke by activating plasminogen, rapidly dissolving thrombi, reducing platelet aggregation, and achieving successful recanalization. In this study, we reviewed the principle of action of thrombolytic drugs, their classification and use on the basis of current research progress at home and abroad. The results show that the safety and efficacy of thrombolytic drugs have improved significantly from the first generation of thrombolytic drugs, streptokinase, which is not fibrin-specific, to the third generation of thrombolytic drugs, tenecteplase, which not only retain the characteristics of directly activating plasminogen, but also enhance the specificity of fibrin and prolong the half-life. With the development of research, small-molecular compounds with the inhibition of plasminogen activator, or the modification of thrombolytic drugs with strong anti-plasminogen activator inhibition activity in vivo, or the search for new small-molecular substances with thrombolytic effect from microorganisms and natural plants, have become the focus of research on new thrombolytic drugs. The new thrombolytic drugs are likely to replace the current thrombolytic drugs because of greater thrombolytic efficacy and fewer side effects.

2.
Bioengineered ; 13(4): 9708-9728, 2022 04.
Article in English | MEDLINE | ID: mdl-35435132

ABSTRACT

Post-stroke depression (PSD) seriously affects the normal life of patients. Based on the previous sequencing results, this study selected miR-129-5p as the research object, which was significantly reduced in the PSD model by screening. To clarify the regulatory role of miR-129-5p, this study overexpressed and interfered with miR-129-5p in neuronal cells cultured in vitro, tested its effect on neuronal cell autophagy, and determined expressions of fasciculation and elongation protein zeta-1 (FEZ1), short coiled-coil protein (SCOC), unc-51 like autophagy activating kinase 1 (ULK1) and autophagy cargo receptor (NBR1) autophagy-related proteins. The dual-luciferase reporter system and immunoprecipitation were applied to detect the molecular regulatory mechanism of miR-129-5 and FEZ1, SCOC, ULK1 and NBR1. Findings of the present study revealed that the autophagy of neuronal cells was markedly decreased by overexpressing miR-129-5p (p < 0.05), and expressions of FEZ1, SCOC, ULK1 and NBR1 were substantially reduced (p < 0.05). The dual-luciferase reporter system results indicated that FEZ1, SCOC, ULK1 and NBR1 were all miR-129-5p target genes. Furthermore, immunoprecipitation assay revealed that SCOC, ULK1 and NBR1 could directly bind to the FEZ1 protein. The experiments at an animal level demonstrated that miR-129-5p could effectively alleviate the behavioral indicators of PSD model mice. Taken together, this study testified that SCOC/ULK1/NBR1 proteins could directly bind to FEZ1 to form protein complex, and all of the four proteins FEZ1/SCOC/ULK1/NBR1 were miR-129-5p target genes. miR-129-5p overexpression could effectively restore the behavioral characteristics of model mice, and reduce the autophagy-related proteins FEZ1/SCOC/ULK1/NBR1.


Subject(s)
MicroRNAs , Adaptor Proteins, Signal Transducing/metabolism , Animals , Autophagy/genetics , Autophagy-Related Protein-1 Homolog/genetics , Autophagy-Related Protein-1 Homolog/metabolism , Carrier Proteins/genetics , Carrier Proteins/metabolism , Depression/genetics , Humans , Intracellular Signaling Peptides and Proteins/genetics , Intracellular Signaling Peptides and Proteins/metabolism , Luciferases/metabolism , Membrane Proteins/metabolism , Mice , MicroRNAs/genetics , MicroRNAs/metabolism , Nerve Tissue Proteins/metabolism
3.
Bioengineered ; 13(2): 3582-3596, 2022 02.
Article in English | MEDLINE | ID: mdl-35100085

