ABSTRACT
Flowers are gaining considerable interest among consumers as ingredients in food, beverages, cosmetics, and natural health products. The supply chain trades in multiple forms of botanicals, including fresh whole flowers, which are easier to identify than dried flowers or flowers processed as powdered or liquid extracts. There is a gap in the scientific methods available for the verification of flower species ingredients traded in the supply chains of multiple markets. The objective of this paper is to develop methods for flower species ingredient verification using two orthogonal methods. More specifically, the objectives of this study employed both (1) DNA-based molecular diagnostic methods and (2) NMR metabolite fingerprint methods in the identification of 23 common flower species ingredients. NMR data analysis reveals considerable information on the variation in metabolites present in different flower species, including color variants within species. This study provides a comprehensive comparison of two orthogonal methods for verifying flower species ingredient supply chains to ensure the highest quality products. By thoroughly analyzing the benefits and limitations of each approach, this research offers valuable insights to support quality assurance and improve consumer confidence.
ABSTRACT
Cinnamomum verum (syn C. zeylanicum) is considered 'true' cinnamon. However, it is reported that less expensive sources of cinnamon from C. cassia (syn C. aromaticum), C. loureiroi, and C. burmannii (toxic coumarin) may be used in the place of C. verum. We lack the quality assurance tools that are required to differentiate C. verum from other cinnamon species when verifying that the correct species is sourced from ingredient suppliers. The current research on cinnamon species authentication using DNA tools is limited to a few species and the use of high-quality DNA extracted from raw leaf materials. The cinnamon bark traded in the supply chain contains much less DNA and poorer-quality DNA than leaves. Our research advances DNA methods to authenticate cinnamon, as we utilized full-length chloroplast genomes via a genome skimming approach for C. burmannii and C. cassia to facilitate the design of optimal mini DNA markers. Furthermore, we developed and validated the use of NMR fingerprints for several commercial cinnamon species, including the quantification of 16 molecules. NMR fingerprints provided additional data that were useful for quality assessment in cinnamon extract powders and product consistency. Both the new mini DNA markers and NMR fingerprints were tested on commercial cinnamon products.
ABSTRACT
Authentication of Panax ginseng and Panax quinquefolius products is important to be able to mitigate instances of adulteration and substitution that exist within the international supply chain of ginseng. To address this issue, species-specific hydrolysis probe qPCR assays were developed and validated for both P. ginseng and P. quinquefolius herbal dietary supplements. Performance of the probe-based assays was evaluated using analytical validation criteria, which included evaluation of: (1) specificity, in selectively identifying the target species; (2) sensitivity, in detecting the lowest amount of the target material; and (3) repeatability and reproducibility of the method in detecting the target species in raw materials on a real-time PCR platform (reliability). The species-specific probes were developed and successfully passed the validation criteria with 100% specificity, 80-120% efficiency and 100% reliability. The methods developed in this study are fit for purpose, rapid, and easy to implement in quality assurance programs; authentication of ginseng herbal supplements is possible, even with extracts where DNA is fragmented and of low quality and quantity.
ABSTRACT
The COVID-19 pandemic has generated increased interest in potential transmission routes. In food retail settings, transmission from infected customers and workers and customers through surfaces has been deemed plausible. However, limited information exists on the presence and survival of SARS-CoV-2 on surfaces, particularly outside laboratory settings. Therefore, the purpose of this project was to assess the presence of the virus at commonly found surfaces at food retail stores and the potential role that these spaces play in virus transmission. Samples (n=957) were collected twice a week for a month in food-retail stores within Ontario, Canada. High-touch surfaces were identified and surveyed in 4 zones within the store (payment stations, deli counters, refrigerated food section and carts and baskets). The samples were analyzed using a molecular method, i.e., reverse transcriptase quantitative Polymerase Chain Reaction (RT-qPCR). Regardless of the store's location, the sampling day or time, the location of the surface within the store or the surface material, all samples tested negative for SARS-CoV-2. These results suggest that the risk of exposure from contaminated high-touch surfaces within a food retailer store is low if preventive measures and recommended sanitizing routines are maintained.
