The rs1008562, rs2234671, and rs3138060 polymorphisms of the CXCR1 gene are associated with breast cancer risk in a Mexican population.

OBJECTIVE: The rs1008562, rs2234671 and rs3138060 polymorphisms of the CXCR1 gene have been shown to be associated with many diseases, but in breast cancer (BC) their association has not been detected. The purpose of this study was to determine the frequency and association of the rs1008562, rs2234671 and rs3138060 polymorphisms of CXCR1 gene in BC patients in the Mexican population. PATIENTS AND METHODS: The CXCR1 polymorphisms were determined by Polymerase Chain Reaction (PCR) and real time-PCR in healthy Mexican subjects and BC patients. RESULTS: The prevalent patron in BC patients was observed, the majority were overweight and obesity (72%) with metastatic lymph nodes (48%), luminal A/B subtypes (63%), and advanced stages (60%). Triple negative breast cancer (TNBC) patients: they were younger (58%) than 43 years old, overweight (33%), obesity (42%), ductal type histological (98%), metastasis to lymph nodes (47%), advanced stages III-IV (61%) and metastasis (33%). The rs2234671 polymorphism was associated with BC susceptibility when BC patients and the control group were compared for the CC genotype (p=0.037), CG (heterozygous model: p=0.018), GC/CC (dominant model: p=0.004), and the C allele (p=0.001), as well as the GC/CC genotype with hormone replace therapy (HRT, p=0.016). The rs3138060 polymorphism was associated with BC susceptibility for CG/GG genotype (dominant model: p=0.032) and G allele (p=0.018). Although the association between the dominant model of rs1008562, rs2234671, rs3138060 polymorphisms and BC patients and control was evident for tobacco and alcohol consumption (p<0.05). The rs1008562, rs2234671, and rs3138060 polymorphisms of the CXCR1 gene classified by molecular subtype and stage were also associated with BC patients, indicating that these factors may significantly contribute to BC risk. The CCC (OR 1.75, 95% CI 1.03- 2.97, p=0.046), GGG (OR 3.73, 95% CI 1.61- 8.65, p=0.0018) haplotypes were also associated with BC susceptibility. CONCLUSIONS: Rs2234671 and rs3138060 polymorphisms in the CXCR1 gene were associated with BC susceptibility in the Mexican population. The dominant model of the rs1008562, rs2234671 and rs3138060 polymorphisms could significantly contribute to BC risk in tobacco and alcohol consumption, molecular subtype and stage. The rs1008562, rs2234671 and rs3138060 polymorphisms, and the haplotypes CCC and GGG could significantly contribute to BC risk in the Mexican population analyzed.

The ERBB2 gene polymorphisms rs2643194, rs2934971, and rs1058808 are associated with increased risk of gastric cancer.

Gastric cancer (GC) is the third most lethal type of cancer worldwide. Single nucleotide polymorphisms (SNPs) in regulatory sites or coding regions can modify the expression of genes involved in gastric carcinogenesis, as ERBB2, which encodes for the tyrosine-kinase receptor HER-2. The aim of this work was to analyze the association of the polymorphisms: rs2643194, rs2517951, rs2643195, rs2934971, and rs1058808 with GC, as they have not yet been analyzed in GC patients, as well as to report their frequency in the general Mexican population (GMP). We studied genomic DNA from subjects with GC (n=74), gastric inflammatory diseases (GID, n=76 control subjects), and GMP (n=102). Genotypes were obtained by means of real-time PCR and DNA-sequencing. The risks for GC were estimated through odds ratio (OR) using the Cochran-Armitage trend test and multinomial logistic regression. Increased risk for GC was observed under the dominant inheritance model for the rs2643194 TT or CT genotypes with an OR of 2.75 (95%CI 1.12-6.75, P=0.023); the rs2934971 TT or GT genotypes with an OR of 2.41 (95%CI 1.01-5.76, P=0.043), and the rs1058808 GG or CG genotypes with an OR of 2.21 (95%CI 1.00-4.87, P=0.046). The SNPs rs2643194, rs2934971, and rs1058808 of the ERBB2 gene were associated with increased risk for GC.