ABSTRACT

To clarify the differential expressions of microRNAs and mRNAs in a PSD model, this study employed PSD mice for model construction by injecting vasoconstrictor ET-1 (angioendothelin-1) into the medial prefrontal cortex (mPFC) of mice. The animals underwent elevated plus maze test, open field test, tail suspension test, and forced swimming test subsequently. Transcriptome sequencing was performed to analyze the differentially expressed mRNAs and microRNAs. The results showed that open arm entries and time of PSD mice were markedly decreased. Times of the entry to center for mice in the model group were apparently decreased. The climbing time of mice in the model group was greatly decreased. The behavior of PSD mice indicated a marked change, and several indicators of the behavioral tests were significantly lower than those of the control group. Transcriptome sequencing analysis demonstrated that expressions of 1 206 genes and 21 microRNAs were markedly upregulated in model group, whereas expressions of 2 113 genes and 32 microRNAs were markedly downregulated. GO analysis revealed that the differentially expressed genes were mainly involved in regulatory pathways of single-multicellular organism process, developmental process, cell periphery, plasma membrane, and neuron projection. Meanwhile, KEGG analysis results indicated that the differentially expressed genes mostly participated in signaling pathways of neuroactive ligand-receptor interaction, calcium signaling pathway, and cytokine-cytokine receptor interaction. In conclusion, differentially expressed microRNAs and mRNAs were screened, which offers a theoretical foundation for further investigation of molecular mechanisms and novel insight for the early identification, prevention, and treatment of PSD.


Subject(s)
Depression , Gene Expression Profiling , Hippocampus/metabolism , MicroRNAs , RNA, Messenger , Stroke , Transcriptome , Animals , Depression/etiology , Depression/genetics , Depression/metabolism , Male , Mice , MicroRNAs/biosynthesis , MicroRNAs/genetics , RNA, Messenger/biosynthesis , RNA, Messenger/genetics , Stroke/complications , Stroke/genetics , Stroke/metabolism , Syndrome
4.
Chinese Journal of Neuromedicine ; (12): 747-750, 2021.
Article in Chinese | WPRIM (Western Pacific) | ID: wpr-1035476

ABSTRACT

Poststroke recrudescence (PSR) is a reappear phenomenon in the neurological symptoms of chronic stroke in the setting of toxic metabolic factors. Infection, hyponatremia, and use of benzodiazepine are important precipitants. In this paper, the risk factors, pathogenesis, clinical characteristics, diagnosis and treatment methods of PSR are reviewed to enhance the understanding of the disease among clinicians.

5.
Article in Chinese | WPRIM (Western Pacific) | ID: wpr-866004

ABSTRACT

In the field of medical education, Ethiopia has made a great progress in recent years. After systematical inquiry of Ethiopia's clinical medical education, this paper elaborates the mode of undergraduate teaching in Ethiopia from aspects of curriculum design, emphasis of contents, teaching methods and assessment methods, and also introduces the development and continuing education of Ethiopian medical students after graduation. Moreover, the "Innovative Track" clinical medical education reform proposed by Ethiopia recently is introduced as well. Therefore, characteristics and advantages of clinical teaching in Ethiopia indicate that in the process of deepening the medical education reform in China, we should learn from different countries. In this way, the development of medical education in China can be promoted better and faster.

6.
Article in Chinese | WPRIM (Western Pacific) | ID: wpr-344207

ABSTRACT

<p><b>OBJECTIVE</b>To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.</p><p><b>METHODS</b>Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.</p><p><b>RESULTS</b>Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.</p><p><b>CONCLUSION</b>The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.</p>


Subject(s)
Adult , Aged , Female , Humans , Male , Middle Aged , Genes, Neurofibromatosis 2 , Mutation , Neurilemmoma , Genetics , Spinal Cord Neoplasms , Genetics
7.
Article in Chinese | WPRIM (Western Pacific) | ID: wpr-413209