ABSTRACT
Several botanicals have been traditionally used as protein sources, including the leguminous Pisum sativum L. and Glycine max (L.) Merr. While a rich history exists of cultivating these plants for their whole, protein-rich grain, modern use as powdered supplements present a new challenge in material authentication. The absence of clear morphological identifiers of an intact plant and the existence of long, complex supply chains behoove industry to create quick, reliable analytical tools to identify the botanical source of a protein product (many of which contain multiple sources). The utility of molecular tools for plant-based protein powder authentication is gaining traction, but few validated tools exist. Multiplex quantitative polymerase chain reaction (qPCR) can provide an economical means by which sources can be identified and relative proportions quantified. We followed established guidelines for the design, optimization, and validation of qPCR assay, and developed a triplex qPCR assay that can amplify and quantify pea and soy DNA targets, normalized by a calibrator. The assay was evaluated for analytical specificity, analytical sensitivity, efficiency, precision, dynamic range, repeatability, and reproducibility. We tested the quantitative ability of the assay using pea and soy DNA mixtures, finding exceptional quantitative linearity for both targets - 0.9983 (p < 0.0001) for soy and 0.9915 (p < 0.0001) for pea. Ratios based on mass of protein powder were also tested, resulting in non-linear patterns in data that suggested the requirement of further sample preparation optimization or algorithmic correction. Variation in fragment size within different lots of commercial protein powder samples was also analyzed, revealing low SD among lots. Ultimately, this study demonstrated the utility of qPCR in the context of protein powder mixtures and highlighted key considerations to take into account for commercial implementation.
ABSTRACT
Plant-associated bacteria can establish mutualistic relationships with plants to support plant health. Plant tissues represent heterogeneous niches with distinct characteristics and may thus host distinct microbial populations. The objectives of this study are to investigate the bacterial communities associated with two medicinally and commercially important plant species; Ginkgo biloba and Panax quinquefolius using high Throughput Sequencing (HTS) of 16S rRNA gene, and to evaluate the extent of heterogeneity in bacterial communities associated with different plant niches. Alpha diversity showed that number of operational taxonomic units (OTUs) varied significantly by tissue type. Beta diversity revealed that the composition of bacterial communities varied between tissue types. In Ginkgo biloba and Panax quinquefolius, 13% and 49% of OTUs, respectively, were ubiquitous in leaf, stem and root. Proteobacteria, Bacteroidetes, Actinobacteria and Acidobacteria were the most abundant phyla in Ginkgo biloba while Proteobacteria, Bacteroidetes, Actinobacteria, Plantomycetes and Acidobacteria were the most abundant phyla in Panax quinquefolius. Functional prediction of these bacterial communities using MicrobiomeAnalyst revealed 5843 and 6251 KEGG orthologs in Ginkgo biloba and Panax quinquefolius, respectively. A number of these KEGG pathways were predicted at significantly different levels between tissues. These findings demonstrate the heterogeneity, niche specificity and functional diversity of plant-associated bacteria.
Subject(s)
Bacteria/classification , Ginkgo biloba/microbiology , Panax/microbiology , RNA, Ribosomal, 16S/genetics , Sequence Analysis, DNA/methods , Bacteria/genetics , Bacteria/isolation & purification , DNA, Bacterial/genetics , DNA, Ribosomal/genetics , High-Throughput Nucleotide Sequencing , Phylogeny , Plant Leaves/microbiology , Plant Roots/microbiology , Plant Stems/microbiologyABSTRACT
The demand for popular natural health products (NHPs) such as Black Cohosh is increasing considerably, which in turn challenges quality assurance (QA) throughout the supply chain. To detect and quantify the target species present in a given NHP, DNA-based molecular techniques such as Real-time quantitative PCR (qPCR) and digital PCR (dPCR) are standard tools in the food and pathogen testing industries. There is a gap in the literature concerning validated quantitative PCR methods for botanicals that can be utilized for QA and good manufacturing practices. The objective of this study is to develop an efficient quantification method using qPCR and dPCR techniques for the detection and quantification of Actaea racemosa (Black cohosh) NHPs from its potential adulterants. These developed methods are validated for applicability on commercial NHPs. Species-specific hydrolysis probe assays were designed to analyze the black cohosh NHPs using qPCR and dPCR techniques. The results confirmed that the developed qPCR and dPCR methods are highly precise for identifying and quantifying black cohosh NHPs, indicating their potential applicability in future routine industrial and laboratory testing. This enables a single qPCR test to determine not only the presence of a specific botanical, but also the amount when mixed with an adulterant.