The ERBB2 gene polymorphisms rs2643194, rs2934971, and rs1058808 are associated with increased risk of gastric cancer

Gastric cancer (GC) is the third most lethal type of cancer worldwide. Single nucleotide polymorphisms (SNPs) in regulatory sites or coding regions can modify the expression of genes involved in gastric carcinogenesis, as ERBB2, which encodes for the tyrosine-kinase receptor HER-2. The aim of this work was to analyze the association of the polymorphisms: rs2643194, rs2517951, rs2643195, rs2934971, and rs1058808 with GC, as they have not yet been analyzed in GC patients, as well as to report their frequency in the general Mexican population (GMP). We studied genomic DNA from subjects with GC (n=74), gastric inflammatory diseases (GID, n=76 control subjects), and GMP (n=102). Genotypes were obtained by means of real-time PCR and DNA-sequencing. The risks for GC were estimated through odds ratio (OR) using the Cochran-Armitage trend test and multinomial logistic regression. Increased risk for GC was observed under the dominant inheritance model for the rs2643194 TT or CT genotypes with an OR of 2.75 (95%CI 1.12−6.75, P=0.023); the rs2934971 TT or GT genotypes with an OR of 2.41 (95%CI 1.01−5.76, P=0.043), and the rs1058808 GG or CG genotypes with an OR of 2.21 (95%CI 1.00−4.87, P=0.046). The SNPs rs2643194, rs2934971, and rs1058808 of the ERBB2 gene were associated with increased risk for GC.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ß-Thalassemia in Mexican mestizo patients.

INTRODUCTION: Beta-thalassemia (ß-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. METHODS: One hundred and forty-nine ß-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δß-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. RESULTS: Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δß-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. CONCLUSION: Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of ß-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans.

Association between the CDH1-472delA and -160C>A polymorphisms and diffuse and intestinal gastric cancer in a Mexican population.

Gastric cancer (GC), the third leading cause of cancer-related deaths in Mexico and worldwide, can be classified into diffuse (DGC) or intestinal (IGC) types based on its histological characteristics. DGC is characterized by reduced expression of the cell adhesion protein E-cadherin, which is encoded by CDH1. The -472delA (rs5030625) and -160C>A (rs16260) polymorphisms in CDH1 induce a decrease in gene transcription; in fact, these mutated alleles have been associated with GC in some populations, with conflicting results. The aim of this study was to determine the association between the CDH1 -472delA and -160C>A polymorphisms and DGC and IGC in Mexican patients. The study was conducted in 24, 23, 48, and 93 individuals with DGC and IGC, without GC (control), and belonging to the general Mexican population (GMP), respectively. The genotypes were obtained by polymerase chain reaction - restriction fragment length polymorphism and the obtained data analyzed using Arlequin 3.1. The frequencies of the mutated allele (A) of -472delA were 0.326, 0.318, 0.284, and 0.296 in the DGC, IGC, control, and GMP groups, respectively, and those of the -160C>A polymorphism were 0.174, 0.318, 0.313, and 0.280, respectively. The genotype and allele frequencies of the two polymorphisms did not differ significantly (P > 0.05) among DGC, IGC, and control subjects. Therefore, we concluded that the CDH1 -472delA and -160C>A polymorphisms are not associated with DGC or IGC in patients from western Mexico.