ABSTRACT

Objective To investigate the efficacy of intra-arterial thrombolysis with stenting for acute cerebral infarction. Methods Using a prospective case-control design, 24 patients with acute cerebral infarction who remained angiostegnosis ( > 50%) after intra-arterial thrombolysis were randomly divided into stent treatment group and drug treatment group. They were treated with stenting + drug treatment and conventional drug treatment. The rates of vascular complete revascularization and residual stenosis, and the modified Rankin scale scores at 3 months in both groups were evaluated. Results The rate of complete revascularization in the stent treatment group was significantly higher than that in the drug treatment group (54. 5% vs.0%,χ2 =6.382, P <0. 001), and the rate of residual stenosis was significantly lower than that in the drug treatment group ([4.5 ±5.2]% vs. [82. 5 ±10. 5]%, t =7.464, P<0.001). The rate of favorable clinical outcome in the stent treatment group was significantly higher than that in the drug treatment group (100% vs. 76. 9%,χ2 = 14. 263, P = 0.038). Conclusion The efficacy of intra-arterial thrombolysis with stenting in the treatment of acute cerebral infarction is superior to that in the drug treatment group, and it is safer.

8.
Article in Chinese | WPRIM (Western Pacific) | ID: wpr-413212

ABSTRACT

Objective To observe the dynamic changes of serum inflammatory factors after vertebral artery stenting and to investigate its clinical significance. Methods A total of 48 patients treated with vertebral artery stenting were included, and 48 patients only received cerebral angiography were used as a control group. The levels of soluble intercellular adhesion molecule-1 (sICAM-1), high-sensitivity C-reactive protein (hs-CRP) and tumor-necrosis factor-α (TNF-α) were detected before procedure (angiography), at 24 h, 48 h, 3 d, and 1 and 3 weeks after procedure (angiography). Results The serum levels of hs-CRP (4. 85 ± 0. 53 mg/L vs. 2. 57 ±0. 36 mg/L,P<0. 05), TNF-α (2.42 ±0. 34 μg/L vs. 1. 08 ±0. 37 μg/L,P <0. 05) and sICAM-1 (449.43 ± 47. 16 μg/L vs. 269. 15 ± 37. 46 μg/L, P < 0. 05) at 24 hours after procedure in the stenting group were significantly elevated compared with those before procedure. The Hs-CRP level (6.24 ± 0.59 mg/L) reached the peak at 48 hours after procedure. At week 3 (2. 51 ±0.29 mg/L), it returned to the level before procedure (2. 57 ±0. 36 mg/L); TNF-α level reached the peak at day 3 (2.30 ± 0.25 μg/L), and it remained higher level at week 3 (1. 89 ±0. 13 μg/L); the sICAM-1 level continued to rise at week 3 (296. 95 ± 59. 72 μg/L). The serum hs-CRP, TNF-α and sICAM-1 levels at 24 hours after procedure in the stenting group were significantly higher than those (3. 25 ±0.40 mg/L、J. 18 ±0. 19 μg/L and 336. 57 ± 50. 18μg/L) in the control group (all P<0.05). Conclusions The serum hs-CRP, TNF-α, sICAM-1 levels were significantly elevated after vertebral artery stenting. It was suggested that the stenting caused a longer duration of inflammatory response.

9.
Article in Chinese | WPRIM (Western Pacific) | ID: wpr-623956

ABSTRACT

To study the current situation and affecting factors of bilingual teaching for Neurology,we investigated the students of a five-year medical undergraduade in clinical medicine with a questionaire.It will provide the data and reference to effectively improve bilingual teaching program for Neurology.