Subject(s)
Cimicifuga/classification , Cimicifuga/genetics , Plants, Medicinal/classification , Plants, Medicinal/genetics , DNA Contamination , DNA, Plant , Ethnobotany/methods , Ethnobotany/standards , Polymerase Chain Reaction/methodsABSTRACT
DNA barcoding is an emerging molecular identification and classification technology that has been applied to medicinal plants since 2008. The application of this technique has greatly ensured the safety and effectiveness of medicinal materials. In this paper, we review the application of DNA barcoding and some related technologies over the past 10 years with respect to improving our knowledge of medicinal plant identification and authentication. From single locus-based DNA barcodes to combined markers to genome-scale levels, DNA barcodes contribute more and more genetic information. At the same time, other technologies, such as high-resolution melting (HRM), have been combined with DNA barcoding. With the development of next-generation sequencing (NGS), metabarcoding technology has also been shown to identify species in mixed samples successfully. As a widely used and effective tool, DNA barcoding will become more useful over time in the field of medicinal plants.
Subject(s)
DNA Barcoding, Taxonomic/methods , DNA, Plant/genetics , Plants, Medicinal/genetics , High-Throughput Nucleotide SequencingABSTRACT
BACKGROUND: Actaea racemosa (black cohosh) herbal dietary supplements are commonly used to treat menopausal symptoms in women. However, there is a considerable risk of contamination of A. racemosa herbal products in the natural health product (NHP) industry, impacting potential efficacy. Authentication of A. racemosa products is challenging because of the standard, multi-part analytical chemistry methods that may be too costly and not appropriate for both raw and finished products. OBJECTIVE: In this paper, we discuss developing and validating quick alternative biotechnology methods to authenticate A. racemosa herbal dietary supplements, based on the use of a species-specific hydrolysis PCR probe assay. METHODS: A qPCR-based species-specific hydrolysis probe assay was designed, validated, and optimized for precisely identifying the species of interest using the following analytical validation criteria: (1) specificity (accuracy) in determining the target species ingredient, while not identifying other non-target species; (2) sensitivity in detecting the smallest amount of the target material; and (3) reliability (repeatability and reproducibility) in detecting the target species in raw materials on a real-time PCR platform. RESULTS: The results show that the species-specific hydrolysis probe assay was successfully developed for the raw materials and powders of A. racemosa. The specificity of the test was 100% to the target species. The efficiency of the assay was observed to be 99%, and the reliability of the assay was 100% for the raw/starting and powder materials. CONCLUSION: The method developed in this study can be used to authenticate and perform qualitative analysis of A. racemosa supplements.
Subject(s)
Cimicifuga , Drug Contamination , Female , Humans , Plant Extracts , Real-Time Polymerase Chain Reaction , Reproducibility of Results , Species SpecificityABSTRACT
The broad spectrum of health benefits attributed to probiotics has contributed to a rapid increase in the value of the probiotic market. Probiotic health benefits can be strain specific. Thus, strain-level identification of probiotic strains is of paramount importance to ensure probiotic efficacy. Both Lactobacillus gasseri BNR17 and Lactobacillus reuteri LRC (NCIMB 30242) strains have clinically proven health benefits; however, no assays were developed to enable strain-level identification of either of these strains. The objective of this study is to develop strain-specific PCR-based methods for Lactobacillus gasseri BNR17 and Lactobacillus reuteri LRC strains, and to validate these assays according to the guidelines for validating qualitative real-time PCR assays. Using RAST (Rapid Annotation using Subsystem Technology), unique sequence regions were identified in the genome sequences of both strains. Probe-based assays were designed and validated for specificity, sensitivity, efficiency, repeatability, and reproducibility. Both assays were specific to target strain with 100% true positive and 0% false positive rates. Reaction efficiency for both assays was in the range of 90 to 108% with R square values > 0.99. Repeatability and reproducibility were evaluated using five samples at three DNA concentrations each and relative standard deviation was < 4% for repeatability and < 8% for reproducibility. Both of the assays developed and validated in this study for the specific identification of Lactobacillus gasseri BNR17 and Lactobacillus reuteri LRC strains are specific, sensitive, and precise. These assays can be applied to evaluate and ensure compliance in probiotic products.