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

INTRODUCTION: Alpha-thalassemia (α-thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α-thal and beta-thalassemia (ß-thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α- and ß-thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2 . METHODS: Common deletional alleles (-α(3.7) , -α(4.2) , - -(SEA) , - -(MED) , - -(FIL) , - -(THAI) , -α(20.5) ) and α-triplication were studied by gap-PCR and nondeletional alleles (α(IVSI) ((-5nt)) , α2 (NcoI) , α1 (NcoI) ) by ARMS. ß-thal alleles Cd39 (C>T), IVS1:1 (G>A), IVS1:110 (G>A), and Spanish δß-thal were also investigated. DNA sequencing was performed on HBA2, HBA1, and HBB genes. Negative samples were subjected to MLPA. RESULTS: In 35 subjects, we identified the mutations, -α(3.7) , - -(SEA) , - -(FIL) , α(IVSI) ((-5nt)) , and ααα(anti3.7) and two novel deletion alleles - -(Mex1) (6.8-8.9 kb) and - -(Mex2) (77.6-135.7 kb). Four individuals also had a ß-thal allele (Cd39/IVS1:110). No α-thal alleles were observed in 16 subjects, but three had a ß-thal mutation Cd39, IVS1:110, and Spanish δß-thal. CONCLUSION: α-thal is relatively common in Mexican patients, the combination with ß-thal is sometimes unexpected, and this underlines the importance of performing molecular analysis for both α- and ß-genes defects in patients showing microcytic hypochromic anemia.

Epidermal growth factor receptor expression in gastric tumors and its relationship with the germline polymorphisms - 216 G>T, -191 C>A, (CA) n IVS1, and R521K.

BACKGROUND: Gastric cancer (GC) is the third worldwide leading cause of cancer-related death affecting both sexes. The aberrant expression of epidermal growth factor receptor (EGFR) gene has been detected in many human epithelial malignancies and linked to advanced disease, more aggressive phenotype, and poor prognosis. AIMS: To analyze the relation that the expression of EGFR in gastric tumors holds with pathological characteristics and with the germline polymorphisms -216 G>T, -191 C>A, (CA) n IVS1, and R521K. MATERIALS AND METHODS: We studied 22 biopsies from gastric tumors obtained by endoscopy. EGFR expression was determined by relative quantification real-time polymerase chain reaction with the glyceraldehyde-3-phosphate dehydrogenase reference gene (as for messenger RNA [mRNA]) and by immunohistochemistry (IHC) (as for protein). EGFR germline polymorphisms were analyzed by sequencing, GeneScan, and restriction fragment length polymorphisms. RESULTS: EGFR mRNA expression was increased (>2-fold) in 13.6% of GC cases, decreased (<0.5-fold) in 68.2%, and normal in 18.2%; overexpression was related to well-differentiated gastric tumors, whereas underexpression was linked to moderate or poorly differentiated gastric tumors (P < 0.001). EGFR protein expression was high (IHC 2+ and 3+) in 29.4% of gastric tumors and was normal or low (score 0 to 1+) in 70.6% cases. EGFR expression, in both mRNA and protein, was not related to any EGFR polymorphism (P > 0.05). CONCLUSIONS: Most gastric tumors showed low EGFR expression (mRNA and protein), whereas EGFR overexpression was related to well-differentiated gastric tumors. Furthermore, germinal polymorphisms -216, -191, (CA) n IVS1, and R521K were not related to EGFR expression (mRNA or protein).

EGFR gene polymorphisms -216G>T and -191C>A are risk markers for gastric cancer in Mexican population.

Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein with tyrosine-kinase activity that plays an important role in multiple cellular functions. EGFR overexpression has been observed in several types of tumors and it is significantly associated with disease stage, survival, prognosis, and progression of cancer. The polymorphisms -216G>T, -191C>A, and (CA)n first intervening sequence (IVS1) have been related to EGFR overexpression and have been studied in several types of cancer, but not in gastric cancer (GC). The aim of this study was to determine the association of these 3 polymorphisms and GC. Genomic DNA from 68 GC patients and 102 healthy blood donors were analyzed. Polymorphisms were identified by DNA-sequencing (-216G>T and -191C>A) and GeneScan (CA)n IVS1. The results showed that the distribution of the -216G>T and -191C>A genotypes differed between groups (P < 0.05). The odds ratio for the -216TT genotype was 4.59 (95% confidence interval = 1.55-13.54, P < 0.05) and 10.71 (95% confidence interval = 2.31-49.59, P < 0.05) for the -191AA genotype, both in a recessive model. The genotype and allele distributions of the (CA)n IVS1 repeat was similar in both groups. In conclusion, the -216TT and -191AA genotypes and GA haplotype of the EGFR gene were found to be associated with an increased risk of gastric cancer in a Mexican population.