10.
Chinese Medical Journal ; (24): 286-289, 2002.
Article in English | WPRIM (Western Pacific) | ID: wpr-308100

ABSTRACT

<p><b>OBJECTIVE</b>To investigate the expression of Toll-like receptor 2 (TLR2) and Toll-like receptor 4 (TLR4) and the effect of lipopolysaccharide (LPS) on their expression in cultured endothelial cells.</p><p><b>METHODS</b>Total RNA was extracted from ECV304 cells and isolated human umbilical vein endothelial cells (HUVECs) exposed to LPS, respectively. The quantification of TLR2 and TLR4 mRNA in HUVECs and EVC304 cells was carried out by reverse transcriptase-polymerase chain reaction (RT-PCR).</p><p><b>RESULTS</b>ECV304 cells and HUVECs were able to express TLR2 and TLR4 mRNA, but the expression levels of TLR4 appeared to be stronger than those of TLR2. LPS could upregulate the expression levels of TLR4 obviously, whereas it had no effect on the expression level of TLR2.</p><p><b>CONCLUSIONS</b>Our data indicate that TLR4 may be the LPS signal transducer in endothelial cells and plays important roles in the cell activation of LPS. The ECV304 cell line is a better experimental model than isolated HUVECs in the research of endothelial cells.</p>


Subject(s)
Humans , Cell Line , Dose-Response Relationship, Drug , Drosophila Proteins , Endothelium, Vascular , Cell Biology , Metabolism , Gene Expression Regulation , Lipopolysaccharides , Pharmacology , Membrane Glycoproteins , Genetics , RNA, Messenger , Genetics , Metabolism , Receptors, Cell Surface , Genetics , Time Factors , Toll-Like Receptor 2 , Toll-Like Receptor 4 , Toll-Like Receptors , Umbilical Veins , Cell Biology , Metabolism , Up-Regulation
11.
Article in Chinese | WPRIM (Western Pacific) | ID: wpr-555962

ABSTRACT

Objective To express and identify of Toll-like receptor 4 (TLR4) extracellular fragment in Pichia pastoris and to provide basis for the related researches. Methods The human TLR4 extracellular cDNA fragment was amplified by PCR and after confirming by DNA sequence analysis, was inserted into the Pichia pastoris expression vector pPIC9K containing AOX1 promoter and lead sequence of ? factor gene to form a pPIC9K/TLR4 extracellular recombinant expression plasmid. The recombinant plasmid was transformed into GS115 and high copies transformants were screened with G418. After being identified by colony PCR, transformants were cultured in flasks and induced by 1% methanol. The expression products were analyzed by SDS-PAGE and were identified by Western blot analysis. Results The sequencing showed that TLR4 extracellular gene was identical to that in Genbank. The analysis for the recombinant plasmid DNA digested by enzyme demonstrated that the recombinant expression plasmids of pPIC9K/TLR4 extracellular were constructed successfully. After screening by G418, 200 high-copy-number of transformants were acquired. The special TLR4 extracellular gene segment was obtained by identification with colony PCR, which showed that TLR4 extracellular gene of 5 clones were inserted into Pichia pastoris. After methanol induction for 4 d, the expression proteins came up to 50.35% of total proteins in medium supernatant as shown by SDS-PAGE. Western blot analysis proved that the expression protein could bind to TLR4 monoclonal antibody specifically. Conclusion TLR4 extracellular protein is expressed and identified successfully by Pichia pastoris system, which can provide basis for the researches of further screening of high expression colony, protein purification, and functional research.

12.
Article in Chinese | WPRIM (Western Pacific) | ID: wpr-552483

ABSTRACT

An immunogenic peptide sequence of B cell dominant epitope of human Toll like receptor 4 (TLR4) was selected basing on predication of B cell epitope of TLR4.bALB/c mice were immunized with synthetic peptide of TLR 4 and one clone (B4) of hybridoma cells was picked out by ELISA and limited dilution. High titer McAb prepasations against TLR 4 were obtained from ascites fluid of BALB/c mice infravenously inoculated with the McAb inducing hybridoma cells.The titer of ascites fluid was 1∶ 100 000 .The subclass of the McAb was IgG2,k.The specificity of McAb was identified. by indirect ELISA,and a single strong blot was shown in molecular weights of 90 Kd.using Western blot analysis.

SELECTION OF CITATIONS
SEARCH DETAIL