Subject(s)
Lactobacillus gasseri , Limosilactobacillus reuteri , Probiotics , Real-Time Polymerase Chain Reaction , Lactobacillus gasseri/genetics , Lactobacillus gasseri/isolation & purification , Limosilactobacillus reuteri/genetics , Limosilactobacillus reuteri/isolation & purification , Reproducibility of ResultsABSTRACT
In response to the need from the food industry for new analytical solutions, a fit-for-purpose quantitative 1H NMR methodology was developed to authenticate pure coffee (100% arabica or robusta) as well as predict the percentage of robusta in blends through the study of 292 roasted coffee samples in triplicate. Methanol was chosen as the extraction solvent, which led to the quantitation of 12 coffee constituents: caffeine, trigonelline, 3- and 5-caffeoylquinic acid, lipids, cafestol, nicotinic acid, N-methylpyridinium, formic acid, acetic acid, kahweol, and 16-O-methylcafestol. To overcome the chemical complexity of the methanolic extract, quantitative analysis was performed using a combination of traditional integration and spectral deconvolution methods. As a result, the proposed methodology provides a systematic methodology and a linear regression model to support the classification of known and unknown roasted coffees and their blends.
Subject(s)
Coffea/chemistry , Magnetic Resonance Spectroscopy/methods , Alkaloids/analysis , Caffeine/analysis , Coffea/classification , Coffee/chemistry , Cooking , Discriminant Analysis , Diterpenes/analysis , Food Contamination/analysis , Seeds/chemistry , Seeds/classificationABSTRACT
Sarsaparilla is a popular natural health product (NHP) that has been reported to be one of the most adulterated botanicals in the marketplace. Several plausible explanations are documented including economically motivated product substitution, unintentional errors due to ambiguous trade name associated with several different taxa, and wild harvesting of incorrect non-commercial plants. Unfortunately, this includes the case of an adulterant species Decalepis hamiltonii, a Red listed medicinal plant species by the International Union for Conservation of Nature (IUCN) and declared as a species with high conservation concern by the National Biodiversity Authority of India (NBA). This study provides validated genomic (genome skimming & DNA probes) and metabolomic (NMR chemical fingerprints) biotechnology solutions to prevent adulteration on both raw materials and finished products. This is also the first use of Oxford Nanopore on herbal products enabling the use of genome skimming as a tool for quality assurance within the supply chain of botanical ingredients. The validation of both genomics and metabolomics approach provided quality assurance perspective for both product identity and purity. This research enables manufactures and retailers to verify their supply chain is authentic and that consumers can enjoy safe, healthy products.
Subject(s)
Genome, Plant , Plants, Medicinal/genetics , Quality Control , Smilax/genetics , DNA Barcoding, Taxonomic , Drug Contamination , Genomics , Metabolomics , PhytotherapyABSTRACT
Plant-based protein powders are rapidly growing in popularity, and outdated quality assurance tools expose vulnerabilities to adulteration via different methods of "protein spiking". Adequate diagnostic tools are urgently needed to be able to authenticate protein source ingredients and screen for potential adulterants. We explored the application of three diagnostic tools for ingredient identification: targeted PCR with Sanger sequencing, NGS, and LC-MS/MS. We collected 33 samples of common commercial products from the plant-based protein powder market and sought to identify botanical components using the three technologies. We found success in detection with all approaches, with at least one main protein source being identified by at least one approach in all samples. The investigation uncovered challenges to data collection or result interpretation with each technology including but not limited to amplification biases with PCR technologies, potential influence of DNA degradation, and issues with protein solubility during isolation. Ultimately, each platform demonstrated utility along with certain caveats, which epitomized the importance of orthogonality of testing.