5' and 3' ß-globin haplotypes in purepechas and Tarahumaras, two Mexican indigenous groups.

OBJECTIVE: The purpose of this study was to determine the ß-globin cluster haplotype variability of two Mexican indigenous groups-Purepechas (PUR) and Tarahumaras (TAR)-and their relationship with other world populations. METHODS: The 5' and 3' haplotypes (Hp) of the ß globin cluster in 71 PUR and 53 TAR individuals were analyzed. Five polymorphisms in the 5'Hp (ε, (G) γ, (A) γ, 5'ψß and 3'ψß) and five in the 3'Hp (IVS2: 16, 46, 74, 81 and 3' end +339) were identified by restriction enzymes and direct DNA sequencing. 5'Hp and 3'Hp frequencies in PUR and TAR were compared with reported frequencies from 47 and 10 worldwide populations, respectively. RESULTS: Sixteen different 5'Hps were observed in the indigenous Mexican groups, 11 in each population, with the most common being 5'Hp 1. Eight 3'Hps were detected, seven in PUR and six in TAR, the most frequent being 3'Hp C. Three new 3'Hps were found, A8 (CTGCT) in both populations, C9 (GTGCA) in TAR and E1 (GTTCT) in PUR. The comparative analysis showed that 5'Hp frequencies in PUR were significantly different than those in all populations except the Brazilian-Guarani, while TAR were significantly similar to Aché and North Han Chinese. 3'Hp frequencies were similar between PUR and TAR, as well as with Nuu-Chah-Nulth, Mongolian and Sumatran populations. CONCLUSIONS: The 5'Hp analysis showed great variability in worldwide populations, including PUR and TAR, while 3'Hp frequencies were similar among indigenous Mexican and other populations with Asiatic origins. This suggests that 5'Hp exposes the microevolutionary process of each population and the 3'Hp establishes genetic relationships among populations.

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

We investigated associations between vitamin D receptor (VDR) gene polymorphisms, FokI T>C (rs2228570), BsmI G>A (rs1544410), ApaI G>T (rs7975232), and TaqI T>C (rs731236), with bone mineral density (BMD) in postmenopausal Mexican-Mestizo women. Three hundred and twenty postmenopausal women participated, who were classified according to World Health Organization criteria as non-osteoporotic (Non-OP; N = 88), osteopenic (Opn; N = 144), and osteoporotic (OP; N = 88). BMD measurements at the lumbar (L1-L4) spine and at the left and right femoral neck were obtained by dual-energy X-ray absorptiometry. Single nucleotide polymorphisms (SNPs) were genotyped using real-time polymerase chain reaction and TaqMan probes. Genotype and allelic frequencies of the 4 VDR SNPs were similar among the 3 groups. Polymorphic allele frequencies were as follows: FokI (C) 0.53, 0.49, 0.56; BsmI (A) 0.26, 0.22, 0.23; ApaI (T) 0.43, 0.39, 0.44; TaqI (C) 0.27, 0.22, 0.23 for the Non-OP, Opn, and OP groups, respectively. Although no associations were found between the SNPs and BMD, based on the putative function of the FokI SNP, we constructed, for the first time, the haplotype with the 4 VDR SNPs, and found that the CGGT haplotype differed between the Non- OP and OP groups (21.8 vs 31.8%, P < 0.05). The risk analysis for this haplotype was nearly significant under the dominant model (OR = 1.783, 95%CI = 0.98-3.25, P = 0.058). This result suggests a possible susceptibility effect of the C allele of the FokI SNP for the development of osteoporosis in postmenopausal Mexican-Mestizo women.