Subject(s)
Dietary Supplements/analysis , High-Throughput Nucleotide Sequencing , Plant Proteins/analysis , Polymerase Chain Reaction , Powders/analysis , Tandem Mass Spectrometry , Chromatography, Liquid , DNA, Plant/analysis , Food Contamination/analysis , Food, Genetically Modified , Plant Proteins/genetics , Plants/chemistry , Plants/genetics , Plants/metabolismABSTRACT
OBJECTIVES: The aim of this study was to explore the variability in DNA quality and quantity along a gradient of industrial processing of botanical ingredients from raw materials to extracts. METHODS: A data matrix was assembled for 1242 botanical ingredient samples along a gradient of industrial processing commonly used in the Natural Health Product (NHP) industry. Multivariate statistics was used to explore dependant variables for quality and quantity. The success of attaining a positive DNA test result along a gradient of industrial processing was compared among four biotechnologies: DNA barcoding, NGS, Sanger sequencing and qPCR. RESULTS: There was considerable variance in DNA quality and quantity among the samples, which could be interpreted along a gradient from raw materials with greater quantities (50-120 ng/µL) of DNA and longer DNA (400-500bp) sequences to extracts, which were characterized by lower quantities (0.1-10.0 ng/µL) and short fragments (50-150bp). CONCLUSIONS: Targeted molecular diagnostic tests for species identity can be used in the NHP industry for raw and processed samples. Non-targeted tests or the use of NGS for any identity test needs considerable research and development and must be validated before it can be used in commercial operations as these methods are subject to considerable risk of false negative and positive results. Proper use of these tools can be used to ensure ingredient authenticity, and to avert adulteration, and contamination with plants that are a health concern. Lastly these tools can be used to prevent the exploitation of rare herbal species and the harvesting of native biodiversity for commercial purposes.
ABSTRACT
Background: Although there has been some success using DNA barcoding to authenticate raw natural health product (NHP) botanical ingredients, there are many gaps in our understanding of DNA degradation, which may explain low PCR and sequencing success in processed NHPs. Objective: In this study, we measured multiple DNA variables after each step in the processing of a green tea extract in order to document DNA quality and quantity. Methods: We sampled plant material after each step of green tea extract processing: five steps at a Chinese tea farm (n = 10) and five at an NHP processing facility (n = 3). We hypothesized that processing treatments degrade and remove DNA from NHPs, reflected by decreasing quantities of extractable genomic DNA (gDNA), an increasing proportion of small DNA fragments in genomic extracts, and decreasing quantitative PCR (QPCR) efficiency [higher cycle threshold (Ct) values]. DNA from end-production green tea extract was sequenced in order to try to validate material as the botanical of interest. Results: We saw a 41.1% decrease in mean extractable gDNA through farm processing (P < 0.01) and a 99.7% decrease through facility processing (P < 0.05). There was a 26.3% decrease in mean DNA fragment size through farm processing (P < 0.001) and an 82.0% decrease through facility processing (P < 0.05). QPCR efficiency was reduced through processing, marked by significant increases in Ct values with 100 base pair (bp) and 200 bp PCR targets (P < 0.05), and an inability to amplify 300 bp targets when using DNA template from end-production green tea extract. Conclusions: Although there was significant degradation and removal of DNA through processing, sufficiently intact DNA was able to be recovered from highly processed green tea extract for further sequencing and identification. Highlights: This work addresses a key gap in the understanding of DNA degradation through processing and provides useful information to consider when designing molecular diagnostic techniques for NHP identification.
Subject(s)
Camellia sinensis/chemistry , DNA Damage , DNA, Plant/analysis , DNA, Plant/genetics , Plant Extracts/analysis , Plant Leaves/chemistry , Food Handling , Real-Time Polymerase Chain Reaction , Sequence Analysis, DNAABSTRACT
Background: There is considerable risk of adulteration of Ginkgo biloba herbal products in the natural health product (NHP) industry. Authentication of G. biloba products is challenging because of the standard, complex, analytical chemistry methods that may be too costly and not appropriate for both raw and finished products. Objective: We sought to develop and validate an alternative method to authenticate G. biloba herbal dietary supplements, based on the use of a species-specific hydrolysis PCR probe assay. Methods: A species-specific hydrolysis probe assay was developed, validated, and evaluated for the performance of the assay in accurately identifying the species of interest using the following analytical validation criteria: (1) specificity (accuracy) in identifying the target species ingredient, while not identifying other nontarget species, (2) sensitivity in detecting the smallest amount of the target material, and (3) reliability (repeatability and reproducibility) in detecting the target species in raw materials on a real-time PCR platform. Results: The species-specific hydrolysis probe assay was successfully developed for raw materials of G. biloba. The specificity of the assay was 100% to the target species. Efficiency of the assay was observed to be 99%, and the reliability of the assay was 100% for the raw/starting materials. Conclusions and Highlights: The method developed in this study is simple, rapid, and easy for supplement manufacturers to perform in their laboratories to ensure that their G. biloba supplements are authentic.
Subject(s)
Dietary Supplements/analysis , Food Contamination/analysis , Ginkgo biloba/chemistry , Real-Time Polymerase Chain Reaction/methods , DNA/analysis , DNA/isolation & purification , Hydrolysis , Plant Bark/chemistry , Plant Leaves/chemistry , Plant Roots/chemistry , Reproducibility of Results , Wood/chemistryABSTRACT
Backgroud: Probiotics have been shown to benefit human health through several mechanisms, including their role in improving the health of our gastrointestinal tracts. The health benefits of probiotics are strain specific, and therefore it is critical to include the correct strains in probiotic products when claiming specific health benefits. Several studies have reported issues concerning the accuracy of labeling of commercial probiotic products, including inaccurate taxonomy, missing species, or undeclared species. Consequently, there is a growing need to develop and validate assays to reliably verify strain identity in commercial probiotic products. PCR-based methods are the most commonly used methods for food species ingredient diagnostics because they are simple, fast, sensitive, and can be validated. Objective: The aim of this paper is to set the guidelines for validating targeted qualitative real-time PCR assays to verify the presence of specific strains in a probiotic supplement. Methods and Results: Qualitative real-time PCR assays are validated to evaluate the assay performance in terms of specificity, sensitivity, repeatability, and reproducibility in detecting target strains. Conclusions and Highlights: Setting these guidelines will facilitate and streamline the validation process for qualitative real-time PCR-based assays for probiotic identity authentication in support of quality assurance systems.
Subject(s)
Bacteria/isolation & purification , Probiotics/analysis , Real-Time Polymerase Chain Reaction/standards , Food Microbiology/standards , Reproducibility of ResultsABSTRACT
Background: PCR methods are the most commonly used DNA-based identity tool in the commercial food, beverage, and natural health product markets. These methods are routinely used to identify foodborne pathogens and allergens in food. Proper validation methods for some sectors have been established, while there are none in other markets, such as botanicals. Results: A survey of the literature indicates that some validation criteria are not addressed when developing PCR tests for botanicals. Objective: We provide recommendations for qualitative real-time PCR methods for validating identity tests for botanical ingredients. Methods: These include common criteria that underpin the development and validation of rigorous tests, including (1) the aim of the validation test, (2) the applicability of different matrix variants, (3) specificity in identifying the target species ingredient, (4) sensitivity in detecting the smallest amount of the target material, (5) repeatability of methods, (6) reproducibility in detecting the target species in both raw and processed materials, (7) practicability of the test in a commercial laboratory, and (8) comparison with alternative methods. In addition, we recommend additional criteria, according to which the practicability of the test method is evaluated by transferring the method to a second laboratory and by comparison with alternative methods. Conclusions and Highlights: We hope that these recommendations encourage further publication on the validation of PCR methods for many botanical ingredients. These properly validated PCR methods can be developed on small, real-time biotechnology that can be placed directly into the supply chain ledger in support of highly transparent data systems that support QC from the farm to the fork of the consumer.
Subject(s)
Plant Preparations/analysis , Real-Time Polymerase Chain Reaction/standards , Plants/chemistry , Reproducibility of ResultsABSTRACT
Global concerns have been paid to the potential hazard of traditional herbal medicinal products (THMPs). Substandard and counterfeit THMPs, including traditional Chinese patent medicine, health foods, dietary supplements, etc. are potential threats to public health. Recent marketplace studies using DNA barcoding have determined that the current quality control methods are not sufficient for ensuring the presence of authentic herbal ingredients and detection of contaminants/adulterants. An efficient biomonitoring method for THMPs is of great needed. Herein, metabarcoding and single-molecule, real-time (SMRT) sequencing were used to detect the multiple ingredients in Jiuwei Qianghuo Wan (JWQHW), a classical herbal prescription widely used in China for the last 800 years. Reference experimental mixtures and commercial JWQHW products from the marketplace were used to confirm the method. Successful SMRT sequencing results recovered 5416 and 4342 circular-consensus sequencing (CCS) reads belonging to the ITS2 and psbA-trnH regions. The results suggest that with the combination of metabarcoding and SMRT sequencing, it is repeatable, reliable, and sensitive enough to detect species in the THMPs, and the error in SMRT sequencing did not affect the ability to identify multiple prescribed species and several adulterants/contaminants. It has the potential for becoming a valuable tool for the biomonitoring of multi-ingredient THMPs.
ABSTRACT
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.